P. 1
Chuyển hóa Glu, Lip, Pro, Adn

Chuyển hóa Glu, Lip, Pro, Adn

|Views: 226|Likes:
Được xuất bản bởiGo On

More info:

Published by: Go On on Nov 23, 2013
Bản quyền:Attribution Non-commercial

Availability:

Read on Scribd mobile: iPhone, iPad and Android.
download as PDF, TXT or read online from Scribd
See more
See less

02/20/2014

pdf

text

original

Sections

  • THOÁI HOÁ NITƠ CỦA ACID AMIN
  • TỔNG HỢP HEMOGLOBIN
  • TỔNG HỢP GLOBIN
  • TỔNG HỢP HEME
  • TIÊU HOÁ HEMOGLOBIN

CHUYỂN HÓA LIPID

ĐẠI CƯƠNG
ĐẠI CƯƠNG
Vai trò:
 Cung cấp năng lượng cho cơ thể.Một khẩu
phần ăn hợp lý cung cấp khoảng 25-30%
năng lượng cơ thể.
 Nguồn dự trữ năng lượng lớn nhất trong
cơ thể
 Tham gia cấu trúc cơ thể và là bản chất
của một số hợp chất sinh học quan trọng
ĐẠI CƯƠNG
Nhu cầu: khoảng 1g/1kg thể trọng/ngày
Tăng khi cần chống lạnh
1g lipid cung cấp khoảng 9,1 kcal(hơn hẳn
so với glucid và protid)
Các dạng :
Lipid dự trữ:chủ yếu là triglycerid
Lipid màng:PL,C,GL.(Chiếm khoảng 10%
trọng lượng khô của tổ chức)
Lipid vận chuyển (lipid hòa tan)
TIÊU HÓA
Lipid từ thức ăn xuống ruột non được nhũ tương
hóa nhờ muối mật, giúp tăng diên tích tiếp xúc bề
mặt với các enzym thủy phân để dễ tiêu hóa hơn
Micell
TIÊU HÓA
TIÊU HÓA
Qúa trình tiêu hóa thực chất là quá trình thủy
phân lipid:
- Thủy phân triglycerid
TIÊU HÓA
Thủy phân phospholipid và sterid:
TIÊU HÓA
Phosphodiestease của ruột đặc hiệu với liên kết
este giữa acid phosphoric và X hoặc giữa acid
phosphoric và glycerol tạo diglycerid, acid
phosphoric….
Phosphomonoesterase tiếp tục thủy phân các
sản phẩm trên
Cholesterol esterase thủy phân sterid thành acid
béo và cholesterol
HẤP THU
 Glycerol và AB chuỗi ngắn (<10C) xuyên qua
thành ruột non vào TMcửa tới gan.
 Các AB chuỗi dài, mono, diglycerid được
dùng làm nguyên liệu để tổng hợp lại
triglycerid ở màng ruột.
 Các lipid mới tổng hợp như triglycerid,
cholesterol este ....kết hợp với protein và tạo
thành LP(chylomicron)
 LP qua bạch mạch rồi vào máu tới gan.
HẤP THU
HẤP THU
CHUYỂN HÓA ACID BÉO – Thoái hóa
Trước tiên là hoạt hóa AB thành dạng hoạt động
acyl CoA. Sau đó chuyển các acyl CoA từ bào tương
vào trong ty thể.
-Hoạt hóa AB: AB được este hóa với HSCoA ở ngoài
ty thể nhờ năng lượng của ATP tạo acyl CoA.

CHUYỂN HÓA ACID BÉO – Thoái hóa
CHUYỂN HÓA AB – β OXY HÓA
Sau khi hoạt hóa, acyl CoA vào ty thể
để β oxy hóa
Mỗi lần β oxy hóa cắt ra một mẫu 2C
dưới dạng Acetyl CoA, acetyl CoA tiếp
tục vào chu trình acid citric để tạo năng
lượng
β-OXY HÓA ACID BÉO
CHUYỂN HÓA AB – β OXY HÓA
CHUYỂN HÓA AB – β OXY HÓA
CHUYỂN HÓA AB – β OXY HÓA
CHUYỂN HÓA AB – β OXY HÓA
Năng lượng từ AB:
-Số phân tử ATP tạo thành khi oxy hóa hoàn
toàn một phân tử AB có số C chẵn 2n được tính
theo công thức sau:
Số ATP = [5(n- 1) + 12n] – 2 =17n – 7
n phân tử acetyl CoA được oxy hóa đến cùng
trong chu trình citric acid cho 12n ATP
n-1 vòng β oxy hóa cho 5(n-1) ATP
Trừ 2ATP được dùng trong quá trình hoạt hóa
AB.
Ví dụ : acid stearic
CHUYỂN HÓA AB – β OXY HÓA
Acetyl CoA tiếp tục được oxy hóa đến cùng trong
chu trình acid citric
CHUYỂN HÓA AB – β OXY HÓA
THOÁI HÓA AB BÃO HÒA CÓ SỐ C LẺ
Cũng trải qua quá trình β oxy hóa như trên
nhưng vòng oxy hóa cuối cùng tạo thành
Acetyl CoA và Propionyl CoA.
Propionyl phải qua nhiều biến đổi để tạo
thành Succinyl CoA có thể vào chu trình acid
citric
THOÁI HÓA AB BÃO HÒA CÓ SỐ C LẺ
THOÁI HÓA AB- CÁC THỂ CETON
Sau khi thoái hóa AB ,acetyl CoA có thể được oxy
hóa hoàn toàn trong chu trình acid citric,tham gia
tổng hợp cholesterol hoặc các thể ceton
Các thể ceton gồm 3 chất:
Sinh tổng hợp các thể ceton được thực hiện trong ty
thể tế bào gan:
THOÁI HÓA AB- CÁC THỂ CETON
Sơ đồ hình thành các thể ceton
THOÁI HÓA AB- CÁC THỂ CETON
Sơ đồ hình thành các thể ceton
THOÁI HÓA AB- CÁC THỂ CETON
Nhiễm ceton: mức ceton tăng cao bất thường trong
những trường hợp :
Đói kéo dài
Đái tháo đường
Nhiễm ceton có thể gây nhiễm toan nặng
Khi nồng độ thể ceton trong máu tăng cao quá
70mg/dl thì có thể phát hiện thể ceton trong nước
tiểu
Khi nồng độ ceton trong máu vượt quá 100mg/dl
hơi thở có mùi hôi của aceton.
THOÁI HÓA AB- CÁC THỂ CETON
Số phận của thể ceton
Acetoacetate và β hydroxybutyrate :
-Sản xuất đầu tiên ở gan
- khuếch tán vào máu đến các mô
-Rồi có thể chuyển thành acetyl CoA
-Đi vào chu trình acid citric tạo năng lượng cho mô
hoạt động.
Acetone:
- Chỉ sản xuất một số lượng nhỏ
- Bài tiết ra nước tiểu ,hơi thở
THOÁI HÓA AB- CÁC THỂ CETON
TỔNG HỢP ACID BÉO – ĐẠI CƯƠNG
Thức ăn không phải là nguồn AB duy nhất
Tất cả các cơ quan trong cơ thể đều có thể
tổng hợp AB để dự trữ năng lượng lâu dài và
dùng trong cấu trúc màng tế bào
Xảy ra mạnh mẽ ở mô gan, mỡ , niêm mạc
ruột, yếu ở cơ, da, thần kinh.
Xảy ra ở bào tương, một phần ít xảy ra ở
trong ty thể và microsome
Tổng hợp AB đơn giản hơn thoái hóa AB
TỔNG HỢP ACID BÉO – ĐẠI CƯƠNG
Sự khác nhau giữa tổng hợp và thoái hóa AB
-Tổng hợp AB xảy ra ở bào tương
- Thoái hóa AB chỉ xảy ra ở ty thể
-Tất cả sự tổng hợp xảy ra nhờ sự xúc tác của một
phức hợp enzym:MULTIENZYM ACID BÉO
SYNTHETASE
-NADH và FADH2 được tạo thành trong thoái hóa
-NADPH được sử dụng cho tổng hợp
TỔNG HỢP AB – CÁC BƯỚC

TỔNG HỢP AB
AB CẦN THIẾT:LINOLEIC và LINOLENIC
Cơ thể không tổng hợp được phải lấy từ thức ăn
Thuộc họ ω-3 và ω-6, có ở dầu thực vật và dầu cá
Chuyển thành acid arachidonic và eicosapetaenoic để
tổng hợp eicosanoids(prostaglandin, leucotrienes,
thromboxane)
CHOLESTEROL – SINH TỔNG HỢP
Được tổng hợp chủ yếu ở gan, vỏ thượng thận,
lách, niêm mạc ruột , phổi, thận.
Cholesterol là tiền chất của nhiều chất có hoạt tính
sinh học quan trọng:
CHOLESTEROL- TỔNG HỢP
CHOLESTEROL- VẬN CHUYỂN TRONG MÁU
Cholesterol di chuyển trong máu , đặc biệt trong
thành phần β lipoprotein. Trong máu, đặc biệt
trong gan cholesterol bị este hóa tạo thành
cholesterol este
-Trong máu:
Lecithin lysolecithin
C CE
LACT(Lecithin- cholesterol acyl transferase)
-Tại gan:
Acyl CoA HSCoA
C CE
ACAT (Acyl CoA- cholesterol- Acyl
transferase)
CHUYỂN HÓA TG, PL VÀ CÁC LIPID KHÁC
TRIGLYCERID
Xảy ra mạnh mẽ ở
mô gan và mô mỡ
CHUYỂN HÓA TG, PL VÀ CÁC LIPID KHÁC
PHOSPHOLIPID
-Thoái hóa:
Dưới tác dụng của
phospholipaseA,
B,C,D các PL bị
Thủy phân thành
AB, Glycerol,
a.phosphoric,base N
CHUYỂN HÓA TG, PL VÀ CÁC LIPID KHÁC
PHOSPHOLIPID
Tổng hợp:
Xảy ra chủ
yếu ở gan.
Chuyển đến
các mô khác
tham gia cấu tạo
màng tb,hoặc thoái
hóa cho năng lượng
VẬN CHUYỂN LIPID MÁU
Có 4 loại lipoprotein huyết tương chính vận chuyển
lipid trong máu là: Chylomicron,VLDL,LDL, HDL.
Thành phần lipid các LP thường giống nhau gồm
TG,CE,C,PL. nhưng khác nhau về tổng lượng và tỷ
lệ các loại lipid trên.
Nguyên tắc cấu trúc:các phân tử hoặc các nhóm
chức ưa nước quay ra ngoài( vỏ bọc), phần nhân là
các phân tử , các gốc kỵ nước
VẬN CHUYỂN LIPID MÁU
Thành phần của các LP
VẬN CHUYỂN LIPID MÁU
Các LP có tỷ lệ lipid và protein giống nhau nên
chúng có tỷ trọng và điện tích khác nhau, có thể
tách riêng các loại bằng ly tâm hoặc điện di
VẬN CHUYỂN LIPID MÁU
CHỨC NĂNG CỦA LIPOPROTEIN
Chylomicron: chuyển TG từ thức ăn ở đường
tiêu hóa đến gan
VLDL: Chuyển TG nội sinh từ gan đến mô
ngoại vi
LDL: chuyển cholesterol đến các tế bào ngoại
biên
HDL: chuyển cholesterol từ tb ngoại biên về
gan.
VẬN CHUYỂN LIPID MÁU
CHUYỂN HÓA LP
Như vậy VLDL, IDL, LDL là chất vận chuyển
cholesterol từ gan đến các tế bào ngoại biên.
Khi LDL nhiều thì nồng độ cholestetrol tăng cao
trong máu có thể gây ứ đọng thành mạch, nguy
cơ của bệnh xơ vữa động mạch, các LP này
được gọi là các LP gây xơ vữa.
HDL là chất vận chyển ngược cholesterol từ tế
bào ngoại vi về gan, chống ứ đọng cholesterol ,
HDL được coi là chất bảo vệ thành mạch, chống
xơ vữa
ĐẶC ĐIỂM CHUYỂN HÓA LIPID Ở MỘT SỐ MÔ
Mô mỡ
 Nơi dự trữ phần lớn AB.
 AB được vận chuyển từ gan đến mô mỡ bởi phức hợp
VLDL.
 AB chuyển thành triglycerid ở tế bào mỡ để dự trữ.
 Glycerol-3 phosphate được tế bào yêu cầu để tổng
hợp triglycerid. Quá trình này đến từ đường glucose.
ĐẶC ĐIỂM CHUYỂN HÓA LIPID Ở MỘT SỐ MÔ
ĐẶC ĐIỂM CHUYỂN HÓA LIPID Ở MỘT SỐ MÔ
Gan:
Là nơi tạo mật, thoái biến và tổng hợp AB, tổng hợp
phospholipid, cholesterol este và triglycerid
Tổng hợp AB , β oxy hóa AB xảy ra chủ yếu ở gan tạo
acetyl CoA, một phần tiếp tục đốt cháy trong chu trình
acid citric
PL được tổng hợp chủ yếu ở gan, vận chuyển, đưa mỡ
ra khỏi gan
TG được tổng hợp ở gan, được vận chuyển ra khỏi gan
dưới dạng VLDL.
CHUYỂN HOÁ PROTEIN
CHUYỂN HOÁ PROTEIN
SƠ ĐỒ TỔNG QUÁT CHUYỂN HOÁ PROTID
Protein thức ăn
Acid amin
Protein cơ thể
Các sản phẩm
chứa nitơ khác
Bộ khung carbon NH
4
+
Urea
Bài tiết
Acetyl CoA
Pyruvate, sản phẩm
trung gian chu trình
acid citric
ATP Glucose
THOÁI HOÁ PROTEIN
NHU CẦU PROTEIN CỦA CƠ THỂ
- Cơ thể cần 30 – 60 g/ngày (khoảng 1g/kg/ngày)
- Vai trò:
• Tổng hợp protein cấu trúc và chức năng: collagen,
myosin…
• Tổng hợp protein có hoạt tính sinh học: enzym,
hormon…
• Tổng hợp chất có hoạt tính sinh học: histamin,
serotonin…
• Cung cấp 12% tổng năng lượng cơ thể (ở động vật ăn
thịt 90%)
- Acid amin dư thừa (từ thức ăn) không được dự trữ
Suy dinh dưỡng năng lượng protein:
- Thể marasmus: suy kiệt tổng quát do thiếu cả năng lượng
và protein.
- Thể kwashiorkor: đặc trưng bằng phù, năng lượng nhập
vào đủ nhưng thiếu cả chất và lượng protein.
Thực tế thường gặp dạng trung gian của 2 thể này.
NGUỒN GỐC ACID AMIN TRONG CƠ THỂ
Acid amin ngoại sinh Acid amin nội sinh
- Từ động vật, thực vật và vi sinh
vật (tảo, men bia…) hấp thu vào cơ
thể qua quá trình tiêu hoá
- Tổng hợp trong cơ thể
- Thuỷ phân từ protein tế bào (men
catepsin có trong lysosom, gây hiện
tượng tự tiêu)
TIÊU HOÁ VÀ HẤP THU PROTEIN
Tiêu hoá:
Proteinase (protease): là các peptidase thuỷ phân protein thành
peptid rồi thành acid amin tự do:
- Endopeptidase: cắt các liên kết peptid bên trong chuỗi: pepsin,
trypsin, chymotrypsin…, thường đặc hiệu cho acid amin
- Exopeptidase: cắt liên kết peptid ở đầu tận
• Aminopeptidase: đầu N tận
• Carboxypeptidase: đầu C tận
Hấp thu:
Acid amin tự do
Niêm mạc ruột non
Tĩnh mạch cửa
Gan
Mô, tế bào
Tiêu hoá protein
• Enzym tiêu hóa được tiết ra dưới dạng tiền enzym
(proenzym) không hoạt động. Khi được đưa vào
lòng ruột, các tiền enzym sẽ được hoạt hóa thành
dạng hoạt động.
VÒNG LUÂN CHUYỂN PROTEIN
Protein cơ thể
Acid amin
Thoái hoá
protein
Tái sử dụng để
tổng hợp protein
Thoái hoá
Ở người lớn, 1-2% tổng lượng protein cơ thể thoái hoá
mỗi ngày (chủ yếu từ cơ), tạo acid amin tự do:
- 75-80% được tái sử dụng để tổng hợp protein mới
- 20-25% tạo urea
Protein tế bào luôn được đổi mới.
Cân bằng nitơ (nitrogen balance)
• Ở người trưởng thành, khối protein ổn
định do lượng protein tổng hợp và protein
thoái hoá liên tục và cân bằng.
CÂN BẰNG NITƠ
Là sự khác biệt giữa tổng lượng nitơ nhập và tổng
lượng nitơ mất qua phân, nước tiểu và mồ hôi.
- Dương: nhập > xuất. VD: trẻ nhỏ đang phát triển, phụ
nữ có thai, người bệnh hồi phục.
- Âm: nhập < xuất. VD: người già, sau phẫu thuật, ung
thư tiến triển, ăn không đủ.
Người lớn bình thường: nhập = xuất
THOÁI HOÁ NITƠ CỦA ACID AMIN
SẢN PHẨM CỦA THOÁI HOÁ NITƠ Ở
ĐỘNG VẬT
- ammonia
- acid uric
- urea
Ưu thế ammonia: cá xương (Teleostei) (thải nhờ trao đổi
liên tục với môi trường nước)
Ưu thế acid uric: chim (cần giữ nước, giữ trọng lượng
thấp)
Ưu thế urea: người (tan nhiều trong nước, không độc)
Acid α-amin
Acid α-ceto
α-Cetoglutarate L-Glutamate
NH
3
CO
2
Urea
Dòng di chuyển của nitơ trong dị hoá acid amin
(Sinh tổng hợp urea)
Chuyển amin
Khử amin
oxi hoá
Chu trình urea
CHUYỂN AMIN
transaminase
(vitamin B6)
Mô động vật: 2 enzyme phổ biến nhất và hoạt động mạnh nhất là
glutamate oxaloacetate transaminase (GOT) và glutamate pyruvate
transaminase (GPT)
α-Cetoglutarate
Pyruvate
Alanine
Glutamate
Aspartate
Oxaloacetate
GPT GOT
GPT, GOT
GPT
GOT
GPT=glutamate pyruvate transaminase=ALT=alanine transaminase
GOT=glutamate oxaloacetate transaminase=AST=aspartate transaminase
GOT, GPT - Ứng dụng lâm sàng
• Xác định hoạt độ transaminase SGOT (AST) và
SGPT (ALT) và chỉ số GOT/GPT (De Ritis) trong
các bệnh lý tim, gan hay cơ vân…
• GOT và GPT là các enzym nội bào, bình thường
trong huyết thanh < 40 UI/l.
• Xét nghiệm tránh vỡ hồng cầu.
• Nhồi máu cơ tim: chủ yếu tăng GOT, chỉ số
GOT/GPT > 1, tăng gấp 2-25 lần, tăng sớm, cao
nhất từ 16-48 giờ.
• Viêm gan siêu vi: tăng cả GPT và GOT; GPT
tăng nhiều GOT/GPT < 1, tăng gấp trăm lần,
sớm trước vàng da, tăng kéo dài, chuyển thành
mạn tính.
Khử carboxyl tạo amin
• Phổ biến ở vi sinh vật
Các amin khi hết tác dụng, sẽ bị
khử amin và oxy hoá:
Khử carboxyl tạo amin
Chuyên chở NH
3
• NH
3
:
 Nội sinh: Khử amin oxy hoá các acid amin
Thoái hoá base nitơ
 Ngoại sinh: vi khuẩn có enzym thuỷ phân protein trong
ruột (NH
3
/TM cứa > NH
3
/tuần hoàn 5-10 lần)
• glutamine:
 Không độc, không mang điện tích, nên dễ vận chuyển
qua màng.
 Là chất vận chuyển NH
4
+
chủ yếu/máu
 Nguồn cung cấp nhóm amin cho tổng hợp acid amin
TỔNG HỢP glutamine
Mg
2+
- Chuyên chở NH
3
trong máu. NH
3
tự do trong máu: 1-2 mg/l
- Là cơ chế khử độc NH
3
chủ yếu của não (tạo urea không
đóng vai trò quan trọng). Nhưng nếu NH
3
máu cao không
đủ glutamate não tổng hợp glutamate từ α-cetoglutarat 
kiệt quệ các chất trung gian trong chu trình acid citric.
VẬN CHUYỂN glutamine TRONG MÁU
Acid amin
NH
3
glutamine
(60-100 mg/l)
NH
3
tự do
(1-2 mg/l)
Acid
glutamic
NH
3
NH
3
Urea NH
4
Cl
Nước tiểu

MÁU
GAN THẬN
Alanin vận chuyển NH
4
+
ở mô có cường độ hoạt động mạnh là cơ về gan
(chu trình Glucose-Alanin)
ỨNG DỤNG
NH
3
tăng trong máu gây tổn thương tế bào thần kinh
 NH
3
qua hàng rào máu não, kết hợp glutamate tạo
glutamine gây giảm α keto glutarat của não, dẫn tới giảm
oxaloacetat, ảnh hưởng đến chu trình Krebs, thiếu năng lượng
cho não, tổn thương tế bào.
 Tăng glutamine trong não, giảm dự trữ glutamate (glu cần
thiết cho tạo các neurotransmitter như γ-aminobutyrat
(GABA)).
 Tăng glutamine não, thay đổi chất gây thẩm thấu trong tế
bào hạch glial, gây phù não.
NH
3
tăng trong trường hợp:
- Suy tế bào gan nặng: xơ gan giai đoạn
cuối, nhiễm độc, nhiễm virus gây hoại tử
cấp..
- Nối thông cửa chủ
- Di truyền do thiếu enzym của chu trình
urea
Chu trình Urea
• Chu trình Ornithin
• 1932, Hans Krebs
• Chủ yếu xảy ra ở gan
• 5 giai đoạn (1, 2: xảy ra trong ty thể
3, 4, 5: trong bào tương)
Chu trình Urea
1
2
3
4
5
Chu trình Urea
Chu
trình
Urea
CPS I: carbamyl
phosphat synthetase
OTC: ornithin
transcarbamylase
CHU TRÌNH UREA
1: carbamoyl phosphate
synthetase
2: ornithine transcarbamoylase
3: arginosuccinate synthetase
4: arginosuccinase
5: arginase
Phương trình tổng quát:
CO
2
+ NH
4
+
+ 3ATP + Asp + 2H
2
O Urea + 2ADP + 2Pi + AMP + PPi + fumarate
RỐI LOẠN CHUYỂN HOÁ LIÊN QUAN ĐẾN
CHU TRÌNH UREA
Tăng ammonia máu type 1: thiếu carbamoyl phosphate synthetase
Tăng ammonia máu type 2: thiếu ornithine transcarbamoylase
Tăng citrulline máu: thiếu arginosuccinate synthetase
Tăng acid arginosuccinic máu và nước tiểu: thiếu arginosuccinase
Tăng arginine máu: thiếu arginase trong hồng cầu
Triệu chứng của các bệnh lý di truyền do khiếm khuyết một trong các
enzym của chu trình urea thường xuất hiện ngay sau sinh gồm co giật,
rối loạn vận động, lơ mơ, bú kém, thậm chí hôn mê hay tử vong nếu
không được phát hiện. Nặng nhất là khiếm khuyết carbamoyl
phosphate synthetase.
Urea cycle defects (UCDs)
Urea-ứng dụng lâm sàng
• Urea là sản phầm thoái hoá chủ yếu từ protein, được tạo
thành từ NH
3
và chủ yếu ở gan.
• Khả năng tạo urea của gan rất lớn (tổn thương 2/3, khả
năng tạo urea vẫn bình thường).
• Urea được tạo ra, vào máu, lọc ở thận và thải ra nước tiểu.
• Bình thường:
Urea máu: 3,5 – 7 mmol/l
(0,2 - 0,4 g/l)
BUN (blood urea nitrogen)
• Tăng hay giảm urea có liên quan một số tình trạng bệnh lý.
Liên quan giữa chu trình Urea và chu trình Krebs
THOÁI HOÁ SƯỜN CARBON
NH
3
α keto acid
Amin hoá các α keto acid tạo các
acid amin
Ala
Gln
Urea
Tạo chất béo hay glucose
Amin hoá hay chuyển amin
tạo acid amin không cần thiết
Vào chu trình Krebs tạo CO
2
và H
2
O
Acid amin
TỔNG HỢP ACID AMIN
Quá trình tổng hợp acid amin
– Là quá trình gắn nhóm amin vào sườn
carbon tương ứng
– Nhóm amin: từ thức ăn (VSV, thực vật, động
vật). Sau đó, được sử dụng tạo acid amin mới
dưới dạng nhóm amin của glutamine hoặc
glutamate
– Khung carbon : từ các sản phẩm chuyển
hóa trung gian
ACID AMIN CẦN THIẾT VÀ KHÔNG CẦN THIẾT
Acid amin cần thiết Acid amin không cần thiết
Cơ thể động vật có vú không tổng
hợp được, cần phải lấy từ thức ăn
Arginine
Histidine
Isoleucine
Leucine
Lysine
Methionine
Phenylalanine
Threonine
Tryptophan
Valine
Cơ thể động vật có vú tổng hợp
được
Glycine
Alanine
Cystein
Acid glutamic
Glutamine
Acid aspartic
Asparagine
Tyrosine
Proline
Serine
Arg và His được tổng hợp trong chu trình UREA, nhưng tốc độ rất
thấp không đáp ứng đủ nhu cầu phát triển ở trẻ em
Khái quát tổng hợp acid amin
• Tổng hợp của hầu hết acid amin bắt
đầu từ các sản phẩm trung gian của
TCA
• Tùy theo chất ban đầu, tổng hợp acid
amin được phân thành các nhóm khác
nhau
Khái quát tổng hợp acid amin
CHUYỂN HOÁ CHUYÊN BIỆT CỦA
MỘT SỐ ACID AMIN
GLUTAMATE (1)
PLP : Pyridoxal phosphate
Tổng hợp GABA :
γ-aminobutyric acid là chất ức
chế dẫn truyền thần kinh chính
của hệ TKTW  Thiếu GABA 
mất kiềm chế, động kinh
Cơ chế của GABA : ↑ tính
thấm của kênh Cl-
BENZODIAZEPINES (θ
động kinh) : ↑ tính thấm màng
đối với Clo  ↑ tác dụng của
GABA
Tạo Glutathione tại gan
Glutamate (2)
Glutathion tham gia các quá trình oxy hoá sinh học:
Chuyển hoá HISTIDINE
Tổng hợp
Histamin:
 Histamin được phóng
thích đáp ứng với một
tình trạng dị ứng
 Histamin gây dãn mạch,
co cơ trơn (thụ thể H
1

phế quản, ruột), tăng tính
thấm thành mạch,kích
thích tiết acid dạ dày (thụ
thể H
2
)
CHUYỂN HOÁ
TRYPTOPHAN
Acid nicotinic = Niacin =
Vitamin B3: tiền chất của NAD
và NADP (coenzym của các
phản ứng oxy hóa khử)
Chuyển hoá TRYPTOPHAN
Tổng hợp Serotonin:
 Xảy ra ở hệ TKTƯ, ống
tiêu hóa
 Chức năng dẫn truyền TK
Chuyển hoá TRYPTOPHAN
Tổng hợp Melatonin:
 Được tổng hợp ở TB tuyến
yên
 Tăng cường giấc ngủ do ức
chế sự tổng hợp và bài tiết
Dopamin và GABA ở TB não
vào ban đêm
SƠ ĐỒ TỔNG QUÁT CHUYỂN HOÁ
PHENYLALANINE VÀ TYROSINE
CHUYỂN HOÁ PHENYLALANINE
TỔNG HỢP MELANINE
THOÁI HOÁ TYROSINE
Homogentisat = Alcapton
HORMONE TUYẾN GIÁP
TỔNG HỢP
CATECHOLAMINE
COMT: catechol-O-methyltransferase
MAO: monoamine oxidase
CHUYỂN HOÁ CREATIN
THẬN - GAN

˜
Tổng hợp Creatin và Creatinin
Creatin
• Do gan tạo ra
• 98% creatin về cơ (20-30% creatin, 70-
80% creatin P)
• Là nguồn dự trữ năng lượng của cơ
• Tạo creatin P trong ty thể/cơ
• Phóng thích năng lượng tạo ATP trong
bào chất/cơ
Creatinin
• Sản phẩm khử nước (không cần enzyme)
của creatin
• ≈1,5% creatin chuyển thành
creatinin/ngày (1,8g).
• Lượng creatinin phụ thuộc vào lượng cơ
(tuổi, giới)
• Đánh giá chức năng lọc của thận
Tạo muối mật:
Tạo porphyrin:
Tạo purin, pyrimidin:
Tạo acid nicotinic (vit PP) từ Tryptophan
Tạo MET dưới dạng hoạt hóa giàu năng lượng, dễ
dàng cho nhóm CH
3
trong tổng hợp chất (cystein)
hay để methyl hóa nhiều chất quan trọng như:
BỆNH LÝ DI TRUYỀN LIÊN QUAN ĐẾN
CHUYỂN HÓA ACID AMIN
• Phenylketonuria (Phenyl ceton niệu)
• Suy tuyến giáp bẩm sinh
• MAPLE SYRUS URINE DISEASE
• Alcaptonuria (Alcapton niệu)
• Bạch tạng (Albinism)
BỆNH LÝ DI TRUYỀN LIÊN QUAN ĐẾN CHUYỂN HÓA ACID AMIN
Phenylketonuria (Phenyl ceton niệu)
Phenylketonuria (Phenyl ceton niệu)
• Nguyên nhân:
- Khiếm khuyết di truyền về tạo PAH (NST 12q22-24).
- Khiếm khuyết về enzyme của tetrahydrobiopterin.
• Tyr trở thành aa cần thiết
• Phenylalanin tăng cao trong máu
• Phenyllactic và phenylacetic tăng cao trong nước tiểu
• Tần suất:1:20.000 trẻ sơ sinh
• Nếu không được phát hiện và ngăn ngừa sớm, trẻ sẽ bị
chậm phát triển về mặt trí tuệ
• Phát hiện sớm, trẻ được điều trị bằng chế độ ăn hạn chế
Phe sẽ phát triển bình thường.
Suy tuyến giáp bẩm sinh
Trong suy giáp bẩm sinh
(hypothyroidism), tuyến
giáp không sản xuất đủ
hormon giáp (ví dụ T
4
).
TSH cao do tuyến giáp
kích thích và thiếu
feedback từ T
4
và T
3
(vì
nồng độ thấp).
Suy tuyến giáp bẩm sinh
- Phổ biến là chậm phát triển trí tuệ. Tuy nhiên, không triệu
chứng lúc sinh. Nếu không được phát hiện sớm sẽ dẫn tới
chứng ngu đần (cretinism), chậm phát triển cả về trí tuệ và thể
lực.
- Tần suất chung 1:3500
- Sàng lọc bằng TSH hoặc T
4
từ mẫu máu
khô, lấy vào ngày thứ 3-5
- Phổ biến là sàng lọc TSH, khẳng định bằng T
4
- Giá trị cut-off 15-20mU/l TSH /máu toàn phần.
- Nếu được điều trị sớm, tiên lượng tốt Điều trị càng sớm
càng tốt. Điều trị hormon tuyến giáp, T
4
hay T
3
, rẻ
- Theo dõi θ quan trọng nhất là trong năm đầu
MAPLE SYRUS URINE DISEASE
• 1/760 ở những gia đình Mennonites.
• Thiếu enzym BCKAD (Branched-chain ketoacid
dehydrogenase) .
• Sau sinh có những bất thường về thần kinh như
co giật, hôn mê, có thể tử vong.
• Tăng leucin, isoleucin và valin (aa có nhánh)
trong huyết tương và trong nước tiểu.
• Xuất hiện các dạng oxo-acid bất thường/nước tiểu
(mùi lạ)
• Điều trị:
 Nhanh chóng làm giảm leucin và các BCAA khác.
 Cung cấp đủ năng lượng, các thực phẩm dinh
dưỡng không chứa BCAA cho trẻ.
Alcaptonuria (Alcapton niệu)
Rối loạn di truyền bẩm sinh do thiếu
homogentisate oxygenase
Tích tụ homogentisate, bài tiết ra nước tiểu, có
màu đen do homogentisate bị oxy hóa
Tích tụ acid homogentisic trong mô liên kết, gây
viêm khớp thoái hóa
Tần suất : 1:200.000
MAPLE SYRUS URINE DISEASE
Protein máu
• Nồng độ protein toàn phần/huyết thanh:
65-85 g/l
1. Protein máu giảm :
- Giảm cung cấp: Rối loạn tiêu hóa, RL hấp thu...
- Giảm tổng hợp: Bệnh lý về GAN
- Mất protein: qua đường niệu, tiêu hóa, mất máu..
-Tăng phân hủy: Tiểu đường, cường giáp trạng…
2. Tăng protein/máu :
- Cô đặc máu
- Protein bất thường: Bence Jone protein (Kahler)
Protein niệu
• Bình thường: < 150mg/24h: protein NT (-), vết
• Bệnh lý: >>150mg/24h, kéo dài
 Tăng thẩm tích protein của màng cầu thận, có thể do:
1. Bệnh lý thận: Viêm cầu thận, hc thận hư…
2. Xuất hiện protein bất thường, TLPT thấp
 Tăng khuếch tán protein do giảm tốc độ dòng máu tại
thận: Suy tim, tăng huyết áp, đứng lâu…
 Rối lọan tái hấp thu ở ống thận (hiếm)
 Tổn thương đường tiết niệu
CHUYỂN HOÁ HEMOGLOBIN
TỔNG HỢP HEMOGLOBIN
TỔNG HỢP GLOBIN
Gen mã hóa các chuỗi globin:
|, ¸, o và c nằm trên nhánh ngắn nhiễm sắc
thể 11
o và , nằm trên nhánh ngắn nhiễm sắc thể 16
Phôi Thai Người lớn
Hb Gower 1 (ζ
2
ε
2
) Hb F (α
2
γ
2
) Hb A (α
2
β
2
)
Hb Gower 2 (α
2
ε
2
) Hb A
2

2
δ
2
)
Hb Portland (ζ
2
γ
2
)
TỔNG HỢP HEME
Heme được tổng hợp từ glycine và succinyl-CoA.
÷
OOC CH
2
CH
2
C S-CoA
O
+
÷
OOC CH
2
NH
3
+
÷
OOC CH
2
CH
2
C
O
CH
2
NH
3
+
CO
2
CoA-SH
H
+ succinyl-CoA glycine
o-aminolevulinate (ALA)
o-Aminolevulinic
Acid Synthase
Tạo o-aminolevulinic acid (ALA)
(ty thể)
Kết hợp glycine và
succinyl-CoA, khử
carboxyl. CoA và
carboxyl của glycine
bị loại bỏ
Pyridoxal phosphate (PLP)
N
H
C
O
P

O
O
OH
CH
3
C
H O
÷
+
H
2
N
H
C
O
P

O
O
O
÷
CH
3
HC
÷
+
H
2
N
H
2
C
H
+
COO
÷
glycine-PLP Schiff base (aldimine)
PLP: coenzyme cho ALA
synthase
glycine trong liên kết Schiff
base với PLP aldehyde
Tạo porphobilinogen (PBG)
C
C
N
H
CH
C
CH
2
COO
÷
CH
2
CH
2
COO
÷
H
2
C
NH
3
+
CH
2
CH
2
COO
÷
C
CH
2
O
NH
3
+
CH
2
CH
2
COO
÷
C
CH
2
O
NH
3
+
+

porphobilinogen
(PBG)
2 o-aminolevulinate
(ALA)
2 H
2
O
PBG Synthase
PBG synthase = ALA dehydratase
PORPHOBILINOGEN SYNTHASE
Cần sự tham gia của Zn
2+
.
Bị ức chế bởi Pb
2+
. Ngộ độc chì làm tăng tổng hợp
ALA (do không tổng hợp được heme giải ức chế
phiên mã ALA synthase).
Biểu hiện thần kinh của ngộ độc chì do ALA và tác
dụng trực tiếp của chì
Cơ chế độc não của ALA:
- Cấu trúc tương tự GABA (γ-
aminobutyric acid) – chất dẫn
truyền thần kinh
- ALA tự oxi hoá phát sinh gốc oxy
tự do
CH
2
CH
2
COO
÷
C
CH
2
O
NH
3
+
CH
2
CH
2
COO
÷
CH
2
NH
3
+

ALA GABA
NH
CH
2
CH
2
COO
-
CH
2
COO
-
HN
CH
2
COO
-
CH
2
CH
2
HN
CH
2
CH
2
COO
-
CH
2
COO
-
NH
CH
2
COO
-
CH
2
CH
2
COO
-
COO
-
N
H
CH
2
COO
-
CH
2
CH
2
COO
-
S Enz
N
H
CH
2
COO
-
CH
2
CH
2
COO
-
KẾT GẮN PBG
HO
NH
CH
2
CH
2
COO
-
CH
2
-
OOC
HN
CH
2
COO
-
CH
2
CH
2
HN
CH
2
CH
2
COO
-
CH
2
COO
-
NH
CH
2
COO
-
CH
2
CH
2
COO
-
COO
-
hydroxymethylbilane
Thuỷ phân dipyrromethane của enzyme, giải phóng
hydroxymethylbilane gồm 4 vòng pyrrole
HO
NH
CH
2
CH
2
COO
-
CH
2
-
OOC
HN
CH
2
COO
-
CH
2
CH
2
HN
CH
2
CH
2
COO
-
CH
2
COO
-
C NH
C
CH
2
COO
-
CH
2
CH
2
COO
-
COO
-
NH
CH
2
CH
2
COO
-
CH
2
-
OOC
HN
CH
2
COO
-
CH
2
CH
2
HN
CH
2
CH
2
COO
-
CH
2
COO
-
COO
-
C NH
C
CH
2
CH
2
COO
-
CH
2
-
OOC
Uroporphyrinogen III
Synthase
hydroxy- uroporphyrinogen
methylbilane III
TẠO UROPORPHYRINOGEN III
- đóng vòng
- xoay một pyrrole để tạo tetrapyrrole bất đối xứng

NH
CH
CH
2
H
3
C
N
CH
3
CH CH
2
HN
CH
2
CH
2
COO
-
CH
3
N
CH
2
CH
2
COO
-
H
3
C
protoporphyrin IX
NH
CH
2
CH
2
COO
-
CH
2
-
OOC
HN
CH
2
COO
-
CH
2
CH
2
HN
CH
2
CH
2
COO
-
CH
2
COO
-
COO
-
NH
CH
2
CH
2
COO
-
CH
2
-
OOC
uroporphyrinogen III
TẠO PROTOPORPHYRIN IX

NH
CH
CH
2
H
3
C
N
CH
3
CH CH
2
HN
CH
2
CH
2
COO
-
CH
3
N
CH
2
CH
2
COO
-
H
3
C
N
CH
CH
2
H
3
C
N
CH
3
CH CH
2
N
CH
2
CH
2
COO
-
CH
3
N
CH
2
CH
2
COO
-
H
3
C
Fe
Ferrochelatase
protoporphyrin IX heme
2H
+
Fe
++

TẠO HEM
Hem synthase = ferrochelatase
THOÁI HOÁ HEMOGLOBIN
TIÊU HOÁ HEMOGLOBIN
Hemoglobin
Myoglobin
enzyme
tiêu hoá
Heme
Hematin Phân
Globin
Peptid,
acid amin
Hấp thu
THOÁI HOÁ HEMOGLOBIN: TỔNG QUÁT
- Đời sống hồng cầu 120 ngày
- Hồng cầu chết
Đại thực bào
Hệ võng nội mô
(tuỷ xương, gan, lách)
Thoái hoá hemoglobin
Bilirubin tự do
Bilirubin liên hợp
Heme Globin
Acid amin
Tái sử
dụng
Ruột
Sắt
THOÁI HOÁ HEMOGLOBIN: TỔNG QUÁT
BILIRUBIN TỰ DO
- màu vàng
- không tan trong nước (2 gốc
propionate tạo liên kết H nội
phân tử)
- tự do: chưa kết hợp với acid
glucuronic
- độc hệ thần kinh
- phản ứng nhận biết diazo
chậm bilirubin gián tiếp
Albumin
MÁU
GAN
- 250 – 300 mg được tạo ra/ngày
- nguồn gốc:
• 85% từ phá huỷ hồng cầu già,
• 15% từ sự tạo nguyên hồng cầu không hiệu
quả, chuyển hoá protein chứa heme
(myoglobin, cytochrome, peroxidase)
- vận chuyển trong máu bởi albumin. Đến màng
tế bào gan, bilirubin tách khỏi phức hợp với
albumin, được vận chuyển tích cực vào trong tế
bào.
- dư thừa: mô ngoại mạch: vàng da; não: tổn
thương não
BILIRUBIN TỰ DO
TẠO BILIRUBIN
LIÊN HỢP
- 85% diglucuronate,
15% monoglucoronate
- tan trong nước
- không độc
- phản ứng diazo
nhanh bilirubin trực
tiếp
MẬT RUỘT
PHẢN ỨNG DIAZO
(PHẢN ỨNG VAN DEN BERGH)
Bilirubin liên hợp Diazo sulfanilic acid Azobilirubin (đỏ tía) +
Bilirubin tự do
Diazo sulfanilic
acid
Azobilirubin (đỏ tía)
+ Alcohol
+
Bilirubin trực tiếp
Bilirubin gián tiếp
BIẾN ĐỔI CỦA BILIRUBIN Ở RUỘT
Bilirubin liên hợp
Bilirubin tự do
Urobilinogen
(mesobilirubinogen,
urobilinogen, stercobilinogen)
(không màu)
GAN
Bilirubin
THẬN
Urobilin
(vàng)
NƯỚC TiỂU
Stercobilin
(vàng)
PHÂN
β-glucuronidase vi
khuẩn/ruột già
khử
oxi hoá
80%
tái hấp thu
20%
oxi hoá
MẬT
Chu trình
gan – ruột
RỐI LOẠN CHUYỂN HOÁ HEMOGLOBIN
Bình thường trong huyết thanh:
- Bilirubin toàn phần (Bi TP) < 10 mg/l
- Bilirubin gián tiếp (Bi GT) hay tự do (Bi TD) 2-8
mg/l (85% bi TP)
- Bilirubin trực tiếp (Bi TT) hay liên hợp (Bi LH) 0-2
mg/l (15% bi TP)
Bi TP > 20-25 mg/l: vàng da
VÀNG DA TRƯỚC GAN
Nguyên nhân: tán huyết
- Bệnh hemoglobin (HbS, Thalassemia, Minkowski Chauffard…)
- Thiếu G6PD
- Bệnh miễn dịch (truyền nhầm nhóm máu, bất đồng nhóm máu Rh…)
- Bệnh mắc phải (sốt rét, sốt xuất huyết, nhiễm trùng, nhiễm độc dung
môi hữu cơ)
- Vàng da sinh lý ở trẻ sơ sinh (hệ thống liên hợp, thụ thể màng tế
bào gan chưa phát triển bình thường): ngày thứ 2-3 sau sinh
Xét nghiệm:
- Máu: Bi TD tăng cao; Bi LH tăng nhẹ/bình thường
- Nước tiểu, phân: urobilinogen tăng
VÀNG DA TẠI GAN
Nguyên nhân:
- Bệnh di truyền thiếu hụt men liên hợp bilirubin UDP glucoronyl
transferase
• Hội chứng Crigler-Najjar (loại I, II): hoạt tính men bị giảm
• Bệnh Gilbert: giảm thu nhận bilirubin vào tế bào gan, hoạt
tính men giảm
Xét nghiệm Bi TD tăng cao
- Bệnh mắc phải: viêm gan do virus, nhiễm độc gan do hoá chất
(chloroform, acetaminophen…), xơ gan, ung thư gan
 Xét nghiệm:
- Máu: Bi TD và LH đều tăng
- Nước tiểu: urobilinogen tăng (giảm tái tạo bilirubin), sắc tố mật
(+) (do tắc mật trong gan)
VÀNG DA SAU GAN
Nguyên nhân:
- Tắc đường dẫn mật: sỏi mật, ung thư đầu tuỵ, hạch to chèn
ép đường dẫn mật…
Xét nghiệm:
- Máu: Bi LH tăng là chính
- Nước tiểu: muối mật (+), sắc tố mật (+)
- Phân, nước tiểu nhạt màu.
Tình trạng Bilirubin
huyết
thanh
Urobilinogen
nước tiểu
Bilirubin
nước
tiểu
Urobilinogen
phân
Bình thường TT: 0-2
mg/l
GT: 2-8
mg/l
0-4 mg/24h (-) 40-280
mg/24h
Thiếu máu
tán huyết
Tăng GT Tăng (-) Tăng
Viêm gan Tăng TT và
GT
Giảm (+) Giảm
Vàng da tắc
mật
Tăng TT (-) (+) Vết, (-)
Chỉ có bilirubin tự do mới qua được hàng rào máu-não bệnh não tăng
bilirubin máu (kernicterus) là do tăng bilirubin tự do.
Chỉ có bilirubin liên hợp mới có thể xuất hiện trong nước tiểu vàng da có
bilirubin nước tiểu: tăng bilirubin LH; vàng da không có bilirubin nước tiểu: tăng
bilirubin không liêp hợp
CHUYEÅN HOÙA
ACID NUCLEIC
1. THOAÙI HOÙA ACID NUCLEIC
1.1. Sô ñoà toång quaùt
Acid nucleic (ADN, ARN)
H
2
O Nuclease
Nucleotid
Pvc Nucleotidase
Nucleosid
Nucleosidase
Base N + Pentose
Base N + Pentose
Purin Pyrimidin
Acid uric NH
3
, CO
2
Ureâ
1.2. Thoaùi hoùa base purin
nucleosidase
Xanthin oxidase
2 loại phản ứng chủ yếu: khử amin thuỷ phân và oxy hoá
ADA
deficiency
(ADA)
H
Xanthin oxidase
X
a
n
t
h
i
n

o
x
i
d
a
s
e
Ngöôøi
Chim Acid uric NT
Moät soá boø saùt
Saûn phaåm
thoaùi hoùa cuoái cuøng
Moät soá boø saùt khaùc
Ña soá ÑV coù vuù Alantoin
Nhuyeãn theå
Uricase
• Sản phẩm thoái hóa cuối cùng của purin khác nhau giữa các
loài.
• Ở đa số các loài ĐV có vú, acid uric được chuyển thành
allantoin tan trong nước nhờ uricase.
• Ở người, thiếu uricase nên sản phẩm cuối cùng của thoái
hóa purin là acid uric.
Bình thöôøng:
-Acid uric/maùu ~ 3 – 6 mg%
-Acid uric /NT ~ 500-800 mg/ 24 giôø
Beänh “guùt” (goutte, gout, thoáng phong):
• Acid uric/maùu ||: >10mg% ÷15-20mg%
• Coù tinh theå Natri Urat ôû suïn, xöông …ñaëc bieät laø caùc khôùp
÷Vieâm khôùp caáp
• Soûi ñöôøng tieåu.
2.TOÅNG HÔÏP ACID NUCLEIC
Nguyeân lieäu:
H
3
PO
4
: töø thöùc aên
Ribose: töø con ñöôøng HMP---->Ribose-5- P
Base N: cô theå toång hôïp.
Hai con đường tổng
hợp purin nucleotid
3 giai đoạn:
Gđ 1: Tổng hợp PRPP từ ribose-5-P
Gđ 2: Trải qua nhiều pư để tạo thành IMP
Gđ 3: Tạo thành AMP và GMP từ IMP
TH purin nucleotid từ
ribose 5-phosphat
• Gồm 3 cơ chế ức chế
ngược (ức chế enzym) ở
3 Gđ
• Ở Gđ3 :
IMP  AMP cần có GTP
IMP  GMP cần có ATP
 sự tổng hợp 2
nucleotid này có khuynh
hướng cân bằng.
1
2
3
ĐIỀU HÒA TỔNG HỢP
PURIN NUCLEOTID
HGPRT
TH purin nucleotid từ việc tái sử dụng base
nitơ và nucleosid tự do
Allopurinol allopurinol ribonucleotid bất hoạt (*)
Trong HC Lesch-Nyhan: hoạt tính HGPRT giảm →(*) không xảy ra, nên
allopurinol không có tác dụng.
PRPP
HGPRT
2.2. Toång hôïp Pyrimidin vaø Pyrimidin nucleotid
2 giai ñoaïn:
dUMP
dTMP
d
1
2
Megaloblastic anemia:
 do thiếu CTP, TMP, UTP
→ giảm sản xuất HC
Điều trị bằng Uridin
ĐIỀU HÒA TỔNG HỢP
PYRIMIDIN NUCLEOTID
1
2
C
T
P


c

c
h
ế

n
g
ư

c

e
n
z
y
m

a
s
p
a
r
t
a
t
e

t
r
a
n
s
c
a
r
b
a
m
o
y
l
a
s
e
.
CTP ức chế aspartate
transcarbamoylase (hình
bên)
UMP ức chế CAP
synthase
TTP không có vai trò
trong ức chế ngược trên sự
tổng hợp pyrimidin
Nhiều thuốc dùng trong điều trị (hoá trị K…) tác dụng lên enzym
của quá trình tổng hợp nucleotid
2.3. Toång hôïp caùc deoxyribonucleotid
khöû oxy ôû C
2’
Ribonucleotid Deoxyribonucleotid
Quaù trình khaùc nhau ôû caùc loaøi:
*E.coli:
NDP dNDP
*Lactobacillus:
NTP dNTP
*Toång hôïp caùc dNTP töø dNDP:
dNDP dNTP
ATP ADP
KHỬ RIBONUCLEOTID THÀNH
DEOXYRIBONUCLEOTID
• Khử nhóm 2’-hydroxyl của ribonucleotid diP
• Phức hợp enzym ribonucleotid reductase
Söï taïo thaønh caùc Nucleosid di vaø triphosphat:
Bằng pư phosphoryl hóa
2.4. Toång hôïp ADN
2.4.1.Söï nhaân ñoâi baùn baûo toàn
- Moâ hình: caáu truùc xoaén ñoâi
- Watson vaø Crick: giaû thuyeát veà cô cheá baùn
baûo toàn cuûa söï toång hôïp ADN.
2.4.2.Caáu truùc chaïc ba cuûa ADN (replication fork)
Quaù trình nhaân ñoâi ADN, 5 giai ñoaïn:
1. Nhaän bieát ñieåm môû ñaàu vaø thaùo xoaén taùch
bieät 2 sôïi ADN meï (heä thoáng Replicase)
2 loaïi protein chính tham gia quaù trình naøy:
ADN helicase, taùch rôøi hai sôïi
Protein gaén ADN sôïi ñôn (single strand DNA –
binding protein hay SSB protein), giöõ cho 2
sôïi ADN ñôn ôû traïng thaùi rôøi nhau vaø oån ñònh
2. Taïo ARN moài nhôø primase
Primase keát hôïp ADN helicase taïo primosom
3.Toång hôïp hai sôïi ADN môùi nhôø ADN polymerase
(ADN Polymerase III)
-sôïi daãn,
-sôïi sau ñoaïn Okazaki
4. Loaïi ARN moài nhôø ADN polymerase I. Sau ñoù caùc
ñoaïn ADN môùi tieáp tuïc ñöôïc keùo daøi.
5. Noái nhöõng ñoaïn ADN môùi nhôø ADN ligase
2.4.4. Söûa chöõa ADN :
E.coli, tæ leä sai soùt 1/10
9
– 10
10
nucleotid.
Nhôø ADN polymerase I vaø III coù theå luøi laïi
taùch vaø loaïi boû nucleotid sai, gaén nucleotid
ñuùng.
ARN polymerase khoâng coù taùc duïng töï söûa
chöõa.
Söï nhaân ñoâi ADN ôû tb nhaân thaät vaø tb nhaân sô
ñeàu töông töï nhö nhau.
2.5.Toång hôïp ARN (Söï chuyeån maõ)
CCCACAGCCGCCAGTTCCGCTG
CGCATTTT
ADN-sợi mã hóa
GGGTGTCGGCGGTCAAGGCGAC
GCGTAAAA
ADN-sợi khuôn
CCCACAGCCGCCAGUUCCGCUG
CGCAUUUU
ARN m
Ñieàu chænh ARN:
• ARNm ñöôïc ñieàu chænh raát ít hoaëc khoâng caàn ñieàu
chænh sau khi ARN ñöôïc toång hôïp. Moät soá ARN
ñöôïc giaûi maõ ngay trong quaù trình chuyeån maõ.
• tieàn ARNt vaø tieàn ARNr:
- bò caét ñoaïn bôûi nuclease vaø ñöôïc ñieàu chænh thaønh
nhöõng sôïi ARN môùi.
- theâm moät soá nucleotid vaøo ñaàu ARN.Ví duï, CCA
ñöôïc theâm vaøo ñaàu 3’ cuûa moät soá phaân töû ARNt naøo
chöa coù saün trình töï chuoãi naøy ôû ñaàu.
- thay ñoåi veà base vaø ribose cuûa ARNr.
moät soá base ñöôïc methyl hoùa ;
- taïo base hieám ôû ARNt
SINH TOÅNG HÔÏP PROTEIN
Toång hôïp protein: raát caàn thieát cho söï toàn taïi, taêng
tröôûng vaø phaùt trieån cuûa teá baøo.
Protein coù nhieàu chöùc naêng quan troïng:
- xuùc taùc phaûn öùng hoùa hoïc (enzym),
- xaây döïng teá baøo vaø moâ (protein caáu truùc),
- baûo veä cô theå (khaùng theå) ….
Protein coù tính ñaëc hieäu raát cao:
truyeàn laïi cho theá heä sau (di truyeàn), nghóa laø teá baøo
con toång hôïp ñöôïc nhöõng protein coù caáu truùc vaø tính
chaát gioáng heät nhöõng protein cuûa teá baøo meï.
Luận thuyết trung tâm
Nguồn: Purves et al., Life: The Science of Biology, 4th Edition.
Mã di truyền chuẩn
Nguồn: Purves et al., Life: The Science of Biology, 4th Edition.
Söï chuyeån maõ vaø giaûi maõ
Söï chuyeån maõ: söï phieân maõ, söï sao cheùp, transcription
- laø söï toång hôïp ARNm
- khuoân: ADN (chöùa caùc maõ)
- enzym: ARN polymerase hay transcriptase.
Söï giaûi maõ: söï phieân dòch, translation.
- laø söï toång hôïp protein
- Khuoân: ARNm.
Transcriptase ngöôïc vaø ARN polymerase höôùng ARN
Transcriptase ngöôïc:
- ôû moät soá viruùt gaây ung thö ôû moâ ÑV
- enzym xuùc taùc söï toång hôïp ADN
- khuoân: phaân töû ARN viruùt
- taïo: ADN boå sung (cDNA, complementary DNA)
ARN polymerase höôùng ARN (ARN replicase)
- cuûa E.coli bò nhieãm viruùt
- enzym xuùc taùc söï taïo thaønh moät ARN boå sung
- khuoân: ARN viruùt
- taïo: ARN boå sung vôùi ARN viruùt.
Söï hoaït hoùa vaø vaän chuyeån acid amin
Acid amin seõ ñöôïc hoaït hoùa thaønh nhöõng daïng phaân töû giaøu naêng löôïng.
Quaù trình hoaït hoùa naøy laø raát caàn thieát vì acid amin töï do thì khoâng theå
töï keát hôïp tröïc tieáp ñöôïc vaøo chuoãi polypeptid ñang ñöôïc keùo daøi.
- Enzym xuùc taùc: Amino acyl synthetase
2 giai ñoaïn:
-Hoaït hoùa aa :
Mg++
E + R-CH-COOH + ATP (RCHCOO~AMP)E + PP
NH2 NH2
Adenylat aa
- Taïo phöùc hôïp aa-ARNt:
(RCHCOO~AMP) E + ARNt AMP + E + RCHCOO-ARNt
NH2 NH2
- xaûy ra ôû baøo töông, vôùi söï tham gia cuûa 20 aa, 20 ARNt, ATP,
Mg
++
vaø 20 aa-ARNt synthetase.
Quaù trình bieåu hieän gen
nhaân sô
nhaân thaät
3.5.3.Protein sau khi ñöôïc toång hôïp:
 Thuûy phaân caét fMet hoaëc Met,
 Taïo lieân keát disulfur giöõa 2 cystein; protein töï xoaén vaø
cuoän khuùc taïo neân caùc caáu truùc baäc II, III, IV.
 Coù theå coù moät soá acid amin ñöôïc bieán ñoåi:
prolin, lysin hydroxyprolin, hydroxylysin.
 Taïo glucoprotein:
glucid + protein glucoprotein
 Moät soá protein ñöôïc phosphoryl hoùa.
3.5.4.Söï phaân boá protein
Sau khi ñöôïc caùc baøo quan
toång hôïp, protein
ra ngoaøi teá baøo
3.5.5. Taùc duïng cuûa moät soá khaùng sinh
-ÖÙc cheá söï STH protein ôû vi khuaån ¬vi khuaån khoâng
phaùt trieån ñöôïc.
-Moãi loaïi khaùng sinh coù taùc duïng leân moät khaâu nhaát
ñònh cuûa quaù trình STH protein.
Ví duï:
Chaát öùc cheá Taùc duïng ñaëc hieäu
Chæ taùc duïng treân teá
baøo nhaân sô:
Rifamycin
Tetracyclin
Streptomycin
ÖÙc cheá söï di chuyeån cuûa ARN polymerase
(ngaên caûn söï sinh toång hôïp ARN).
ÖÙc cheá söï gaén aminoacyl-ARNt vaøo vò trí
A cuûa ribosom (böôùc 1).
Ngaên caûn söï chuyeån phöùc hôïp môû ñaàu
sang giai ñoaïn keùo daøi (böôùc 1); gaây ñoïc
nhaàm maõ.
Chloramphenicol
Erythromycin
Taùc duïng treân teá baøo
nhaân sô vaø teá baøo
nhaân thaät:
Puromycin
Actinomycin D
Chæ taùc duïng leân teá
baøo nhaân thaät:
Cycloheximide
ÖÙc cheá phaûn öùng xuùc taùc bôûi peptidyl
transferase (böôùc 2).
ÖÙc cheá phaûn öùng chuyeån vò (böôùc 3).
Gaén vaøo sôïi polypeptid ñang hình thaønh, laøm cho
noù bò phoùng thích sôùm hôn vaø dôû dang.
Gaén vaøo ADN vaø ngaên caûn söï di chuyeån cuûa ARN
Polymerase (ngaên caûn söï toång hôïp ARN).
ÖÙc cheá peptidyl transferase.
Rifamycin
ARN Polymerase
ADN ARN PROTEIN
Môû ñaàu – Keùo daøi – Keát thuùc
1 2 3
Tetra
Strepto Ery
Chloram
Pep.Trans
ferase
LIÊN QUAN VÀ
ĐIỀU HOÀ CHUYỂN HOÁ
Đại cương:
• Các chất đều có con đường chuyển hoá riêng.
• Con đường chuyển hoá của các chất có những
điểm chung, liên quan chặt chẽ tạo nên mạng
lưới chuyển hoá chung rất phức tạp của cơ thể
www.genome.ad.jp/kegg/pathway/map/map01100.html
Sự liên quan
giữa các con
đường chuyển
hoá các chất
Đại cương
• Quá trình chuyển hoá các chất được kiểm soát
chặt chẽ nhờ cơ chế điều hoà ở mức cơ thể
hoặc tế bào.
• Sự điều hoà chuyển hoá các chất theo nhu cầu
của cơ thể.
Sự thống nhất chuyển hóa
Thể hiện ở:
• Chu trình ACID CITRIC
AcetylCoA ÷CO
2
, H
2
O + Q
• HÔ HẤP TẾ BÀO: “ĐỐT CHÁY” G, L, P theo
những cơ chế chung, hệ thống enzym chung ÷
tạo H
2
O, ATP
• HOẠT HÓA, TÍCH TRỮ VÀ SỬ DỤNG NĂNG
LƯỢNG: nhờ quá trình phosphoryl hóa, hệ
thống ADP-ATP.
Các giai đoạn
của quá trình
thoái hoá
Gđ1: Tạo acetyl-CoA từ acid béo,
glucose, và acid amin
Gđ2: Oxi hoá nhóm acetyl trong chu trình
acid citric tách ra từng cặp nguyên tử
hydro.
Gđ3: NADH và FADH
2
mang từng cặp
nguyên tử H đến chuỗi hô hấp tế bào tạo
H
2
O. Quá trình này tích trữ năng lượng
dạng ATP.
Sự biến đổi qua lại giữa G, L, P: thông qua các chất ngã ba đường
• Chất ngã ba đường : sản phẩm thoái hóa chung
: tiền chất chung
GLUCID LIPID
Chất ngã 3 đường
PROTID
TD: PYRUVAT, ACETYLCoA, OAA, GLYCEROL
COOH COOH COOH COOH
l l l l
H
2
N- CH C=O C=O H2N- CH
l l l l
CH
3
+ CH
2
CH
3
+ CH
2
l l
CH
2
CH
2
l l
COOH COOH
Ala oCETO GLUTARAT PYRUVAT Glu
Alanin oceto glutarat Aspartat
ALAT GPT GOT ASAT
Pyruvat L Glutamat Oxalo acetat
CH
2
OH CH
2
OH CH
2
OH
l l l
CHOH CHOH C=O
l l l
CH
2
OH CH
2
O- P CH
2
O- P
PDA
GPT
Glycerol
kinase
ATP ADP
Dehydrogenase
NADHH
+
NAD
+
Pyruvat → tân tạo glucid
→ acetyl CoA → AB
PGA → tân tạo glucid
pyruvat → Ala
Tuy nhiên các chất không thể thay thế nhau hoàn
toàn được vì:
- Glucid là nguồn năng lượng chủ yếu của cơ thể
- Lipid: các AB cần thiết cơ thể không tổng hợp được
- Protid: các AA cần thiết cơ thể không tổng hợp được
chế độ dinh dưỡng hợp lý, đủ chất với tỷ lệ nhất
định.
TỶ LỆ KHẨU PHẦN THỨC ĂN THÍCH HỢP
Năm Tổng Q %
P L G
1972 2300
Kcal
12 13 75
1997 2700
Kcal
10-12 15 - 20 65 - 75
NHÂN
• TỔNG HỢP
ADN
ARN
NAD
+
TY THỂ
• CHHTB
• |Oxh AB
• CTAC
• Tạo thể ceton
BÀO DỊCH
• Đường phân
• HMP
• Tổng hợp AB
TY THỂ VÀ BÀO DỊCH
• Tân tạo G
• CT urê
• Tạo Hem
ATP
RIBOSOM
Tổng hợp protein
ATP
PO
Quan hệ chuyển hóa giữa các bào quan
THỂ TY : nơi chuyển hóa năng lượng (ATP)
NHÂN : tổng hợp ADN, ARN, NAD
+
RIBOSOM : STH Protein

You're Reading a Free Preview

Tải về
scribd
/*********** DO NOT ALTER ANYTHING BELOW THIS LINE ! ************/ var s_code=s.t();if(s_code)document.write(s_code)//-->