Phn lp vi khun kh sulphate (SRB) ng dng trong x l nc thi axit t hot ng khai thc khong sn

Nguyn Th Hi
Trng i hc Khoa hc T nhin Lun vn ThS chuyn ngnh: Vi sinh vt hc; M s: 60 42 40 Ngi hng dn: TS. inh Thy Hng Nm bo v: 2012
Abstract: Nghin cu Acid Mine Drainage (AMD) v cc vn mi trng lin quan. X l AMD bng phng php ha hc, sinh hc. c tnh sinh hc ca Sulfate reducing bacteria (SRB). Phn b ca SRB trong t nhin. a d ng v di truyn ca SRB. c im sinh l ca SRB. Nhu cu dinh dng ca SRB. Cc yu t nh hng ti sinh trng ca SRB. C nh tranh ca SRB vi cc nhm vi khun khc trong mi trng. Nghin cu c im sinh hc ca cc ch ng SRB mi phn lp. Th nghim x l AMD trn m hnh phng th nghi m. Keywords: Sinh vt hc; Nc thi axit; Vi khun; X l nc thi; Phn lp vi khun

Content Chng 1 - TNG QUAN TI LIU 1.1 AMD (Acid Mine Drainage) v cc v n mi trng lin quan 1.1.1 S hnh thnh AMD AMD (Acid Mine Drainage) c hnh thnh khi cc khong sulfide (nh pyrite, FeS 2) trong qung tip xc vi oxy v nc (Brown v cs, 2002).

Hnh 1.1. AMD t khu khai thc qung kim loi Vit Nam Qu trnh oxy ha khong sulfide: FeS2 + 7/2O2 +H2O Fe2+ + 2SO 42- + 2H+ Nh vy AMD c hai im c trng nht l pH thp v hm lng ion kim loi nng cao. 1.1.2. nh hng c a AMD ti mi trng 1.1.2.1. nhim ngun nc do AMD AMD c nh hng lu di i vi cc ngu n nc sng, sui, cng nh cuc sng ca cc sinh vt (ng, th c vt v con ngi) lin quan n nh ng ngun nc ny. Nc b nhim AMD c th c pH thp t 2 n 4,5, gy c vi hu ht cc dng sinh vt sng di nc (Hill, 1974). Ngoi c, cc sinh vt khc nh cn trng, to cng gi m r r t v s lng loi v s lng c th khi pH trong mi trng gi m do AMD (Warner, 1971). 1.1.2.2. nhim t do AMD Hot ng khai thc m v khai thc gy ph hy nhiu vng t qua hng trm nm, trong nhiu vng khng c kh nng ph c hi (Duffield v cs, 2000). 1.1.2.3. Tnh tr ng nhim do AMD Vit Nam Theo bo co nh gi mi trng chin lc Quy ho ch pht tri n ngnh than n nm 2020, c xt n nm 2030, cc mi nguy h i do nhi m nc thi t cc m than thuc Tp on Cng nghip than v Khong sn c t ra mc bo ng. Da trn s liu k khai np ph bo v mi trng i vi nc thi cng nghip ca cc n v thuc ngnh than, tng lng nc thi t m nm 2009 l 38.914.075 m 3. Tuy nhin con s ny cha th phn nh y thc trng v cha th tnh c lng nc ra tri t cc bi thi m. 2011). 1.2 X l AMD

1.2.1 X l AMD bng phng php ha hc Cc cht ha hc thng c s dng x l AMD gm CaCO 3, Ca(OH) 2, Na2CO3 , NaOH v NH3. Tuy phng php ha hc c s dng t lu v c hiu qu nhanh chng nhng tn km v khng an ton, thng gy ra nhng vn nhim th cp ( Skousen v cs, 1996). 1.2.2. X l AMD bng phng php sinh hc 1.2.2.1. C s khoa hc ca cng ngh Vi khun kh sulfate (SRB) l cc vi khun sinh trng k kh, s dng sulfate lm cht nhn in t cui cng oxy ha hydro hay cc hp cht hu c v tn thu nng lng cho mc ch sinh trng (phn ng 1.10). 2CH2O + SO42 + H + H2 S + 2HCO 3 H2S + Me2+ MeS + 2H+ (1.11) (1.10)

1.2.2.3. Cc yu t nh hng t i qu trnh x l AMD bng SRB L quy trnh cng ngh da trn hot ng ca vi sinh vt, qu trnh x l AMD b chi phi bi cc yu t nh hng n tnh cht sinh l, sinh ha ca SRB, c th l: Ngun SRB C cht pH Thnh phn ha hc ca AMD Nhit

1.3. c tnh sinh hc ca SRB SRB l vi khun h hp k kh, s d ng sulfate lm cht nhn in t cu i cng oxy ha cc hp cht hu c n gin v hydro. SRB ph bin trong mi trng k kh, ni chng c vai tr quan tr ng trong c chu trnh lu hunh v chu trnh cacbon (hnh 1.2).

Hnh 1.2. V tr ca SRB trong chu trnh cacbon v lu hunh (Muyzer, Stams, 2008). 1.3.3. c i m sinh l ca SRB 1.3.3.1. Nhu cu dinh dng ca SRB Hu ht SRB c nhu cu dinh dng n gin v sinh trng tt trong mi trng c ngun cacbon/nng lng n nh (Postgate, 1984). Ngu n cacbon v in t thch hp i vi SRB bao gm cc axit hu c m ch ngn nh acetate, lactate, pyruvate v ru (Hao v cs, 1996 Ph thu c vo cch oxy ha cht hu c m SRB c th c phn chia thnh hai nhm trao i cht nh sau (Widdel, 1988): Nhm oxy ha khng hon ton: oxy ha cc hp cht hu c n acetate. Thuc nhm ny ch yu l cc loi thuc chi Desulfovibrio spp. Nhm oxy ha hon ton: Oxy ha cc hp cht hu c (bao gm c acetate) hon ton thnh CO2.. Trong nhm ny c a dng cc loi SRB khc nhau, nh Desulfobacter spp., Desulfobacterium spp., Desulfosarcina spp. SRB th c hin trao i cht oxy ha cc c cht hu c s d ng sulfate lm cht nhn in t cu i cng (Postgate, 1984). S kh sulfate thnh sulfide tiu th 8 in t v cc qu trnh sinh ha thng qua nhi u bc trung gian vi s tham gia ca nhiu enzyme (hnh 1.4) (Fauque v cs, 199; Kremer, Hansen, 1988).

Hnh 1.4. Cc bc kh sulfate SRB v cc enzyme tham gia Ph n ng c th c tm tt nh sau (Peck v Lissolo, 1988): SO42 SO32 HSO 3 HS S2 1.3.3.2. Cc yu t nh hng t i sinh trng ca SRB Nhit , pH, mu i Nng sulfide. Chng 2 NGUYN VT LIU V PHNG PHP NGHIN CU 2.1. Nguyn vt li u Cc mu nc thi Mu nc thi lm giu SRB c thu th p t mt s h thng x l nc thi iu kin k kh ti Qung Ngi, Bnh Dng, v B c Ninh. Mu nc thi AMD th nghim x l trong m hnh phng th nghim c thu th p t m than Trng Kh, Qu ng Ninh. 2.2. Phng php nghin c u 2.2.1. Lm giu v phn lp SRB Lm giu SRB. SRB trong mu nc thi thu th p v c lm giu b ng cch c y vo bnh serum cha mi trng dch th k kh nc ngt cho vi khun kh sulfate (bng 2.1) vi t l 10%, nui trong t m 30oC. Cc l n cy truyn tip theo c tin hnh sau mi 5 7 ngy nui cy theo t l 10% th tch. Qua mi l n cy truyn, s lng SRB trong mu c tng ln. Phn lp SRB. Mu lm giu ln 4 c dng phn lp SRB. Vi c phn lp c tin hnh theo phng php pha long trn dy ng thch bn lng (1%) vi mi trng c thnh phn tng t mi trng dng trong lm giu (Widdel, Bak, 1992). ng th ch bn lng sau khi b sung ngu n vi sinh vt (10%) t mu lm giu c s c kh N2 v t th o ngc ti 30oC trong bng t i. Khun lc n pht trin trong cc ng pha long c tch bng pipet Pasteur v chuyn sang mi trng dch th. 2.2.2 Xc nh iu kin sinh trng ti u Nhit . pH. (1.12)

 mui. Cht cho in t Cht nhn in t 2.2.3. Tch DNA tng s t mu mi trng v chng thun khit DNA t ng s ca mu lm giu v cc mu th nghim x l AMD trn m hnh c tch chit theo phng php do Zhou v cng s (1996) 2.2.4. Phng php i n di bin tnh DGGE

Hnh 2.1. V tr on gen 16S rDNA c s dng trong phn tch DGGE Lactobacillus plantarum (Lopez v cs, 2003). 2.2.5. Gii trnh t gen 16S rDNA v d ng cy phn lo i Gen 16S rDNA ( 1500 bp) ca cc chng SRB thun khit c khu ch i trong ph n ng PCR s d ng cp mi 27F (AGAGTTTGATCCTGGCTCAG) v 1492R (GGTTACCTTGTTACGACT T) ( Weisburg v cs, 1991) 2.2.6. Phn tch ha hc 2.2.6.1. nh lng Fe(II) bng thuc th phenanthrolin (DIN 38406 E1-1, 1983) Nguyn l: O-phenanthrolin ph n ng vi Fe(II) to phc c mu tm trong kho ng pH 3 9, o c bc sng 510 nm. N ng Fe(II) cho php o l 0,01 5 mg/l. Kt qu ca php o c th b nh hng bi ion Mn v Cu. 2.2.6.2. nh lng sulfate (Dinh v cs, 2004) Nguyn l: SO42- kt hp vi Ba2+ to kt ta BaSO4 theo phng trnh: Ba2+ + SO42- BaSO4 kt ta trng. Hm lng sulfate c xc nh thng qua hm lng cht kt ta BaSO4 to thnh. 2.2.6.3. Xc nh nng sulfide (Cord-Ruwisch, 1985) Nguyn l: Ion S2 phn ng vi ion Cu2+ to CuS c mu nu en dng huyn ph, o c nhanh bc sng 480 nm. 2.2.7 Thit k m hnh x l AMD Ngun AMD: Ngun AMD c thu thp t m than Trng Kh Qung Ninh c cc c im l ha nh sau: pH = 4 Nng st = 200 mg/l (tng ng 3,57 mM) Nng sulfate = 1320 mg/l (tng ng 13,75 mM) Gi th: Phoi bo c lt di lp y ca b x l

Ngun vi sinh vt: Dch lm giu SRB sau ln cy truyn th 4 (E1-4) Chu trnh x l:

Hnh 2.2. M hnh x l AMD trong phng th nghim. 1) B iu ha cha AMD u vo; 2) B x l AMD bng SRB; 3) B lng cha nc thi u ra. M hnh x l AMD c hot ng vi ngun c cht cho SRB sinh trng c b sung t bn ngoi l methanol hoc nc thi c hm lng hu c cao. Chng 3 - KT QU V TH O LU N 3.1. Lm giu v phn l p vi khun kh sulfate (SRB) t cc mu nc thi
12

Nng sulfide (mM)

10 8 6 4 2 0 E1-4 E2-4 E3-4

Hnh 3.1. Hm lng sulfide ca cc mu lm giu ln c y truyn th 4 Trn c s , E1-4 c s dng tin hnh phn l p cc ch ng SRB thu n khit.

(a)

(b)

Hnh 3.2. Lm giu v phn l p vi khu n kh sulfate t mu nc th i. ( a) Mu lm giu vi khun SRB E1-4; (b) Khu n l c SRB hnh thnh trong ng th ch bn lng Ba chng SRB c phn lp t ng pha long 108 da trn hnh thi khc nhau ca khun l c (bng 3.1). Bng 3.1. SRB phn lp c t dch lm giu vi mu nc thi E1-4 Tn chng SR2 c im hnh Hnh dng t bo thi khun lc Hnh mi kh 4 Hnh que, c di khc nhau ty cnh, mu en thuc thi gian v iu kin nui cy, kch thc t bo nh nht 13,5 m (hnh 3.3) Hnh mi kh 3 Hnh ovan n hoc xp chui, kch cnh, mu en thc 11,5-2 m (hnh 3.3) Hnh a li 2 Hnh ph y khun, kch thc 12-3 mt, mu en m (hnh 3.3) c i m chuyn ng ca t bo Khng chuyn ng Chuyn ng ch m Chuyn nhanh ng

SR3 SR4

SR2

SR3

SR4

Hnh 3.3. Hnh thi t bo ca ba chng SRB thu n khit phn lp c t mu dch lm giu vi nc thi 3.2. V tr phn lo i c a ba chng SRB d a trn trnh t gen 16S rDNA

Hnh 3.6. Cy phn loi neibourgh joining da trn trnh t gen 16S rDNA gn ca cc chng SRB mi phn lp so snh vi cc loi SRB c quan h gn gi. Escherichia coli (Proteobacteria) c chn lm outgroup. 3.3. Nghin cu c i m sinh hc ca cc chng SRB mi phn l p 3.3.1. nh hng c a nng mui trong mi trng
SR2 5
Nng sulfide(mM)

SR3
0.4
Nng sulfide(mM)

SR4
0.4
Nng sulfide(mM)

5 4 3

5 4 3

0.4 0.3 0.2

OD600

4 3

0.3
OD600

0.3 0.2
OD600

0.2 2 1 0 0 1 5 10 15 20 25 Nng mui (g/l) 0.1 0

2 1 0 0 1 5 10 15 20 25 Nng mui (g/l) 0.1 0

2 1 0 0 1 5 10 15 20 25 Nng mui (g/l) 0.1 0

N ng sulfide

OD600

Hnh 3.7. nh hng ca nng mu i trong mi trng ti mc tng sinh v hot tnh kh sulfate ca cc chng SRB mi phn l p. 3.3.2. nh hng c a pH trong mi trng
SR2 4
Nng sulfide (mM)

SR3
0.3
Nng sulfide (mM)

SR4

4 3

0.3
Nng sulfide (mM)

4 3

0.3

3 0.2
OD600

0.2
OD600

0.2 2 0.1 1 0 4 5 6 pH 7 8 0
OD600

2 0.1 1 0 4 5 6 pH 7 8 0

2 0.1 1 0 4 5 6 pH 7 8 0

Nng sulfide

OD600

Hnh 3.8. nh hng ca pH ti mc tng sinh v hot tnh kh sulfate ca cc chng SRB mi phn l p. Nhm mc ch la chn ngun SRB ph hp nht cho x l AMD, chng ti tin hnh nghin cu nh hng ca pH ti hn hp ba chng SRB mi phn lp so vi mu dch lm giu gc ca ba ch ng ny (hnh 3.9).
Hn hp 3 chng SR2, SR3, SR4
6
6 0.4

E1-4
0.4

Nng sulfide (mM)

5 0.3 4

Nng sulfide (mM)

5 0.3 4 3 2 0.1 1 0.2

3 2

0.2

0.1 1 0 4 5 6 7 0

OD600

0 4 5 6 7

pH

pH

Nng sulfide 3.3.3. nh hng c a nhit nui c y

OD600

Hnh 3.9. nh hng ca pH i vi hn hp chng SRB v mu lm giu gc (E1-4)

OD600

SR2
5 0.4

SR3
5 0.4
5

SR4
0.4

4 3

Nng sulfide (mM)

Nng sulfide (mM)

Nng sulfide (mM)

0.3

4 3

0.3

4 3

0.3

OD600

OD600

0.2 2 1 0 15 20 25 30 37 0.1

0.2 2 1 0 15 20 25 30 37 0.1

0.2 2 1 0 15 20 25 30 37 0.1

Nhit (oC)

Nhit (oC)

Nhit (oC)

N ng sulfide

OD 600

Hnh 3.10. nh hng ca nhit ti mc tng sinh v hot tnh kh sulfate thnh sulfide ca cc chng SRB mi phn l p. 3.3.4. Cht cho in t v cht nhn in t Bng 3.2. Sinh trng ca SRB vi cc cht cho v nhn i n t khc nhau c im SR2 SR3 Cht cho in t Lacte +++ +++ ( kh sulfate) Acetate + + Methanol + + Cht nhn in t ( Sulfate +++ +++ oxy ha lactate) Nitrate +++ Fe (III) Ch thch: +++ sinh trng tt; ++ sinh trng trung bnh; + sinh trng km; trng. 3.4. Th nghi m x l AMD trn m hnh phng th nghi m Bng 3.3. Tm t t th nghi m x l AMD trn m hnh phng th nghi m Tn m Thnh phn AMD hnh pH = 4 MH 1 [Fe] = 200 mg/l (3,57 mM) MH2 [SO42-] = 1320 mg/l (13,75 mM) Ngun Ghi ch SRB Dch lm Nng c giu E1-4 ch t MH2 l nng th c trong b x l AMD Di y l hnh nh m hnh x l trong phng th nghim vi ch x l theo m, quy m 3 5 lt (hnh 3.11) Ngun c cht b sung Methanol (10 mM) COD = 320 mg O2 /l N tng = 26,4 mg/l SR4 +++ ++ +++ +++ ++ khng sinh

OD600

Hnh 3.11. M hnh x l AMD trong phng th nghi m 3.4.1. X l AMD trong iu ki n b sung methanol (10mM) lm c cht
M hnh 1
16 10 8

Nng sulfate (mM)

12 8

4 4 0 0 1 2 3 4 5 6 7 8 Thi gian (ngy) Nng sulfate pH 2 0

Hnh 3.12. M hnh x l AMD vi c cht b sung l methanol (10 mM) 3.4.2. X l AMD trong iu ki n b sung nc thi giu hu c lm c cht
M hnh 2
16 10 8

Nng sulfate (mM)

12 8

4 4 0 0 1 2 3 4 5 6 7 8 Thi gian (ngy) Nng sulfate pH 2 0

pH

pH

Hnh 3.13. M hnh x l AMD vi c cht l nc thi c hm lng cht hu c cao Nh vy nc thi c hm lng hu c cao c kh nng s dng lm c cht tt cho vi khun kh sulfate trong b phn ng x l AMD. Vic kt hp nc thi hu c x l AMD c ngha quan trng trong vi c gi m gi thnh cng ngh, ng thi gp phn bo v mi trng bi cc loi nc thi hu c nh nc thi t chn nui, ch bin th c phm, nc thi sinh hot. 3.4.3. Phn tch thnh phn qun x vi sinh v t trong cc m hnh x l AMD trong phng th nghi m E1.4 MH1 MH2 SR2 SR3 SR4

SR3 SR2 SR4

* * **

SR2: Desulfomicrobium sp. SR3: Desulfobulbus sp. SR4: Desulfovibrio sp.

Hnh 3.14. in di bin tnh (DGGE) gen 16S rDNA phn tch thnh ph n ca qun x vi khun trong m hnh x l AMD . KT LU N 1. thit lp c hn hp SRB (mu E1-4) c hot tnh tt trong iu kin pH th p qua phng php lm giu. 2. Phn lp c 3 chng vi khun kh sulfate SR2, SR3 v SR4 t mu lm giu ni trn. Da trn trnh t gn ca gen 16S rDNA cc chng ny c nh danh tng ng l Desulfomicrobium sp. SR2, Desulfobulbus sp. SR3, v Desulfovibrio sp. SR4. 3. Phn tch DGGE gen 16S rDNA cho th y cc chng phn lp i din cho cc nhm SRB chnh trong mu lm giu E1-4. 4. Nghin cu c im sinh l ca 3 chng th y r ng: C 3 chng u c kh nng sinh trng tt mi trng c hm lng mu i 10 15 g/l, tng ng vi mi trng nc l. c bit l chng SR4 c th sinh trng tt ti nng mu i 25 g/L, tng ng mi trng nc bin.

C ba chng u b c ch ti pH mi trng 6, tuy nhin mu lm giu gc E1-4 th hin kh nng chu pH thp tt hn cc chng thun khit v sinh trng tt pH 4 v 5.

5. M hnh th nghim x l AMD vi c cht b sung l nc thi c hm lng hu c cao t hiu qu cao hn khi s dng c cht n l methanol. Kt qu thu c sau 7 ngy x l gm: pH tng t 4 ln 8,15, nng sulfate gi m t 13,75 mM cn 4,5 mM, hm lng st gi m t 200 mg/l cn 36 mg/l th hin kh nng ng dng th c t ca cng ngh.

References Ting vit 1. Cng ty c ph n tin hc, cng ngh, mi trng, TCT Than & Khong s n Vit (2012), Kt qu phn tch nc thi m than. m Vit Nam, Hi ngh khoa hc k thut m quc t 2010 . 3. Bi Cng Quang (2011), Tc ng ca cc hot ng khai thc m n ngu n nc v h sinh thi, Chuyn bo v mi trng trong khai thc khong sn, H Thy Li. 4. Nguyn Danh Sn (2011), Mi trng v pht tri n bn vng trong qun l khai thc ti nguyn khong sn Vit Nam, Chuyn bo v mi trng trong khai thc khong sn, Vin Khoa hc x hi Vit Nam. Ting Anh 5. Bahr M, Crump BC, Ceraj VK, Teske A, Sogin ML, Hobbie JE (2005), Molecular chacterization of sulfate-reducing bacteria in a New England salt marsh, Environ. Microbiol., 7, pp.11751185. 6. Ben-Dov E, Brenner A, Kushmaro (2007), Quantification of sulfate-reducing bacteria in industrial wastewater by real-time polymerase chain reaction (PCR) using dsrA and apsA genes, Microbiol. Ecol.,54, pp. 439451. 7. Brenner FJ (2001), Use of constructed wetlands for acid mine drainage abatement and stream restoration, Water Sci. Technol., 44, pp. 449-454. 8. Benner SG, Blowes DW, Ptacek CJ (1997), A full -scale porous reactive wall for prevention of acid mine drainage, Ground Water Monit. Remed., 17, pp. 99-107. 9. Bharathi PAL, Sathe V, Chandramohan D (1990), Effect of lead, mercury and cadmium on a Sulphate-reducing bacterium, Environ. Pollut. , 67, pp. 361374. 10. Boetius A , Ravenschlag K, Schubert KJ, Rickert D, Widdel F, Gieseke A, Amann R, Jrgensen BB, Witte U, Pfannkuche O (2000), A marine microbial consortium apparently mediating anaerobic oxidation of methane, Nature, 407, pp. 623626. Nam

2. H S Giao, Mai Th Ton (2010), Nhng im nng mi trng trong hot ng khai thc

11. Boschker HTS, Nold SC, Wellsbury P, Bos D, de Graaf W, Pel R, Parkes RJ, Cappenberg (1998), Direct linking of microbial populations to specific biogeochemical processes by 13C-labelling of biomarkers, Nature, 392, pp. 801804. 12. Boularbah A, Schwartz C, Bitton G, Morel JL (2006), Heavy metal contamination from mining sites in South Morocco: 1. Use of a biotest to assess metal toxicity of tailings and soils, Chemosphere, 63, pp. 802-810. 13. Brookens AM, Schmidt WT, Branch WL (2000), The effectiveness of utilizing passive treatment systems for leachate discharges in Western Maryland, Presented at the American Society for Surface Mining and Reclamation 17th Annual Meeting, Tampa, Florida, June 11-15, 2000. 14. Brown M, Barley B, Wood H (2002), Minewater treatment: technology, application and policy, IWA Publishing, London. 15. Brysch K, Schneider C, Fuchs G, Widdel F (1987), Lithoautotrophic growth of sulphate reducing bacteria, and description of Desulfobacterium autotrophicum gen. nov., sp. nov., Arch. Microbiol.,148, pp. 264274. 16. Cabrera G, Prez RJM, Gmez, balos A, Cantero D (2006), Toxic effects of dissolved heavy metals on Desulfovibrio vulgaris and Desulfovibrio sp. strains, J. Hazar. Mater., 135, pp. 40-46. 17. Chaney RL, Brown SL, Angle JS, Stuczynski TI, Daniels WL, Henry CL, Siebielec G, Li YM, Malik M, Ryan JA, Compton H (2000), In situ Remediation/ Reclamation/Restoration of Metals Contaminated Soils using Tailor-Made Biosolids Mixtures, Symposium on Mining, Forest and Land Restoration: The Successful Use of Residuals/Biosolids/Organic Matter for Reclamation Activities, Denver, CO. 18. Cooper EL, Wagner CC (1973), The effects of acid mine drainage on fish populations, Fish and Food Organisms in Acid Waters of Pennsylvania, US Environmental Protection, EPA, pp. 32-114. 19. Cord-Ruwisch R (1985), A quick method for the determination of dissolved and precipitated sulfides in cultures of sulfate-reducing bacteria, J. Microbiol. Meth. 4, pp. 33-36. 20. Dar SA., Kuenen JG, Muyzer G (2005), Nested PCR -denaturing gradient gel electrophoresis approach to determine the diversity of sulfate-reducing bacteria in complex microbial communities, Appl. Environ. Microbiol., 71, pp. 23252330. 21. Dar SA, Stams AJ, Kuenen JG, Muyzer G (2007), Co -existence of physiologically similar sulphate-reducing bacteria in a full-scale sulfidogenic bioreactor fed with a single organic electron donor, Appl. Microbiol. Biotechnol., 75, pp. 14631472.

22. DIN 38406-E1-1 (1983), German standard methods for the examination of water, waste water and sludge, cation (group E), determination of iron (E1). 23. Doshi SM (2006), Bioremediation of Acid Mine Drainage Using Sulfate-Reducing Bacteria, Report for U.S. Environmental Protection Agency. 24. Dubilier N, Mlders C, Ferdelman T, de Beer D, Pernthaler A, Klein M, Wagner M, Ersus C, Thiermann F, Krieger J, Giere O, Amann R (2001), Endosymbiontic sulphate -reducing and sulphide-oxidizing bacteria in an oligochaete worm, Nature, 411, pp. 298302. 25. Duffield S, Lucia AC, Mitchison N, Kasamas H, (2000), Land recovery and man -made risks: a perspective from the EU accession countries, J. Hazard. Mater. ,78, pp. 91-103. 26. Elferink OSJWH, Visser A, Hulshoff-Pol LW, Stams AJM (1994), Sulphate reduction in methanogenic bioreactors, FEMS Microbiol. Rev., 15, pp. 119136. 27. EPA (1995), Human Health and Environmental Damages from Mining and Mineral Processing Wastes, Washington DC, Office of Solid Waste, U.S. Environmental Protection Agency. 28. Farag, A. M., D.Skaar, D.A. Nimick, E. MacConnell, and C. Hogstrand (2003), "Characterizing aquatic health using salmonids mortality, physiology, and biomass estimates in streams with elevated concentrations of arsenic, cadmium, copper, lead, and zinc in the Boulder River Watershed, Montana", Transac. Amer. Fisher. Soc., 132, pp. 450-457. 29. Felsenstein J (1985), Confidence limits on phylogenies: an approach using the bootstrap, Evolution, 39, pp. 783-791. 30. Figueroa L (2005), Microbial ecology of anaerobic biosystems treating mining influenced waters, Presented at the Mine Water Treatment Technology Conference, Pittsburgh, PA. 31. Frauque, G., J.LeGall, and L. L. Barton (1991), Sulphate -reducing and sulphur-reducing bacteria, Variation in Autotrophic Life, pp. 271-337. 32. Fromm, P. O. (1980), "A review of some physiological and toxicological responses of freshwater fish to acid stress", Environ. Biol. Fishes, 5, pp. 79-93. 33. Gadd G (2004), Microbial influence on metal mobility and application for bioremediation, Geoderma, 122, pp. 109-119. 34. Gusek JJ, Wildeman TR (2002), Passive treatment of aluminum-bearing acid rock drainage ,
rd

Proceedings of the 23 Annual West Virginia Surface Mine Drainage Task Force Symposium, Morgantown, West Virginia, April 16-17, 2002. 35. Dinh TH, Kuever J, MaBmann M, Hassel AW, Martin Stratmann and Fr iedrich Weddel, Iron corrosion by novel anaerobic microorganism, Nature, 427, pp. 829-832.

36. Hao OJ, Chen JM, Huang L, Buglass RL (1996), Sulphate reducing bacteria, Crit. Rev. Enviro. Sci. Technol., 26, pp. 155-187. 37. Hao OJ, Huang L, Chen JM, Buglass RL (1994), Effects of metal additions on sulphate reduction activity in wastewaters, Toxicology and Environmental Chemistyi, 46, pp. 197212. 38. Higgins JP, Hard BC, Mattes A (2003), Bioremediation of rock drainage using sulphatereducing bacteria , Proceedings of Sudbury 2003: Mining and Environment, Sudbury, Ontario, May 25-28, 2003. 39. Hill RD (1974), Mining impacts on trout habitat, Proceedings of a Symposium on Trout Habitat, Research, and Management, Boone, NC, Appalachian Consortium Press. 40. Hilton BL, Oleszkiewiez JA (1988), Sulfide induced inhibition of anaerobic digestion, J. Environ. Eng., 114, pp. 13771391. 41. Hines ME, Evans RS, Genthner BRS, Willis SG, Friedman S, Rooney-Varga JN, Devereux R (1999), Molecular phylogenetic and biogeochemical studies of sulfate -reducing bacteria in the rhizosphere of Spartina alterniflora, Appl. Environ. Microbiol., 65, 22092216. 42. Howells GD, Brown DJA, Sadler K (1983), "Effects of acidity, calcium, and aluminum on fish survival and productivity - a review", J. Sci. Food Agr., 34(6), pp. 559-570. 43. Itoh T, Suzuki KI, Nakase T (1998), Thermocladium modestius gen. nov., sp. nov. a new genus of rod-shaped, extremely thermophilic crenarchaeote, Int. J. Syst. Bacteriol., 48, pp. 879887. 44. Itoh T, Suzuki KI, Sanches PC, Nakase T (1999), Caldivirga maquilingensis gen. nov., sp. nov. a new genus of rod-shaped crenarchaeote isolated from a hot spring in the Philippines, Int. J. Syst. Bacteriol. , 49, pp. 11571163. 45. Jage CR, Zipper CE, Hendricks AC (2000), Factors affecting performance of Successive Alkalinity-Producing Systems, Presented at the American Society for Surface Mining and Reclamation 17th Annual Meeting, Tampa, Florida, June 11-15, 2000. 46. Jennings SR, Neuman DR, Blicker PS (2008), Acid Mine Drainage and Effects on Fish Health and Ecology: A Review, Reclamation Research Group Publication, Bozeman MT. 47. Jeanthon C, Haridon SL, Cueff V, Banta A, Reysenbach AL, Prieur D (2002), Thermodesulfobacterium hydrogeniphilum sp. nov., a thermophilic,

chemolithoautotrophic sulfate-reducing bacterium isolated from a deep-sea hydrothermal vent at Guaymas Basin and emendation of the genus Thermodesulfobacterium, Int. J. Syst. Evol. Microbiol., 52, pp. 765772. 48. Jong T, Parry DL (2006), Microbial sulfate reduction under sequentially acidic conditions in an upflow anaerobic packed bed bioreactor, Water Res., 40, pp. 2561-2571.

49. Kaksonen AH, Plumb JJ, Franzmann PD, Puhakaka JA (2004a), Simple organic electron donors support diverse sulphate- reducing communities in uidized -bed reactors treating acid metal- and sulphate-containing wastewater, FEMS Microbiol. Ecol., 47, pp. 279289. 50. Kaksonen AH, Plumb JJ, Franzmann PD, Puhakaka JA (2004b), Effects of hydraulic retention time and sulphide toxicity on ethanol and acetate oxidation in sulphate reducing metal-precipitating uidized-bed reactor, Biotechnol. Bioeng., 86, pp. 332343. 51. Kepler DA, McCleary EC (1994), Successive alkalinity -producing systems (SAPS) for the treatment of acidic mine drainage, Proceedings of the International Land Reclamation and Mine Drainage Conference and the Third International Conference on the Abatement of Acidic Drainage, Pittsburgh, PA, April 24-29, 1994, pp. 195-204. 52. Kniemeyer O, Musat F, Sievert SM, Knittel K, Wilkes H, Blumenberg M, Michaelis W, Classen A, Bolm C, Joye SB, Widdel F (2007), Anaerobic oxidation of short -chain hydrocarbons by marine sulphate-reducing bacteria, Nature, 449, pp. 898901. 53. Kovacik WPJ (2006), Molecu lar analysis of deep subsurface Cretaceous rock indicates abundant Fe(III)- and S-reducing bacteria in a sulfate-rich environment, Environ. Microbiol., 8, 141155. 54. Kremer DR, Hansen TA (1988), Pathway of propionate degradation in Desulfobulbus propionicus, FEMS Microbiol. Lett., 49, pp. 273-277. 55. Laanbroek HJ, Geerligs HJ, Sijtsma L, Veldkamp H (1984), Competition for sulfate and ethanol among Desulfobacter, Desulfobulbus, and Desulfovibrio species isolated from intertidal sediments, Appl. Environ. Microbiol., 47, pp. 329334. 56. Logan MV, Reardon KF, Figueroa LA, McLain JET, Ahmann DM (2005), Microbial community activities during establishment, performance, and decline of bench-scale passive treatment systems for mine drainage, Water Res., 39, pp. 4537-4551. 57. Lopez IFR, Larrea L, Cocolin E, Orr T, Phister M, Marshall J, Gheynst V, Mills DA (2003), Design and evaluation of PCR primers for analysis of bacterial populations in wine by denaturing gradient gel electrophoresis, Appl. Environ. Microbiol., 69, pp. 68016807. 58. Maillacheruvu KY, Parkin GF (1996), Kinetics of growth, substrate utilization and sulphide toxicity for propionate, acetate and hydrogen utilisers in anaerobic systems, Water Environ. Res., 68, pp. 10991106. 59. Marmur J (1961), A procedure for the isolation of deoxyribonucleic acid from microorganisms, J Mol Biol, 3, pp. 208-218. 60. McCartney DM, Oleszkiewicz JA. (199 1), Sulphide inhibition of anaerobic degradation of lactate and acetate, Water Res., 25, pp. 203209. 61. McCartney DM, Oleszkiewicz JA (1993), Competition between methanogens and sulphate reducers: effect of COD: sulphate ratio and acclimation, Water Environ. Res., 65, pp. 655664.

62. Menendez R (1978), Effects of acid water on Shavers Fork a case history, Surface mining and fish/wildlife needs in the Eastern United States., U.S. DOI, Fish and Wildlife Service, pp. 160-169. 63. Minz D, Flax JL, Green SJ, Muyzer G, Cohen Y, Wagner M, Rittmann EB, Stahl DA (1999), Diversity of sulfate -reducing bacteria in oxic and anoxic regions of a microbial mat characterized by comparative analysis of dissimilatory sulfite reductase genes, Appl. Environ. Microbiol. 65, pp. 46664671. 64. Munshower FF, Neuman DR, Jennings SR, Phillips GR (1997), Effects of land reclamation techniques on runoff water quality from the Clark For k River floodplain, Montana, Washington, DC, EPA Office of Research and Development , pp. 199-208. 65. Mussmann M, Ishii K, Rabus R, Amann R (2005), Diversity and vertical distribution of cultured and uncultured Deltaproteobacteria in an intertidal mud fl at of the Wadden Sea, Environ. Microbiol., 7, pp. 405418. 66. Muyzer G, Stams AJM (2008), The ecology and biotechnology of sulphate-reducing bacteria, Nature, 6, pp. 441-454. 67. Nilsen RK, Beeder J, Thostenson T, Torsvik T (1996), Distribution of th ermophilic marine sulfate reducers in North Sea oil field waters and oil reservoirs, Appl. Environ. Microbiol., 62, pp. 17931798. 68. Nordstrom DK, Alpers CN (1999), Negative pH, efflorescent mineralogy, and consequences for environmental restoration at the Iron Mountain Superfund site, California, National Acad. Sci., 96, pp. 3455-3462. 69. Nordstrom DK, Jenne EA, Averett RC (1977), Heavy metal discharges into Shasta Lake and Keswick Reservoir on the Sacramento River, California a reconnaissance during low flow, U.S. Geological Survey. Open-File Report, pp. 76-49 70. Nordwick S, Zaluski M, Park B, Bless D (2006), Advances in development of bioreactors applicable to the treatment of ARD, Proceedings, 7th Int. Conf. on Acid Rcok Drainage, St. Louis, MO, March 26-30, 2006, ed. by R.I. Barnhisel, pp. 1410-1420. 71. OFlaherty V, Colleran E (1998), Effect of sulphate addition on volatile fatty acid and ethanol degradation in an anaerobic hybrid reactor. I: process disturbance and remediation, Biores. Technol., 68, pp. 101107. 72. Ollivier B, Caumette P, Garcia JL, Mah RA (1994), Anearobic bacteria from hypersaline enviroments, Microbiol. Rev., 58, pp. 27-38. 74. Peck HD, Lissolo T (1988), Assimilatory and dissimilatorymsulphate reduction: enzymology and bio energentics, The Ntrogen and Sulphur Cycles, pp. 99-132. 75. Perry RH, Green D (1984), Perrys Chemical Engineers Handbook , 6th Ed. McGraw-Hill Book Company, Singapore. 76. Pfennig N, Widdel F, Truper HG (1981), The dissimila tory sulphate reducing bacteria, in The Prokaryotes, 2, pp. 926-940. 77. Postage JR (1984), The sulphate reducing bacteria , 2nd ed, Cambridge Univertsity Press, Cambridge.

78. Ramsing NB, Khl M, Jrgensen BB (1993), Distribution of sulfate -reducing bacteria, O2, and H2 S in photosynthetic biofilms determined by oligonucleotide probes and microelectrodes, Appl. Environ. Microbiol., 59, pp. 38403849. 79. Ravenschlag K, Sahm K, Knoblauch C, Jrgensen BB, Amann R. (2000), Community structure, cellular rRNA content, and activity of sulfate-reducing bacteria in marine Arctic sediments, Appl. Environ. Microbiol., 66, pp. 35923602. 80. Reis MAM, Almeida JS, Lemos PC, Carrondo MJT (1992), Effect of hydrogen sulphide on growth of sulphate-reducing bacteria, Biotechnol. Bioeng., 40, pp. 593600. 81. Rissati JB, Capman WC, Stahl DA (1994), Community structure of a microbial mat: the phylogenetic dimension, Proc. Nat. Acad. Sci. USA, 91, pp. 1017310177. 82. Rodrguez L, Ruiz E, Alonso-Azcrate J, Rincn, J (2009), Heavy metal distribution and chemical speciation in tailings and soils around a PbZn mine in Spain, J. Environ. Manag., 90 , pp. 1106-1116. 83. Rose AW, Alcorn GS, Phelps LB, Bower PR (2001), Case study of Pot Ridge Passive Treatment Systems, Cambria County, Pennsylvania, Presented at the American Society for
th

Surface Mining and Reclamation 18 Mexico, June 3-7, 2001.

Annual National Meeting, Albuquerque, New

84. Saitou N, Nei M (1987), The neighbor -joining method: a new method for reconstructing phylogenetic tr ees, Mol. Biol. Evol., 4, pp. 406-425. 85. Sass H, Wieringa E, Cypionka H, Babenzien HD, Overmann J (1998), High genetic and physiological diversity of sulfate-reducing bacteria isolated from an oligotrophic lake sediment, Arch. Microbiol., 170, pp. 243251. 86. Schink B, Stams AJM (2006), The Prokaryotes, Springer Verlag, New York, pp. 309 335. 87. Schnheit P, Kristjansson JK, Thauer RK (1982), Kinetic mechanism for the ability of sulphate reducers to out-compete methanogens for acetate, Arch. Microbiol., 132, pp. 285288. 88. Sen AM (2001), Acidophilic Sulphate Reducing Bacteria: Candidates for Bioremediation of Acid Mine Drainage Pollution , Thesis, Univ. Wales. 89. Singer P, Stumm W (1970), Acid mine drainage: the rate determining step, Science, 167, pp. 1121-1123. 90. Skousen J, Sextone A, Cliff J, Sterner P, Calabrese J, Ziemkiewicz P (1999), Acid mine drainage treatment with a combined wetland/anoxic limestone drain: greenhouse and field

th

systems, Presented at the American Society for Surface Mining and Reclamation 16 Annual National Meeting, Scottsdale, Arizona, August 13-19, 1999. 91. Skousen J, Ziemkiewicz P (1996), Acid Mine Drainage Control and Treatment , 2nd Ed. National Research Center for Coal and Energy, National Mine Land Reclamation Center, West Virginia University, Morgantown, WV, pp. 362. 92. Spear JR, Figueroa LA, Honeyman BD (2000), Modeling the removal of uranium U(VI) from aqueous solution in the presence of sulfate reducing bacteria, Environ. Technol., 66, pp. 3711-3721. 93. Speece RE (1983), Anaerobic biotechnology of industrial wastewaters, Environ. Sci. Technol., 17, pp. 416A427A. 94. Stadnitskaia A, Muyzer G, Abbas B, Coolena MJL, Hopmans EC, Baas M, van Weeringa TCE, Ivanovb MK, Poludetkina E, Sinninghe Damst e JS (2005), Biomarker and 16S rDNA evidence for anaerobic oxidation of methane and related carbonate precipitation in deep-sea mud volcanoes of the Sorokin Trough, Black Sea, Mar. Geol., 217, pp. 6796. 95. Stams AJ, Elferink OS, Westermann P (2003), Metabolic interactions between methanogenic consortia and anaerobic respiring bacteria, Adv. Biochem. Eng. Biotechnol., 81, pp. 3156. 96. Stephenson SL, Studiar SM, McQuattie CJ (1995), Effects of acidification on bryophyte communities in West Viginia moutain streams, J. Environ. Qual., 24, pp. 116 125. 97. Teitzel GM, Parsek MR (2003), Heavy metal resistance of biolm and planktonic Pseudomonas aeruginosa, Appl. Environ. Microbiol., 69, pp. 23132320. 98. Thauer RK, Jungermann K, Decker K (1977), Energy conservation in chemotrophic anaerobic bacteria, Bacteriol. Rev., 41, pp. 100-180. 99. Tsukamoto TK, Killion HA, Miller GC (2004), Column experiments for microbial treatment of acid mine drainage: low-temperature, low-pH and matrix investigations , Water Res., 38, pp. 1405-1418. 100. U.S.Department of Agriculture (USDA) and EPA Region III (2000), A Handbook of Constructed Wetlands, Report# 843F00003. Sci.

101. U.S.Department of Energy (US DOE) (1998), Research and Application of Permeable Reactive Barriers, Document# K0002000. 102. US EPA (2004a), Nationwide Identification of Hardrock Mining Sites , Report #2004-P00005, Office of the Inspector General. 103. US EPA (2004b), Abandoned Mine Lands Team Reference Notebook . 104. Vega FA, Covelo EF, Andrade ML (2006), Competitive sorption and desorption of heavy metals in mine soils: Influence of mine soil characteristics, J. Colloid Interface Sci., 298, pp. 582-592. 105. Warner RW (1971), "Distribution of biota in a stream polluted by acid mine drainage", Ohio J. Sci., 71, pp. 202-215. 106. Watzlaf G, Schroeder K, Kleinmann R, Kairies C, Nairn R (2003), The passive treatment of coal mine drainage, US Department of Energy NETL , pp. 72. 107. Wawer C, Jetten MS, Muyzer G (1997), Genetic diversity and expre ssion of the NiFe hydrogenase large-subunit gene of Desulfovibrio spp. in environmental sample, Appl. Environ. Microbiol., 61, pp.43604369. 108. Webster G, Watt LC, Rinna J, Fry JC, Evershed RP, Parkes RJ, Weightman AJ (2006), A comparison of stable isotope probing of DNA and phospholipids fatty acids to study prokaryotic functional diversity in sulfate-reducing marine sediment enrichment slurries, Environ. Microbiol., 8, pp. 15751589. 109. Weisburg WG, Barns SM, Pelletier DA, Lane DJ (1991). "16S ribosomal DNA amplification for phylogenetic study". J. Bacteriol., 173: 697703. 110. Weijma J, Gubbels F, Hulshoff Pol LW, Stams AJM, Lens P, Lettinga G (2002), Competition for H2 between sulphate reducers, methanogens and homoacetogens in a gaslift r eactor, Water Sci. Technol., 45, pp. 7580. 111. Widdel F (1988), Microbiology and ecology of sulphate - and sulphur-reducing bacteria, in Biology of Anaerobic Microorganism, pp. 469-585. 112. Widdel F, Bak F (1992), Gram -negative mesophilic sulfate-reducing bacteria, in The Prokaryotes, 2nd ed. Spinger, Berlin Heidelberg New York, pp. 3352-3378. 113. Widdel F, Pfennig N (1984), Dissimilatory sul fate- and sulfur-reducing bacteria, Bergeys Manual of Systematic Bacteriology , 1, pp. 663-679. 114. Widdel F, Hansen TA (1991), The dissimilatory sulphate and sulphur reducing bacteria, in The prokaryotes, pp. 583-624. 115. Younger PL, Banwart SA, Hedin RS (2002b), Mine water: hydrology, pollution, remediation, Dordrecht; Boston, Kluwer Academic Publishers.16, pp. 442. 116. Zeikus JG, Dawson MA, Thompson TE, Lugvorsen K, Hatchikian EC (1983), Microbial ecology of volcanic sulphidogenesis: Isolation and characterization of

Thermodesulfobacteria commune gen. nov. and sp. nov. J. Gen. Microbiol., 129, pp. 11591169. 117. Zhou J, Bruns MA, Tiedje JM (1996), DNA recovery from soils of diverse composition, Appl. Environ. Microbiol., 62, pp. 316-322.