[Type text

]

[Type text]

[Type text]

Trường Đại Học Kỹ Thuật – Công Nghệ TP.HCM Khoa Công Nghê Thực Phẩm
  

Đề tài:

-Tp.HCM tháng 11/2011Mục lục
Chương 1 : Tổng quan..............................................................................................4
[Type text] Page 1

[Type text]

[Type text]

[Type text]

I. Sơ lược về vi khuẩn E.coli.....................................................................................4 1. Đặc điểm sinh học..................................................................................................4 1.1 Hình thái................................................................................................................4 1.2 Tính chất nuôi cấy.................................................................................................4 1.3 Tính chất hóa sinh..................................................................................................5 1.4 Kháng nguyên........................................................................................................6 1.5 Phân loại................................................................................................................6 2. Khả năng gây bệnh................................................................................................7 3. Chẩn đoán vi sinh vật............................................................................................12 3.1 Chẩn đoán trực tiếp................................................................................................12 3.2 Chẩn đoán gián tiếp...............................................................................................12 4. Nguyên tắc điều trị và phòng bệnh.......................................................................13 4.1 Điều trị...................................................................................................................13 4.2 Phòng bệnh............................................................................................................13 Chương II : Các phương pháp phát hiện E.coli......................................................14 I. Phương pháp truyền thống....................................................................................14 1. Định lượng E.coli bằng phương pháp MPN........................................................14 1.1 Nguyên tắc.............................................................................................................14 1.2 Quy trình phân tích................................................................................................14 1.3 Cách đọc kết quả....................................................................................................15 2. Định lượng E.coli bằng phương pháp đếm khuẩn lạc........................................15 2.1 Nguyên tắc.............................................................................................................15 2.2 Môi trường và hóa chất..........................................................................................15 2.3 Quy hoạch phân tích..............................................................................................16 2.4 Cách tính kết quả...................................................................................................16
[Type text] Page 2

[Type text]

[Type text]

[Type text]

3. Phương pháp làm giàu vi khuẩn...........................................................................17 3.1 Nguyên lý..............................................................................................................17 3.2 Thiết bị và đồ thủy tinh..........................................................................................17 3.3 Môi trường và thuốc thử........................................................................................17 3.4 Cách làm................................................................................................................17 II. Phương pháp hiện đại..............................................................................................22 1. Phương pháp PCR.................................................................................................22 1.1 Nguyên tắc.............................................................................................................22 1.2 Môi trường tăng sinh.............................................................................................22 1.3 Môi trường phân lập..............................................................................................22 1.4 Trích ly DNA.........................................................................................................22 1.5 Qui trình multiplex-PCR........................................................................................24 1.6 Ưu và nhược điểm của phương pháp PCR.............................................................24 2. Phương pháp ELISA.............................................................................................25 2.1 Nguyên tắc.............................................................................................................25 2.2 Các phương pháp ELISA.......................................................................................26 2.3 Phát hiện E.coli O157:H7 bằng phương pháp Elisa...............................................29 2.4 Ứng dụng của kháng thể đơn dòng trong xác định E.coli O157:H7.......................30 2.5 Ưu điểm của phương pháp E.lisa...........................................................................30 3. Phát hiện E.coli bằng phức hợp kháng thể + hạt nano silica phát quang..................30 Kết Luận.....................................................................................................................34 Phụ Lục......................................................................................................................35 Tài liệu tham khảo.....................................................................................................47

[Type text]

Page 3

[Type text]

[Type text]

[Type text]

Chương I: TỔNG QUAN VỀ VI KHUẨN ESCHERICHIA COLI

I. SƠ LƯỢC VỀ VI KHUẨN ESCHERICHIA COLI (E.COLI)

Escherichia coli do Theodore Escherich (1857-1911), một nhà vi khuẩn học người Áo, phát hiện lần đầu tiên năm 1885. Chi Escherichia thuộc họ vi khuẩn đường ruột. Trong các loài thuộc chi này, E.coli được chọn làm điển hình và có vai trò quan trọng nhất trong y học. E.coli là một trong những thành viên chính của hệ vi khuẩn bình thường ở ruột nhưng cũng là căn nguyên của nhiều bệnh nhiễm trùng, trong đó có những bệnh nó là căn nguyên đứng đầu.

E.coli đã được sử dụng làm mô hình nghiên cứu về sinh học phân tử trong lĩnh vực vi sinh học nói riêng và sinh học nói chung.
[Type text]

Hình 1.1: Hình chụp vi khuẩn E.coli dưới kính hiển vi với kích thước 2 µm

Page 4

[Type text]

[Type text]

[Type text]

E.coli K12 là vi khuẩn được sử dụng làm mô hình nghiên cứu nhiều nhất. nhiều thành tựu về di truyền học, hóa sinh học đã được thu trên cơ sở nghiên cứu vi khuẩn này. Ngày nay E.coli cũng được sử dụng nhiều trong công nghệ sinh học. Mặc dù E.coli là loài vi khuẩn được nghiên cứu sâu nhất, cho đến nay nó vẫn tiếp tục được quan tâm nghiên cứu, với rất nhiều phát hiện mới ở tầm phân tử, đặc biệt cơ chế bệnh sinh của các type gây bệnh (pathotype).
1. Đặc điểm sinh học

1.1 Hình thái E.coli là trực khuẩn Gram âm. Kích thước trung bình từ 2 đến 3µm x 0,5µm; trong những điều kiện không thích hợp (ví dụ như trong môi trường có kháng sinh) vi khuẩn có thể rất dài như sợi chỉ. Rất ít chủng E.coli có vỏ, nhưng hầu hết có lông và có khả năng di động. 1.2. Tính chất nuôi cấy E.coli phát triển dễ dàng trên các môi trường nuôi cấy thông thường. Một số có thể phát triển trên môi trường tổng hợp rất nghèo chất dinh dưỡng. Hiếu kỵ khí tùy ý. Có thể phát triển ở nhiệt độ từ 5-400C. Nhiệt độ thích hợp xung quanh 370C. Trong điều kiện thích hợp E.coli phát triển rất nhanh, thời gian thế hệ chỉ khoảng 20 đến 30 phút. Cấy vào môi trường lỏng (như canh thang) sau 3 đến 4 giờ đã làm đục nhẹ môi trường, sau 24 giờ làm đục đều; sau hai ngày trên mặt môi trường có váng mỏng. Những ngày sau, dưới đáy ống có thể thấy lắng cặn. E.coli không mọc trên canh thang Selenit. Trên môi trường thạch thường, sau khoảng 8 đến 10 giờ, dung kính lúp đã có thể quan sát được khuẩn lạc. Sau 24 giờ khuẩn lạc có kích thước khoảng 1,5mm. Hình thái khuẩn lạc điển hình dạng S, nhưng có thể gặp dạng R, hoặc M. Trên môi trường phân lập, tùy theo chất chỉ thị màu, E.coli có khuẩn lạc màu vàng (như trên thạch lactose) hoặc màu đỏ (như trên thạch MacConkey). Không mọc được trên môi trường SS. Một số loại E.coli có tính chất nuôi cấy riêng có giá trị trong sàng lọc nhanh, như EAEC tạo thành váng đặc trường khi nuôi cấy trên canh thang Muller-Hinton. 1.3. Tính chất hóa sinh E.coli có khả năng lên men nhiều loại đường và có sinh hơi. Hầu hết E.coli đều lên men lactose và sinh hơi, trừ E.coli trơ (inactive) (trong đó có EIEC) không hoặc lên men rất chậm. Một số chi khác trong họ vi khuẩn đường ruột cũng có khả năng lên

[Type text]

Page 5

[Type text] Page 6 .blatta e + T + + + E. Có decarboxylase.1: Tính chất hóa sinh của một số loài thuộc chi Escherichia Các loài Thử nghiệm CNPG Indole Đỏ methyl VogesProskauer Citrate (Simmons) Lysine decarboxylase Arginine dihydrolase Ornithine decarboxylase Di động D-Glucose acid E. E. Enterobacter.alberti s i + + T T + + + T + + + T ? + + + + + + - D-Glucose sinh + + + hơi Lactose + T Sucrose T T D-Mannitol + + + Adonitol + Cellobiose + D-Sorbitol + T D-Arabitol L-Ramnose T T + + Sinh sắc tố vàng ONPG: Ortho-nitrophenyl-beta-Dgalactopyranoside +: >90% dương tính -: < 10% dương tính. ornithin.herma nnii + + + + + + + T T + + + + E. vì vậy có khả năng khử carboxyl của lysine.[Type text] [Type text] [Type text] men nhanh lactose (như Klebsiella. Không sinh H2S.coli có khả năng sinh indole. Thử nghiệm VP (Voges Proskauer) sau 24 giờ âm tính. Serratia và Citrobacter) được gộp vào một nhóm vi khuẩn có tên chung là coliform. Betagalactosidase dương tính. sau 48 giờ có thể dương tính. Không sử dụng được nguồn carbon của citrate trong môi trường Simmons.vulneri E.fergus onii T + + T + + + + E.coli (inactive ) T T + T T + E.coli (bình thường) + + + T T T + + E. Bảng 1. arginin và acid glutamic.

B và L dưới dạng màng rất mỏng chỉ có thể quan sát được nhờ kính hiển vi điện tử. B và L.coli ngưng tập ruột DAEC (Diffusely adherent E.coli): E.coli xâm nhập ruột EAEC (Enteroaggregative E.coli): E.coli) hay E.coli.coli): E. Kháng nguyên Kháng nguyên O: người ta đã biết tới gần 160 yếu tố kháng nguyên O của E. Kháng nguyên H: hơn 50 yếu tố kháng nguyên H đã được xác định. Dựa vào vị trí gây bệnh các E.coli gây tiên chảy (DEC-Dierrheagenic E.coli gây bệnh đường ruột (IPEC) đã được biết gồm: EPEC (Enteropathogenic E. Mỗi type huyết thanh được ký hiệu bằng kháng nguyên O và K.coli được chia thành các type huyết thanh.coli gây nhiễm khuẩn đường tiết niệu 2.[Type text] [Type text] [Type text] T: 10-90% dương tính 1. E.coli).coli gây xuất huyết ruột - Hai loại E. 1. Với sự tổ hợp của các yếu tố kháng nguyên O. thứ hai là nhóm gây bệnh ngoài đường ruột (ExPEC-extraintestinal pathogenic E. - Các loại E.coli): E. trong đó A dưới dạng vỏ quan sát được bằng kính hiển vi quang học thông thường.coli có khả năng gây bệnh ở người được chia thành 2 nhóm: thứ nhất là nhóm gây bệnh đường ruột (IPEC-intestinal pathogenic E. yếu tố kháng nguyên K số 7 loại B).coli sinh độc tố ruột EIEC (Enteroinvasive E.coli gây bệnh ngoài đường ruột quan trọng nhất là: MAEC (Meningitidis-associated E.4. Kháng nguyên K: Khoảng 100 yếu tố kháng nguyên K đã được xác định và được chia thành ba loại: A.coli): E. Khả năng gây bệnh [Type text] Page 7 .5 Phân loại Dựa vào cấu trúc kháng nguyên. ví dụ O86B7 (yếu tố kháng nguyên O số 86.coli): E. K và H sẽ có rất nhiều type huyết thanh khác nhau.coli gây bệnh đường ruột ETEC (Enterotoxigenic E.coli gây viêm màng não UPEC (Uropathogenic E.coli bám dính phân tán EHEC (Enterohaemorrhagic E.coli).coli): E.coli): E.

viêm đường mật. LT bám vào thụ thể GM1 của tế bào biểu mô ruột non nhờ tiểu phần B. ST-I gồm ST-Ia và ST-Ib. Hầu hết các chủng sản xuất ra ST-Ib phân lập được từ người.coli sinh độc tố ruột Hai yếu tố động lực quyết định khả năng gây bệnh của ETEC là: khả năng bám dính vào niêm mac ruột và sản xuất độc tố. Tiều phần A được đẩy vào tế bào biểu mô hoạt hóa enzyme adenylate cyclase làm tăng AMP vòng (cAMP-cyclic adenosine monophosphate). Một chủng E. O128B12. E. Hậu quả của quá trình này là áp lực thẩm thấu trong lòng ruột tăng. viêm phổi ở trẻ mới sinh. Cấu tạo của LT gồm 1 tiểu phần A (active) với phân tử lượng 25. GMP vòng gây rối loạn chuyển hóa nước và điện giải giống như AMP vòng.aureus) về tỷ lệ phân lập được (tính chung tất cả các loại bệnh phẩm) ở nước ta.coli cũng là 1 vi khuẩn gây bệnh quan trọng. Độc tố chịu nhiệt ST có trọng lượng phân tử xấp xỉ 5000 Dalton. O119B4. Những type huyết thanh có khả năng gây bệnh thường gặp trên lâm sàng là: O111B4. gồm hai loại LT I được mã hóa bởi gen trên plasmid và LT II được mã hóa bởi gen trên nhiễm sắc thể. O26B6. Có hai loại độc tố ruột: loại không chịu nhiệt LT (heat labile toxin) và loại chịu nhiệt ST (heat stable toxin). chiếm tỷ lệ cao nhất trong số các vi khuẩn hiếu khí (khoảng 80%). Quyết định khả năng gây tiêu chảy của ETEC là độc tố ruột. E. E. Khả năng này có vai trò của kháng nguyên CFA (clonisation factor antigen) đã được mã hóa bởi gen trên plasmid.coli là căn nguyên thường gặp trong viêm màng não. ST tác động lên ruột bằng sự hoạt hóa enzyme guanylate cyclase làm tăng GMP vòng (cGMPcyclic guanosine monophosphate). Người ta đã nói đến ST-I và ST-II. nhiễm trùng trong bỏng.[Type text] [Type text] [Type text] E. Khả năng bám dính và cư trú trên tế bào biểu mô ruột non là điều kiện đầu tiên để có thể gây bệnh. dẫn đến làm giảm hấp thu Na+. Cơ chế gây bệnh của E. nước được kéo từ tế bào ra lòng ruột gây tiêu chảy.coli đứng thứ hai (sau S. Tuy nhiên.coli là thành viên thuộc nhóm vi hệ bình thường của đường tiêu hóa. O55B5.coli còn gặp trong nhiễm trùng ngoại khoa.500 Dalton.coli có thể sinh một trong hai hoặc cả hai độc tố đó. O86B7. O127B8. còn ST-Ia thì hầu hết từ động [Type text] Page 8 . ST còn làm mất hoặc làm teo một phần nhung mao của tế bào biểu mô ruột.coli khác nhau tùy loại:  ETEC-E.000 Dalton và năm tiển phần B (binding) với phân tử lượng 11. tăng tiết Cl-. Độc tố ruột LT là ngoại độc tố. nó đứng đầu trong các vi khuẩn gây tiêu chảy. O126B16. O25B15. viêm đường tiết niệu. Theo báo cáo của chương trình quốc gia giám sát tính kháng thuốc của các vi khuẩn gây bệnh thường gặp (1988-1994) thì E. đứng hàng đầu trong các căn nguyên gây nhiễm khuẩn huyết. LT I và LT II có cấu trúc và cơ chế tác động giống nhau và giống với độc tố ruột của vi khuẩn tả.

AAF/II và AFF/III. EAEC tạo thành váng đặc trưng. làm tiêu các túi thực bào và nhân lên trong bào tương. Tổn thương nhất chính là viêm loét hoại tử niêm mạc đại tràng. Protein Pet được tiết qua màng ngoài vi khuẩn. Khả năng xâm nhập được mã hóa bởi gen trên plasmid 140MDa.coli thuộc loại EAEC. trong đó loại I và II có cấu trúc bó. Tiêu chảy do ETEC thường khởi phát đột ngột. EAST-1 có khả năng phá hủy tế bào biểu mô. EIEC xâm nhập vào trong tế bào biểu mô đại tràng. EIEC cho kết quả (+) tính trong thử nghiệm khả năng gây viêm kết giác mạc chuột lang (thử nghiệm Sereny). protein Pet và độc tố EAST-1 (enteroaggregative heat-stable toxin-1). Triệu chứng lâm sàng điển hình là đi ngoài phân ít. Khi nuôi cấy trên canh thang Muller-Hinton. Yếu tố aggR có vai trò điều hòa sự biểu hiện của các AFF. Ipa-Invasion plasmid antigen). Cơ chế bệnh sinh trong tiêu chảy do EAEC vẫn chưa được sáng tỏ hoàn toàn. loại III có dạng sợi riêng biệt. nhất là ở trẻ em. Tính chất này được dùng để sàng lọc nhanh các chủng E. Các yếu tố độc lực nêu trên của EAEC phần lớn được mã hóa bởi các gen nằm trên plasmid có phân tử lượng 60 MDa.  EIEC-Ecoli xâm nhập ruột EIEC gây bệnh chủ yếu do khả năng xâm nhập vào niêm mạc đại tràng. Vì vậy trong y văn hiện nay viết căn nguyên gây bệnh lỵ trực khuẩn (bacillary dysentery) gồm Shigella và EIEC. Nó cũng là một trong những căn nguyên quan trọng của nhiễm khuẩn đường tiêu hóa ở khách du lịch. Các gen trên plasmid này mã hóa cho các kháng nguyên xâm nhập (IpaA đến IpaD. Yếu tố điều hòa bám dính kết tập aggR.[Type text] [Type text] [Type text] vật hoặc các thức ăn có nguồn gốc động vật. gây tích tụ dịch và gây độc cho biểu mô tiêu hóa. Một số yếu tố độc lực đực mã hóa bởi các gen trên nhiễm sắc thể đang được nghiên cứu. EIEC còn có khả năng sản xuất độc tố ruột giống một số Shigela. Những yếu tố động lực chính của EAEC được nói đến gồm các diềm bám dính kết tập AAF (aggregative adhesion fimbriae). phá hủy tế bào rối mới xâm lấn sang các tế bào khác. Ba loại AAF đã được nói đến là AAF/I. Các AFF tạo nên kiểu bám dính hình chồng gạch trên tế bào Hep-2. phân toàn nước không có nhày. [Type text] Page 9 . máu. Gen mã hóa cho độc tố này có tên là sen (Shigella enterotoxin). Cơ chế gây bệnh giống vi khuẩn lỵ. Diềm bám dính kết tập được cho là yếu tố quyết định độc lực.coli bám dính kết tập ruột EAEC thường gây tiêu chảy kéo dài hoặc mạn tính. EAEC-E. Chưa gặp các chủng sinh ST-II gây tiêu chảy ở người. Ngoài các yếu tố dộc lực nêu trên EAEC còn tiết ra 1 protein có khả năng làm tan máu và làm mất thăng bằng vận chuyển ion qua màng. có lẫn nhày máu.

EspB.coli Gen động lực hoặc yếu tố độc lực Plasmid 50-70 MDa (EAF): Mã hóa BFP (bundle-forming pilus).tăng cAMP – giảm hấp thu Na+/tăng tiết Cl. EspF.tăng cGMP – tiết chloride và/hoặc giảm hấp thu NaCl – tiêu chảy Các gen trên plasmid 140 MDa mã Vi khuẩn bám và xâm hóa các kháng nguyên xâm nhập nhập vào biểu mô đại (invasion plasmid antigen) IPaA – tràng. CFA-III (tạo bó). EspD. các protein tiết. Per (plasmid-encoded regulator) và Ler (LEE-encoded regulator.coli gây bệnh đường ruột Loại E. EspA. PAI nhiễm sắc thể (LEE) TTSS gồm: intimin (eaeA).[Type text] [Type text] [Type text] Bảng 1. CFA-II và CFA-IV (fimbriae mềm) và pili dài liên quan với type IV Đặc điểm lâm sàng Bám dính tại chỗ nhờ Các tổn BFP thương A/E Tổn thương mô A/E Tiêu chảy cấp Cơ chế gây bệnh EPEC ETEC Bám vào niêm mạc ruột non (CFA I-IV) và sản xuất các độc tố ruột LTI. phân thường toàn nước không có nhầy máu Hội chứng lỵ trực khuẩn Tiêu chảy kéo dài [Type text] Page 10 . STa. EspG và MAP (mitochondriaassociated protein) EAST-1 CDT (Cytolethal distending toxin) Các CFA mã hóa bởi plasmid: CFA-I (fimbriae cứng). nhân lên gây IpaD viêm loét hoại tử niêm mạc đại tràng Điểm bám dính kết tập AAF AAF tạo nên kiểu bám (aggregative adhesion fimbriae) dính hình chồng gạch aggR điều hòa sự biểu Yếu tố điều hòa bám dính kết tập aggr hiện của AAF Protein pet gây tích tụ dịch và gây độc tố cho biểu mô tiêu hóa Độc tố EAST-1 (enteroaggregative EAST-1 phá hủy tế heat-stable toxin-1) bào biểu mô Protein làm tan máu và mất thăng Protein làm tan máu Tiêu chảy cấp.. Tir.tiêu chảy Độc tố vững bền với nhiệt STa và STb Hoạt hóa guanylate (mã hóa bởi plasmid và transposon) cyclase. LTII.2: Tóm tắt các đặc điểm liên quan đến khả năng gây bệnh của các E. STb ETEC EIEC EAEC Độc tố chịu nhiệt LT I và LT II (mã hóa bởi plasmid) Hoạt hóa adenylate cyclase.

EPEC bám dính vào niêm mạc ruột gây tổn thương đặc trưng là sự phá hủy vi nhung mao ở riềm bàn chải của niêm mạc ruột. Yếu tố động lực chính của EHEC là độc tố Stx (Shiga toxin) hay độc tố gây độc đối với tế bào Vero VT (veroccytotoxin) vì vậy loại này thuộc nhóm có tên là VTEC – Verocytotoxin E.[Type text] [Type text] [Type text] bằng vận chuyển ion qua màng EHEC/ VTEC DAEC và làm mất thăng bằng vận chuyển ion qua màng Plasmid 60 MDa mã hóa heamolysin. Những trường hợp hoại tử nặng có thể gây thủng ruột. Hậu quả của quá trình này là mức lọc của thận suy giảm. bệnh nhân bị suy thận cấp. Độc tố Shiga: LCT.coli gây bệnh đường ruột EPEC được bắt đầu nghiên cứu rất sớm. ức chế quá trình tổng hợp protein dẫn đến làm chết tế bào. Hậu quả là viêm đại tràng xuất huyết.coli. làm hẹp và tắc mao mạch tiểu cầu thận.coli bám dính phân tán [Type text] Page 11 .gây hội chứng HUS hóa bởi các gen trên nhiễm sắc thể Các yếu tố bám dính Afa/Dr Afa/Dr gây bám dính (AIDA) phân tán EAST-1 EAST-1 phá hủy tế bào biểu mô Các geb set (enterotoxin) Có thể có TTSS với esc Tiêu chảy ra máu (do xuất huyết đại tràng) Tiêu chảy phân thường không có máu EHEC còn được gọi là E. Độc tố Shiga (Stx1.Hủy hoại các vi nhung mao hấp thu cả tế bào biểu mô ruột.  DAEC – E. gây tiêu chảy phân như máu. từ những năm 1940. Stx2. Stx còn có thể gây hội chứng tăng ure huyết tan máu (HUS-haemorrhagic uremic syndrome). dẫn đến làm chết tế bào. PAI nhiễm sắc thể . có ba loại Stx do EHEC sinh ra đã được xác định là Stx1. Độc tố Shiga hủy hoại chọn lọc các vi nhung mao hất thu của tế bào biểu mô ruột. Stx2v) mã . Stx vào máu đến thận gây tổn thương tế bào biểu mô tiểu cầu thân. Hiện nay. Loại vi khuẩn này có vai trò rất quan trọng trong viêm dạ dày ruột gây tiêu chảy ở trẻ em.coli sinh độc tố Shiga. Stx2 và Stx2v. EspP . Các độc tố này được mã hóa bởi các gen prophage thích hợp trên nhiễm sắc thể. Nó cũng xâm nhập vào tế bào biểu mô đại tràng.ức chế quá trình tổng hợp protein của tế bào biểu mô đại tràng.  EPEC – E.

Nhờ Pili này. O7 và O75. vỏ. những vi khuẩn này thường có các gen mã hóa cho các yếu tố độc lực như yếu tố bám dính. UPEC là nguyên nhân chủ yếu của nhiễm trùng đường tiết niệu.coli thì phản ứng sẽ dương tính. 3.coli gây bệnh được trộn dịch nảo tủy.coli này chưa đầy đủ. K2. tới 80% các trường hợp viêm màng não ở trẻ sơ sinh do E. v\các nhóm huyết thanh hay gặp là O1.coli. Ngoài ra nó coàn có một số yếu tố độc lực khác cũng tham gia vào cơ chế gây bệnh. vào đường tiết niệu thì trở nên gây bệnh. Nhiều tác giả cho rằng có sự liên quan chủ yếu đến cơ địa của trẻ.K13 là hay gặp nhất. hiểu biết về sự nhạy cảm của trẻ sơ sinh với loại E. nhất là ở những người có cơ chế đề kháng bị suy giảm. K3. Đối với viêm màng não mủ có thể phát hiện kháng nguyên đặc hiệu của vi khuẩn bằng phản ứng ngưng kết latex. yếu tố độc lực quan trọng của UPEC là P-pili. Có thể làm tiêu bản soi trực tiếp đối với một số loại bệnh phẩm như cặn ly tâm nước tiểu hoặc nước não tủy.[Type text] [Type text] [Type text] DAEC là type gây bệnh được mô tả tương đối gần đây. O4. là một trong các kháng nguyên nhóm máu.coli cơ bản gống với qui trình chuẩn đoán các vi khuẩn đường ruột. O6. vào dịch tủy não. Tuy nhiên đã xác định được những gen độc lực của ExPEC thường gặp trong các nhiễm trùng ngoài đường ruột. các E. MAEC có kháng nguyên vỏ có liên quan về mặt hóa học và miễn dịch với polysaccharide nhóm B của Neisseria meningitides. Khác với E. nước tiểu với nhiễm khuẩn đường tiết niệu. O2.1. K12.coli gây bệnh đường ruột (IPEC). cho kết quả rất nhanh và độ tin cậy rất cao. Dễ làm. Chúng có thể là thành viên của hệ vi khuẩn bình thường ở ruột nhưng khi vào máu. Chẩn đoán trực tiếp Bệnh phẩm khác nhau tùy bệnh: là phân với nhiễm khuẩn đường tiêu hóa. Cho đến nay. Nguyên lý của phản ứng này như sau: các hạt latex có gắn kháng thể kháng E. Đó là phản ứng ngưng kết thụ động. Các chủng có kháng nguyên K1.coli gây bệnh ngoài đường ruột (ExPEC) là những vi khuẩn gây bệnh cơ hội khi “lạc chỗ”. Nó được xác định là một type gây bệnh riêng vì không có các gen độc lực đặc trưng của các type khác đã được mô tả trước.coli có thể gắn đặc hiệu vào kháng nguyên P. Theo kết quả của nhiều nghiên cứu. Chẩn đoán vi sinh vật 3. máu nếu là nhiễm khuẩn máu… Qui trình chuẩn đoán trực tiếp E. E. nếu trong bệnh phẩm có kháng nguyên đặc hiệu của E. các độc tố. K5. [Type text] Page 12 .

Sau khi đã phân lập được vi khuẩn thuần nhất thì xác định tính chất sinh vật hóa học và định tên bằng phản ứng ngưng kết trên phiến kính với các kháng huyết thanh mẫu. Ngoài việc sử dụng kháng sinh.1 Điều trị E. 4. Nguyên tắc điều trị và phòng bệnh 4. giải quyết các cản trở trên đường tiết niệu. Ở nước ta hiện nay chủ yếu mới sử dụng PCR trong định danh khi vi khuẩn đã được phân lập thuần nhất. Để xác định các E.coli. phương pháp đồng ngưng kết. Endo. hiện nay có môi trường uriselect vừa có giá trị cấy đếm.coli sinh độc tố người ta có thể sử dụng nhiều phương pháp khác nhau như phương pháp quai ruột. rút ống thông sớm nếu có thể được. Các kỹ thuật PCR xác định E. điện giải trong trường hơp ỉa chảy (việc này nhiều khi có vai trò quyết định để cứu sống bệnh nhân). Tiến hành cấy máu khi nghi có nhiễm khuẩn máu. trước đây thường sử dụng thạch thường. [Type text] Page 13 .2. vì vậy cần phải làm kháng sinh đồ để chọn kháng sinh thích hợp.coli. một số việc khác rất có giá trị trong điều trị như bồi phụ nước.2.[Type text] [Type text] [Type text] Phương pháp chuẩn đoán chủ yếu nhất là nuôi cấy phân lập. Để đề phòng nhiễm khuẩn đường tiêu hóa do E.coli trực tiếp từ bệnh phẩm đang được nghiên cứu phát triển. Bệnh phẩm phân được nuôi cấy trên môi trường phân lập có chất ức chế chọn lọc như DCL. Chẩn đoán gián tiếp Trên thực tế phương pháp huyết thanh học không được sử dụng để chẩn đoán các nhiễm khuẩn do E.coli. ELISA… Kỹ thuật khuếch đại gen PCR cũng đã được áp dụng trong chẩn đoán E. nhất là các chủng phân lập được từ nước tiểu. thực hiện các biện pháp phòng bệnh chung không đặc hiệu giống như đối với các vi khuẩn đường ruột khác.coli thuộc vào các vi khuẩn có tỷ lệ kháng thuốc cao. Phòng bệnh Hiện nay chưa có phương pháp nào phòng bệnh đặc hiệu. Nước tiểu giữa dòng được tiến hành cấy đếm trên môi trường đặc. phương pháp thử nghiệm trên tế bào nuôi. 4. 3. vừa có khả năng định danh.

1 Nguyên tắc Số lương E. thực hiện nghiêm túc nguyên tắc vô trùng khi phải tiến hành thăm dò hoặc đặt thông đường tiết niệu. Để phòng nhiễm khuẩn đường tiết niệu do E.coli: thực hiện vệ sinh vùng hậu môn và bộ phận sinh dục ngoài. Theo dõi sự sinh hơi và đổi màu để định tính sự hiện diện trong từng ống thử nghiệm.coli là một trong các vi khuẩn gây bệnh cơ hội quan trọng. Phương pháp này dựa vào nguyên tắc mẫu được pha loãng thành một dãy thập phân (hai nồng độ kế tiếp khác nhau 10 lần). Phương pháp truyền thống 1. Ghi nhận số ống nghiệm [Type text] Page 14 .[Type text] [Type text] [Type text] Thực hiện các biện pháp ngăn ngừa nhiễm trùng bệnh viên vì E. Điều trị loại trừ các yếu tố nguy cơ khác.COLI I. Chương II: CÁC PHƯƠNG PHÁP PHÁT HIỆN E. đây là các ống dương tính. thực phẩm chứa mật độ thấp có thể được xác định bằng phương pháp MPN ( Most Probable Number). Định lượng E. Mỗi nồng độ pha loãng được ủ từ 3 đến 5 ống lặp lại.coli trong mẫu nước. 3 hoặc 5 mẫu có độ pha loãng thập phân liên tiếp được ủ trong ống nghiệm chứa môi trường thích hợp có ống bẫy khí Durham.coli bằng phương pháp MPN 1.

Ghi nhận ống có sinh hơi.5 ± 0. ủ ở 44.coli (E. Dùng que cấy vòng cấy chuyển dịch mẫu từ các ống LSB (+) sang các ống có chứa canh BGBL và ủ ở 37 0C ± 10C trong 48 giờ. I.2 Quy trình phân tích Tuần tự cấy 1ml dung dịch mẫu đã pha loãng 10 -1vào 3 ống nghiệm giống nhau. Chọn khuẩn lạc có đường kính lớn hơn 1mm và cấy vào các môi trường MRVP.coli giả định (tròn.coli [Type text] Page 15 .coli giả định cho kết quả thử nghiệm IMViC tuần tự là + + .20C trong 24 giờ. mỗi ống chứa 10ml canh LSB. dẹt hình đĩa và có ánh kim tím). Khuẩn lạc E. nếu nghi ngờ số lượng vi sinh vật trong mẫu quá cao. Môi trường thạch đĩa EMP Môi trường rắn Simmon Citrate Agar (thạch Simmon Citrate) Canh MR-PV Thuốc thử Methyl Read Thuốc thử α-napthol. Dùng que cấy vòng ria dịch mẫu từ các ông (+) trên môi trường canh EC sang môi trường thạch đĩa MBN. Simmon Citrate Agar để thực hiện các thử nghiệm IMViC.. Đếm số lượng các ống cho kết quả (+) (sinh hơi) ở mỗi độ pha loãng. chỉ sử dụng các ống nghiệm không có bọt khí bên trong ống Durham. phải sử dụng các mẫu có bậc pha loãng cao hơn. Môi trường và hóa chất : - Môi trường lỏng Lauryl Sulphate Broth LSB (canh Lauryl Sulphate) Môi trường lỏng Brilliant Green Lactose Bile Salt (canh BGBL) Môi trường lỏng E. Ủ các đĩa này ở 370C trong 24 giờ để tìm khuẩn lạc E. canh EC) - Các môi trường lỏng trên được chuẩn bị trong các ống nghiệm chứa ống Durham úp ngược. Ủ các ống nghiệm ở 37 0C trong 48 giờ. Ống nghiệm cho kết quả trong môi trường EC và khuẩn lạc E.coli medium. Thực hiện tương tự với dịch mẫu đã pha loãng 10-2 và 10-3.chính là E. Đây là trường hợp xác định MPN bằng hệ 3 dãy nồng độ và 3 ống nghiệm lặp lại (hệ 3 x 3 hay 9 ống nghiệm). Ghi nhận số ống cho kết quả (+) (có sinh hơi) ứng với mỗi độ pha loãng.[Type text] [Type text] [Type text] cho phản ứng dương tính ở mỗi nồng độ pha loãng và được vào bảng MPN để suy ra số lượng nhóm vi sinh vật tương ứng hiện diện trong 1g (hoặc 1ml) mẫu ban đầu. Dùng que cấy vòng chuyển một vòng dịch mẫu từ các ống canh LSB (+) sang môi trường canh EC.coli. Sau khi khử trùng.

Môi trường canh MR-VP Broth được phân phối 5ml vào mỗi ống nghiệm.Môi trường thạch Simmon Citrate được chuẩn bị dưới dạng các ống thạch nghiêng có màu xanh lục. . đun chảy và làm nguội ở nhiệt độ 450C trong bể điều nhiệt trước khi sử dụng.3 Cách đọc kết quả Ở tất cả các trường hợp nêu trên. 1.1 Nguyên tắc Mẫu đã được đồng nhất hóa được cấy một lượng nhất định lên môi trường thạch chọn lọc thích hợp chứa lactose. Khẳng định khuẩn lạc đã đếm là E.Môi trường canh Tryptone Soya Agar (TSA) và môi trường Violet Red Bile Agar (VRB) được chuẩn bị vô trùng trong các chai thủy tinh. Định lượng E. để nguội và bảo quản ở 2-80C cho đến khi sử dụng.Môi trường canh Escherichia coli broth (EC Broth) được phân phối 10ml trong mỗi ống nghiệm chứa ống Durham úp ngược. Ghi nhận số lượng các ống nghiệm có E. ủ ở 440C trong 24 giờ. . hấp khử trùng để nguội và kiểm tra không có sự hiện diện của bọt khí trong ống Durham.Thuốc thử Kovac’s. Các ống EC này được bảo quản ở 2 – 80C.[Type text] [Type text] [Type text] giả định trên môi trường EMB cho kết quả thử nghiệm IMViC như trên là ống nghiệm có E.coli (+).coli bằng các thử nghiệm IMViC. dùng bảng MPN thích hợp (bảng 3 x 3 tức 9 ống nghiệm) để tính ra mật độ vi sinh vật trong mẫu và biểu diễn dưới dạng trị số MPN/g hay MPN/ml mẫu ban đầu chưa pha loãng. 2. hấp khử trùng. Thực hiện tương tự cho tất cả các ông nghiệm cho kết quả (+) trong môi trường EC và tạo được khuẩn lạc E. . .coli (+) ở mỗi độ pha loãng của mẫu. đếm các khuẩn lạc có hình dạng đặc trưng của Coliforms. .coli bằng phương pháp đếm khuẩn lạc 2. từ số lượng các ông nghiệm có E. hấp khử trùng. [Type text] Page 16 .coli giả định trên môi trường EMB.coli (+) ở mỗi độ pha loãng của mẫu. .Môi trường canh Lactose Tryptone Lautyl Sulphate Broth (LST Broth) được chuẩn bị tương tự môi trường canh EC. 2.2 Môi trường và hóa chất .Môi trường canh Tryptone Broth được phân phối 5ml vào mỗi ống nghiệm.

Tiếp tục thực hiện để được các độ pha loãng thập phân tiếp theo sao cho chứa <100 tế bào E.3 Quy trình phân tích [Type text] [Type text] Mẫu được đồng nhất hóa bằng cách đối với mẫu rắn xay nhuyễn mẫu trong điều kiện vô trùng rồi cân chính xác 10g (hoặc 25g). Voges Proskauer.coli (+) ( IMViC là + + .[Type text] 2. đường kính ≥ 0. Để nhiệt độ phòng trong 1 – 2 giờ để hồi phục các tế bào bị tổng thương. Thực hiện tương tự trên mẫu ở 2 nồng độ pha loãng liên tiếp sao cho mỗi đĩa xuất hiện từ 10 – 100 khuẩn lạc và lặp lại ít nhất 2 đĩa ứng với mỗi nồng độ pha loãng. Dịch mẫu đồng nhất được tiếp tục pha loãng theo dãy thập phân bằng cách chuyển 1ml dịch mẫu vào ống nghiệm chứa 9ml dung dịch pha loãng. Bổ sung vào mỗi đĩa 10 – 15ml môi trường thạch VRB ở nhiệt độ 450C trên môi trường TSA. thạch Simmon Citrate. dung dịch mẫu thu được có độ pha loãng là 10-1 so với ban đầu. Lắc tròn đĩa petri xuôi và ngược kim đồng hồ. Citrate. mỗi chiều 3 – 5 lần để trộn dịch mẫu với môi trường. Chọn 5 khuẩn lạc nghi ngờ (khuẩn lạc màu đỏ đến đỏ đậm.50C trong 24 giờ Thử nghiệm Indol. ủ ở 44 ± 0. canh MR-VP. 2. bổ sung vào trong bình tam giác chứa 90ml (hay 225ml) nước SPW đã được hấp khử trùng.-). Ủ các môi trường trên ở 44 ± 0. tính mật độ của E. Methyl Read. Chuyển 1ml dịch pha loãng mẫu đã chọn vào đĩa petri.4 Cách tính kết quả Dựa vào số khuẩn lạc đếm được và tỷ lệ khẳng định.5 mm). Chờ cho môi trường trong đĩa đông đặc. Ghi nhận khuẩn lạc cho thử nghiệm khẳng định E. có vòng tủa muối mật. lật ngược đĩa và ủ ở 37 ± 10C trong 24 – 48 giờ.coli theo công thức sau: A (CFU/mg hay CFU/ml) [Type text] =xR Page 17 . Dung dịch này có độ pha loãng 10-2. dung que cấy vòng chuyền sang môi trường canh EC. Lắc đều trong một thời gian nhất định (ít nhất là 2 phút đối với mẫu rắn).50C trong 24 giờ.coli trong 1ml dung dịch pha loãng. đối với mẫu lỏng hút 10ml (hoặc 25ml). Bổ sung vào mỗi đĩa đã cấy mẫu khoảng 5ml môi trường TSA đã được đun chảy và ổn định trong bể điều nhiệt 450C. Chọn các ống cho kết quả (+) (sinh hơi) và dung que cấy vòng chuyền sang các môi trường sau: canh Tryptone. sau đó tiếp tục chuyển 1ml dịch mẫu này vào ống nghiệm thứ hai chứa 9ml dung dịch pha loăng ta sẽ thu được dịch mẫu có độ pha loãng 10-3. Sau khi được làm đồng nhất bằng cách trên.

[Type text] [Type text] [Type text] N: tổng số khuẩn lạc đếm được ni: số đĩa có số khuẩn lạc được chọn tại mỗi độ pha loãng V: dung tích mẫu (ml) cấy vào mỗi đĩa fi: độ pha loãng có số khuẩn lạc được chọn tại các đĩa đếm R: tỷ lệ khẳng định 3.3 Môi trường và thuốc thử 1. Máy pha trộn 4. 3.50C 2. đĩa Petri 3. Phương pháp làm giàu vi khuẩn 3. Canh thang LST (Lauryl sulphate tryptose broth) (mt28) 6. mt 98) 5. Canh thang nitrate (Nitrate broth) (mt 19) [Type text] Page 18 . Tủ ấm 350C 3. Ống nghiệm.2 Thiết bị và đồ thủy tinh 1. Thạch MacConkey (mt 80) 7. Canh thang EE (Enteric enrichement broth) (mt 14) 4. Thạch L-EMB (Levine’s methylene blue agar) (mt 76) 3. pipet.1 Nguyên lý Phương pháp này dựa vào làm giàu vi khuẩn trước trong canh thang dinh dưỡng và MacConkey. Canh thang MacConkey (mt 17) 8. Những khuẩn lạc khả nghi được kiểm tra về đặc tính sinh hóa và huyết thanh của EEC. Chậu nước 440C và 41. Môi trường lên men (carbohydrate fermentation medium) (mt 46) 2. Môi trường indole và thuốc thử (mt 44. rồi làm giàu trong canh thang LST và EE sau đó ria lên thạch L-EMB.

Canh thang KCN (Potassium cyanide broth) (mt 3) 11.[Type text] [Type text] [Type text] 9. Ủ ấm ở 350C trong 24h. Ria thẳng Ria từ canh thang dinh dưỡng đồng nhất lên thạch L-EMB. thạch MacConkey. Xét nghiệm sơ bộ về huyết thanh : Trung hòa canh thang LST và EE với 10% NaHCO3. Thạch TSI (Triple sugar iron agar) (mt 86) 12.50C trong 18h. chuyển một quai cấy sang 30ml canh thang LST. Canh thang urê (các thành phần là thạch urê nhưng không có agar) (mt 93) 13. Môi trường V. Trộn các giọt trên và xem ngưng kết. Ủ ấm 350C trong 24h. nhỏ một giọt canh thang của mỗi thứ lên trên phiến kính sạch và cho thêm một giọt huyết thanh đa giá OB và một giọt nước muối 0. Ủ ấm canh thang dinh dưỡng 350C trong 6h. 3. Kháng huyết thanh E. 5. 4. Chuyển một quai cấy sang 30ml canh thang EE. Xác nhận tính chất sinh vật hóa học : Ria từ canh thang LST dương tính lên thạch L-EMB và EE dương tính lên thạch MacConkey và thạch L-EMB. Ủ ấm 41. Ủ ấm 440C trong 20h.P (Voges Proskauer medium) (mt 54) 14.Coli 3. Canh thang dinh dưỡng (Nutrient broth) (mt 6) 10. Chuẩn bị mẫu: Cân 25g mẫu bằng thao tác vô khuẩn rồi cho vào 225ml canh thang MacConkey và 225ml canh thang dinh dưỡng trong blender vô khuẩn và làm đồng nhất trong 30 giây (1:10) 2. Làm giàu vi khuẩn : ủ ấm canh thang MacConkey ở 350C trong 20h .4 Cách làm 1.5%. [Type text] Page 19 .

1 Chọn những khuẩn lạc điển hình và cấy vào môi trường TSI. EMB cũng là một phương tiện khác biệt .Coli TSI (H2S) V. Yếu hơn quá trình lên men kết quả lactose trong môi trường với một màu hơi hồng tím . KCN. VP. có chứa thuốc nhuộm eosin và xanh methylene.coli kết quả trong một ánh xanh kim loại. Đặc tính sinh vật hóa học của E. Indole Urease KCN Adonitol Cytochrome oxidase + + + acid 5. gây ra một sự thay đổi màu sắc trên môi trường. Lactose men chuyển hóa đường lactose trong các phương tiện truyền thông và sản xuất các sản phẩm phụ axit. urease. hoặc ít nhất không đậm hơn so với màu sắc của các phương tiện truyền thông [Type text] Page 20 .2 Nhận diện huyết thanh E. Vì vậy.[Type text] [Type text] [Type text] 5. Đồng thời cấy lên mặt thạch nghiêng PCA cùng một khuẩn lạc dùng để kiểm tra huyết thanh. Sản xuất axit mạnh mẽ bởi các sinh vật như E. EMB agar chọn lọc bởi vì thuốc nhuộm anilin trong phương tiện truyền thông tím ức chế sự phát triển của sinh vật Gram dương.Coli gây bệnh đường ruột - Thạch EMB Thạch Eosin methylene thạch màu xanh. indole. Thuộc địa của men nonlactose vẫn không màu. citrate và adonitol.P.

coli cho kết quả dương tính Ống 2: E.coli (+) [Type text] (1) (2) Hình 2.coli (-) .3: Thử nghiệm Indole Ống 1: E.[Type text] [Type text] [Type text] Hình 2.coli Page 21 (B) (A) (A) Cho kết quả (-) (B) Cho kết quả (+) . (2): E.1: Khuẩn lạc E.coli cho kết quả âm tính Hình 2.coli trên môi trường thạch EMB (a) (b) (1) (2) ư Hình 2.5: Thử nghiệm Cytochrome oxidase với vi khuẩn E.4: Thử nghiệm Urease (1): E.

coli (+).7: Thử nghiệm MR (a): E.coli (-) Hình 2. (b): E.coli (+).[Type text] [Type text] [Type text] (a) (b) Hình 2.6: Thử nghiệm VP (a): E.coli (-) [Type text] Page 22 . (b): E.

Phương pháp hiện đại 1.8. 1.coli (a): E. Phương pháp PCR (polymerase Chain Reaction) 1.0125mg/l) và vancomycin (8mg/l) để ức chế các vi khuẩn Gram dương và vi khuẩn sống hoại sinh khác. đặc biệt là E.2 Môi trường tăng sinh Do số lượng E. : Thử nghiệm Citrate với vi khuẩn E.coli nhóm STEC. cho nên trước khi phân lập cần sử dụng môi trường tăng sinh pepton đệm có bổ sung kháng sinh cefiximw (0.coli (+) (b): E.coli gây bệnh hiện diện trong thực phẩm rất ít.1 Nguyên tắc Phương pháp PCR (Polymerase Chain Reaction) là một phương pháp invitro để tổng hợp DNA dựa trên khuôn là một trình tự đích DNA ban đầu khuếch đại.3 Môi trường phân lập [Type text] Page 23 .coli (-) II.[Type text] [Type text] [Type text] Hình2. nhân số lượng bản sao của khuôn này thành hàng triệu bản sao nhờ hoạt động của enzyme polymerase và một cặp mồi (primer) đặc hiệu cho đoạn DNA này. 1.

cefixime) (370C/24 giờ) CT-SMAC (370C/24 giờ) [Type text] Page 24 . Làm thử nghiệm sinh hóa IMViC cho từng khuẩn lac riêng lẻ thuộc nhóm đó để xác định E. lấy ra và chuyển vào tủ âm -700C giữ trong 10 phút.4 Trích ly DNA Việc trích ly DNA được thực hiện như sau: thu khoảng 6-10 khhuẩn lạc E.coli điển hình có khuẩn lạc màu đỏ. Mẫu MAC (370C/24 giờ) SMAC (370C/24 giờ) Pepton (vancomycin.5mg/l).[Type text] [Type text] [Type text] Môi trường phân lập là môi trường MacConkey (MAC). Sorbitol MacConkey (SMAC). hoặc CT-SMAC) cho vào eppendorf đựng sẵn 0. đun sôi 10 phút. Sorbitol MacConkey (CT-SMAC) có bổ sung kháng sinh cefixime (0.coli lên men sorbitol cho khuẩn lạc màu hồng. ly tâm 13000 vòng trong 3 phút.5 ml nước cất hai lần vô trùng.4-0.coli không lên men đường sorbitol nên cho khuẩn lạc màu trắng. Trên từng loại môi trường MAC.coli. E. E.05mg/l) và tellurite (2. những dòng E. cấy từng khuẩn lạc được chọn vào từng ống thạch nghiêng NA. 1. Để yên và hút phần dung dịch ở phía trên làm DNA khuôn mẫu (DNA xét nghiệm). SMAC. Sau khi rã đông hoàn toàn. CT-SMAC chọn ngẫu nhiên 6-10 khuẩn lạc rời rạc đại diện cho mỗi nhóm hình thái. Khoảng 90% E.coli đều lên men đường lactose. trên môi trường MAC. trên môi trường SMAC và CT-SMAC.coli trên môi trường thạch (MAC hoặc SMAC.

5 ml H2O cất khử ion 2 lần Thử IMViC (+ + .-) Ly trích DNA (DNA nhóm khuẩn lạc) (-) Multiplex-PCR (+) Ly trích DNA riêng theo từng ống NA Loại bỏ ống NA đã giữ Multiplex-PCR Sơ đồ 1: Qui trình phân lập.4-0. định tính và phát hiện gen độc lực E.[Type text] [Type text] [Type text] Chọn 6-10 khuẩn lạc đỏ hồng Chọn 6-10 khuẩn lạc theo từng nhóm riêng: trắng hoặc đỏ hoặc cả hai Cấy từng khuẩn lạc được chọn vào từng ống thạch nghiêng NA (370C/24 giờ) Thu tất cả phần còn lại của những khuẩn lạc đã chọn theo từng nhóm riêng và mỗi nhóm cho vào eppendorf chứa sẵn 0. coli [Type text] Page 25 .

3.Ủ bắt cặp 610C/1 phút [Type text] Page 26 .1 Trình tự các đoạn mồi sử dụng trong Multiplex-PCR Mồi (primer) Eae-F Eae-R EhxA-F EhxA-R Stx1-F Stx1-R Stx2-F Stx2-R Uid-F Uid-R Trình tự oligonucleotide (5’3’) ATTACCATCCACACAGACGGT ACAGCGTGGTTGGATCAACCT GTTTATTCTGGGGCAGGCTC CTTCACGTCACCATACATAT CAGTTAATGTGGTGGCGAAGG CACCAGACAATGTAACCGCTG ATCCTATTCCCGGGAGTTTACG GCGTCATCGTATACACAGGAGC GCGAAAACTGTGGAATTGGG TGATGCTCCATCACTTCCTG Kích cỡ DNA được khuếch đại (bp) 397 158 348 584 252 1.5 Qui trình multiplex-PCR 1. Taq 2.5 µl. mỗi loại primer 7.5 pmol.Tiền biến tính 950C/5 phút . MgCl2 3mM. gồm các thành phần sau : PCR buffer 1. DNA 2µl. 1.5.5. Các thành phần của phản ứng PCR: Mỗi phản ứng là 25µl. Chu kỳ nhiệt .1 X.5.2. mỗi dNTP 200µM.Biến tính 940C/1 phút .[Type text] [Type text] [Type text] 1. và nước cất vừa đủ 25µl.

.  Nhược điểm: . .Sự ức chế Taq DNA polymerase bởi thành phần của mẫu vật do mẫu thực phẩm thường có những thành phần phức tạp.kéo dài chuỗi 720C/7 phút [Type text] [Type text] .[Type text] . do vậy có thể dẫn đến trường hợp dương tính giả do DNA từ tế bào chết.Điện di.Ít tốn kém về mặt nhân sự. Tuy nhiên.6% trong TBE. Các sản phẩm PCR được xác định bằng cách so với các băng băng của đối chứng dương và thang ledder 100bp.6. việc chiết tách và tinh chế DNA từ thực phẩm hay môi trường khi thực hiện phương pháp PCR thường cho phép loại bỏ những hợp chất ức chế. Sau đó rửa sạch bằng nước và chụp hình gel với tia UV bằng máy chụp gel. nên trong đa số trường hợp cần có bước nuôi cấy làm giàu để có được mật độ đủ để phát hiện bằng PCR. thời gian điện di 30-35 phút ở 90V và 250 mA.Có thể phát hiện được nhưng vi sinh vật khó nuôi cấy. có thể thực hiện ở hiện trường. Ưu điểm và nhược điểm của phương pháp PCR  Ưu điểm: . không cần dụng cụ và môi trường chẩn đoán phức tạp.Hóa chất cần cho phản ứng PCR dễ tìm và dễ tồn trữ hơn so với trường hợp huyết thanh học.Phương pháp này không phân biệt được tế báo sống với tế bào chết. .Thời gian cho kết quả nhanh .Mật độ vi sinh vật gây bệnh hiện diện trong mẫu thực phẩm thường thấp. ngược lại phương pháp [Type text] Page 27 . đọc kết quả Lấy 10µl sản phẩm PCR cùng với 2µl loading dye được điện di trên gel agarrose 1. 1. gel được ngâm trong dung dịch ethidium bromide khoảng 30 phút. việc tăng sinh là đơi giản hơn và đôi khi không cần thiết .Kéo dài 720C/1 phút . có thể tự động hóa để làm giảm chi phí phát hiện các vi sinh vật gây bệnh trong thực phẩm. Sau khi điện di. Thang chuẩn (ladder) cũng được điện di đồng thời.

9: Đĩa giếng (microplate) Elisa đã được sử dụng rộng rãi dưới dạng các bộ hóa chất (kit). một số lipit và poli saccarit. 2. Một sử dụng rất phổ biến trong các khảo nghiệm miễn dịch liên kết enzyme ( ELISA).2. K (Kháng nguyên bề mặt) và H (kháng nguyên lông). Kháng thể ( Antibody ) là protein ‫ ﻹ‬globulin được sinh ra bởi tế bào lympo tham gia phản ứng miễn dịch đặc hiệu với kháng nguyên Đĩa giếng ( microplate) là một tấm phẳng với nhiều "giếng" được sử dụng như ống nghiệm nhỏ. Kháng nguyên bao gồm protein lạ. các cơ sở xét nghiệm chẩn đoán y tế hiện đại nhất ở người và động vật. Microplate đã trở thành một công cụ tiêu chuẩn trong nghiên cứu phân tích và phòng thí nghiệm thử nghiệm lâm sàng chẩn đoán. kháng nguyên này sẽ được giữ lại trên bề mặt giếng. Bằng cách theo dõi sự đổi màu. Cấu trúc kháng nguyên:  E. Nếu có sự hiện diện của kháng nguyên mục tiêu trong mẫu. Kháng nguyên (Antigen) là những chất có khả năng huy động hệ miễn dịch tiết ra kháng thể đặc hiệu với chúng gây ra phản ứng miễn dịch đặc hiệu. Kỹ thuật này có độ nhạy phát hiện khoảng 106CFU/ml(một số báo cáo cho rằng giới hạn này có thể đạt được 104) II. có thể phát hiện sự hiện diện và định lượng kháng nguyên. dạng tiềm sinh hay tế bào đã chết của các vi sinh vật gây bệnh hoặc gây ngộ độc. Khi bổ sung một cơ chất đặc hiệu enzyme vào giếng.1 Nguyên tắc [Type text] Page 28 . Hình2. enzyme sẽ xúc tác phản ứng thủy phân cơ chất để tạo ra các phản ứng có màu hay phát sáng.2 Các phương pháp Elisa : 2.1 Nguyên tắc Sử dụng kháng thể đơn dòng phủ bên ngoài những đĩa giếng (microplate). Elisa có thể sử dụng phát hiện và định lượng vi sinh trong thực phẩm trong thời gian vài giờ sau khi tăng sinh. Phương pháp ELISA 2. Các kháng nguyên này sẽ được phát hiện bằng cách sử dụng kháng thể thứ cấp có gắn với enzyme như horseradish peroxidase hay alkaline phosphate.coli có 3 cấu trúc kháng nguyên với tên gọi là O ( kháng nguyên thân). axit nucleic.[Type text] [Type text] [Type text] này cho phép phát hiện bào tử.

Chuyển KN đã biết lên bề mặt cứng ( được gọi chung là các đĩa). kháng nguyên này sẽ được giữ lại trên bề mặt giếng. 2. enzyme sẽ xúc tác phản ứng thủy phân cơ chất để tạo ra các phản ứng có màu hay phát sáng. .2.ﻹ‬globulin được sinh ra bởi tế lympo tham gia phản ứng miễn dịch đặc hiệu với kháng nguyên Elisa đã được sử dụng rộng rãi dưới dạng các bộ hóa chất (kit). Kháng nguyên ( Antigen ) là những chất có khả năng huy động hệ miễn dịch tiết ra kháng thể đặc hiệu với chúng gây ra phản ứng miễn dịch đặc hiệu.Thêm dung dịch protein không tương tác (non-interacting protein) như albumin huyết thanh bê (bovine serum albumin) hay casein vào tất cả các mẫu (kể cả mẫu chuẩn).Chuyển các mẫu KN chưa biết vào các giếng khác. Kháng thể ( Antibody ) là protein ‫ . KN sẽ được cố định trên bề mặt.2 Các phương pháp Elisa : 2. Kháng nguyên bao gốm protein lạ.Rửa bề mặt đĩa sau đó chuyển kháng thể (biết trước) vào tất cả các giếng của đĩa. KN chưa biết được hòa tan trong cùng một loại dung dịch đệm giống các mẫu KN chuẩn. Bước này được gọi là "blockin" do protein huyết thanh có tác dụng ngăn cản sự hấp phụ của các protein khác lên bề mặt của đĩa. . Các kháng nguyên này sẽ được phát hiện bằng cách sử dụng kháng thể thứ cấp có gắn với enzyme như horseradish peroxidase hay alkaline phosphate.coli có 3 cấu trúc kháng nguyên với tên gọi là O ( kháng nguyên thân).2. . KT thứ cấp sẽ kết hợp với bất kỳ một KT còn dư (bước này có thể được bỏ qua nếu kháng thể dùng để phát hiện KN đã gắn với enzyme). ELISA gián tiếp (indirect ELISA) gồm các bước chính: . có thể phát hiện sự hiện diện và định lượng kháng nguyên. [Type text] Page 29 . một số lipit và poli saccarit. K (Kháng nguyên bề mặt) và H (kháng nguyên lông). . KT sẽ kết hợp với các KN đã được cố định mà không kết hợp với protein của huyết thanh. Nếu có sự hiện diện của kháng nguyên mục tiêu trong mẫu. Cấu trúc kháng nguyên:  E.2. axit nucleic.1. Khi bổ sung một cơ chất đặc hiệu enzyme vào giếng. Kỹ thuật này có độ nhạy phát hiện khoảng 106CFU/ml(một số báo cáo cho rằng giới hạn này có thể đạt được 104).Thêm KT thứ cấp (secondary antibody).[Type text] [Type text] [Type text] Sử dụng kháng thể đơn dòng phủ bên ngoài những đĩa giếng (microplate). Nồng độ của các mẫu kháng nguyên này dùng để thiết lập đường chuẩn cho việc tính nồng độ của kháng nguyên trong các mẫu chưa biết. Bằng cách theo dõi sự đổi màu. Elisa có thể sử dụng phát hiện và định lượng vi sinh trong thực phẩm trong thời gian vài giờ sau khi tăng sinh.

KN (nếu có) sẽ gắn với KT.10: Các bước tiến hành trong Sanwich ELISA Các bước trong Sandwich ELISA. (3) kháng thể dùng để phát hiện được thêm vào và kết hợp với KN. phần không gắn kết sẽ bị rửa trôi.[Type text] [Type text] [Type text] .2 Sandwich ELISA: Phương pháp được sử dụng để phát hiện KN trong mẫu nghiên cứu và bao gồm các bước cơ bản sau (quy trình có thể được thay đổi trong nhiều trường hợp): (1) Chuẩn bị bề mặt (microtiter) có gắn KT (2) Khóa tất cả những vị trí gắn kết không đặc hiệu trên bề mặt. (4) Thêm KT thứ cấp liên kết với enzyme. KT thứ cấp sẽ gắn với [Type text] Page 30 . Nhược điểm cơ bản: Bước cố định KN không có tính đặc hiệu nên bất kỳ protein nào cũng gắn với bề mặt đĩa vì vậy KN (có nồng độ thấp) phải cạnh tranh với các protein khác trong huyết thanh khi gắn kết với bề mặt của điwax.Thêm cơ chất. .. Enzyme sẽ làm biến đổi cơ chất làm sản sinh tín hiệu huỳnh quang hay tín hiệu điện hóa học (enzyme có tác dụng như yếu tố khuyếch đại). phát quang hay tín hiệu hóa điện. Enzym sẽ biến đổi cơ chất tạo màu.Rửa đĩa.2. (9) Đo cường độ ánh sáng. (3) Phủ mẫu chứa kháng KN cần xác định (4) Rửa đĩa. các kháng thể gắn enzyme còn dư sẽ được loại bỏ.2. Sandwich ELISA hạn chế được nhược điểm này. qua đó xác định sự có mặt và hàm lượng KT.. 2. kháng KN không được gắn kết sẽ bị rửa trôi (5) Thêm các KT đặc hiệu cho KN cần chẩn đoán (6) Thêm KT thứ cấp đã được gắn với enzym (KT thứ cấp đặc hiệu cho KT sơ cấp ở bước 5) (7) Rửa đĩa. tín hiệu huỳng quang. tín hiệu điện hóa. Hình 2. (8) Thêm cơ chất. (1) Phủ đĩa bằng KT (2) Thêm mẫu cần xác định KN.

Lượng KN càng lớn.Microplate . bub ∆ = trate (chất tạo màu phản ứng.Máy đọc phản ứng. thường là TMBZ (3. Enzym sẽ làm biến đổi cơ chất và phát tín hiệu có thể phát hiện và đo được. KT không được gắn kết sẽ bị rửa trôi.3.Kháng nguyên chuẩn.3’ 5.1. Phủ đĩa bằng 200µl dung dịch sữa tách bơ 5% mỗi giếng. hàm lượng KN gốc càng cao. Phát hiện E.05% rửa đĩa 3 lần.5’ tetramethybenzodine)). (5) Thêm cơ chất.PBS-Tween. Phủ kháng nguyên 100µl kháng nguyên pha loãng ở nồng độ thích hợp được gắn trưc tiếp vào đĩa microplate.2. 0. PBS. Nguyên liệu: . tín hiệu sản sinh càng yếu. Đổ bỏ dung dịch có trong microplate. . Trong phương pháp này. ELISA cạnh tranh: (1) "Ủ" KT không được đánh dấu với KN.[Type text] [Type text] [Type text] KT dùng để phát hiện.coli O157:H7 bằng phương pháp Elisa: 2. Phản ứng Elisa gián tiếp: a. KT thứ cấp gắn với enzym. 2. (3) Rửa đĩa. 2. Trình tự phản ứng: . . Sữa tách bơ(casein). (2) Đưa hỗn hợp này vào các giếng của vi phiếm có chứa KN.3. Lượng enzym còn dư sẽ giải phóng tín hiệu hỳnh quang hay tín hiệu màu. huyết thanh thỏ. ủ ở nhiệt độ phòng trong 2 giờ hoặc lắc ở 37oC sau 1 giờ. Rồi dùng dung dịch PBS( Phosphate Buffer Saline) có chứa Tween 20. lượng KT gắn thành công với KN trong đĩa càng thấp do "cạnh tranh".2. Đổ bỏ dung dịch có trong microplate. enzym được gắn với KN chứ không phải KT.conjugate (chất gắn kết) có gắn enzym peroxidase. Rồi [Type text] Page 31 . b. và đập khô. Thời gian ủ kháng nguyên thường là qua đêm ở nhiệt độ 4oC hoặc 37oC trong 2h.3. (4) Thêm KT thứ cấp (KT của KT ở bước 1). (5) Thêm cơ chất.Bước 1.Bước 2. Một số trường hợp.

Bước 3. o Kháng thể đơn dòng đặc hiệu MAB 46E9-9 nhận biết đặc hiệu kháng nguyên lông H7 của loài E. [Type text] Page 32 . .coli O157:H7 o E.coli O157:H7. Dừng phản ứng bằng dung dịch H2SO4 1M. nhỏ mỗi giếng và ủ ở 37oC trong 30 phút. Rồi dùng dung dịch PBS( Phosphate Buffer Saline) cò chứa Tween 20. . phản ứng sẽ chuyển sang màu xanh lục nếu là dương tính.4 Ứng dụng của kháng thể đơn dòng trong xác định E.5 Ưu điểm của phương pháp Elisa Ưu điểm: .Thời gian xét nghiệm lâu. và đập khô. Nhược điểm: .Kháng thể đơn dòng có thể chi phí nhiều hơn so với các kháng thể đa dòng. lúc này phàn ứng có màu vàng. và đập khô. 0.Bước 6. Cơ chất tạo màu : 100µl TMB vào mỗi giếng. Vì vậy. . lắc sau 30 phút. .05% rửa đĩa 3 lần. Kháng thể đặc hiệu loài : 100µl conjugate pha loãng bằng PBS với độ pha loãng là 10.coli O157:H7 có hai loại kháng ngyên có ý nghĩa trong chuẩn đoán là 0 kháng nguyên O157 và H7.Chỉ có các kháng thể đơn dòng có thể được sử dụng như cặp phù hợp. 2.[Type text] [Type text] [Type text] dùng dung dịch PBS( Phosphate Buffer Saline) cò chứa Tween 20. 0.Kháng nguyên thu hoạch như trên.coli . để nhiệt độ phòng 15 phút. Đổ bỏ dung dịch có trong microplate.Kháng nguyên của nồng độ rất thấp hoặc không biết có thể được phát hiện kể từ khi bắt giữ kháng thể chỉ lấy kháng nguyên cụ thể . kháng thể đơn dòng đặc hiệu với các epitop của hai loại kháng nguyên này thường sử dụng để xác định vi khuẩn trong các hệ thống chuẩn đoán huyết thanh. Gắn kháng thể : 100µl huyết thanh pha loãng ở nồng độ thích hợp bằng dung dịch PBS-sữa tách bơ 5%.Bước 4.Nhanh chóng và thuận tiện .05% rửa đĩa 3 lần. đươc đo nồng độ protein và giữa ở nhiệt độ -20 C. Đổ bỏ dung dịch có trong microplate. Kháng thể ủ trong đĩa ở nhiệt độ 37 oC. 2.05% rửa đĩa 5 lần. o Kháng thể MAB 13C4 nhận biết theo hướng nhận biết kháng nguyên độc tố Stx1 của E.Bước 5. Đọc đĩa trên máy đọc đĩa ELISA ở bước sóng 450 nm.000 lần. . và đập khô. . . . 0. Rồi dùng dung dịch PBS( Phosphate Buffer Saline) cò chứa Tween 20.

Phát hiện E.coli O157:H7 trong thực phẩm mang tính pháp lý ở Việt Nam là sử dụng kỹ thuật làm giầu. Người ta đã sử dụng nhiều phương pháp khác nhau để phát hiện chúng như: đếm tế bào dưới kính hiển vi. gắn kết trực tiếp thông qua các nhóm carbon-hydrate bị oxy hóa trên phần Fc của kháng thể. càng nhiều cầu nối trung gian giữa kháng thể và hạt nano chứa tâm màu phát quang càng làm cho phức hợp bền vững hơn và kháng thể không mất hoạt tính lâu hơn. hiện nay có 5 cách để tạo ra phức hợp này là: gắn kết trực tiếp thông qua liên kết amine–carboxylic. tất cả các phương pháp nêu trên đều không thể phát hiện chính xác số lượng vi khuẩn ở nồng độ thấp. người ta đã và đang ứng dụng các loại vật liệu nano phát quang như hạt silica chứa tâm màu hay chấm lượng tử QD chứa các nhóm chức năng sinh học trên bề mặt như một chất đánh dấu huỳnh quang để phát hiện nhanh và chính xác số lượng vi khuẩn gây bệnh thực phẩm bằng kỹ thuật miễn dịch huỳnh quang. đếm khuẩn lạc trên đĩa thạch. Từ những khuẩn lạc nghi ngờ. Cường độ phát huỳnh quang là hàm số f của số lượng tế bào vi khuẩn đích trong mẫu. các nhà khoa học đã chế tạo thành công công thức phức hợp kháng thể đặc hiệu vi khuẩn đích + hạt nano silica băng cách găn trực tiếp các phân tử kháng thể lên bề mặt hạt silica thông qua liên kết amine-carbonxylic với sự có mặt của chất xúc tác EDAC (1-Ethyl-3-(3-dimethylaminopropyl carbodiimide hydrochloride) [Type text] Page 33 . Ở Việt Nam. Mỗi kiểu gắn kết có những ưu điểm và hạn chế riêng. Phương pháp phát hiện E. đầu dò enzym. gắn kết không hóa trị của hạt nano silica được bọc streptavidin với các kháng thể được biotin hóa biotinylated. Phức hợp hạt nano silica + kháng thể đặc hiệu có thể được tạo ra bởi nhiều cơ chế khác nhau. tiến hành kỹ thuật miễn dịch huỳnh quang để phát hiện và xác định số lượng vi khuẩn đích. xác định khuẩn lạc nghi ngờ E. Sau khi tạo được phức hợp kháng thể đặc hiệu + hạt nano silica. tiến hành kiểm tra các tính chất sinh hóa và ngưng kết đặc hiệu để khẳng định là E. Để khắc phục nhược điểm nêu trên. kít chuẩn PCR.coli O157:H7. gắn kết các peptide được gắn histidine hoặc các kháng thể lên các chấm lượng tử được Ni-NIA hóa. miễn dịch học bằng enzym.[Type text] [Type text] [Type text] - Enzyme / chất nền phản ứng trong microwells phải được đọc càng sớm càng tốt 3. sử dụng SMCC làm xúc tác tạo cặp sulfhydryl-amine. Nhưng nhìn chung. ELISA. Tuy nhiên. xác định số lượng vi khuẩn (VK) đích bằng đường chuẩn giữa cường độ phát quang của VK gắn hạt nano và số lượng VK trong dung dịch chuẩn. E. Khâu cốt lõi của kỹ thuật sử dụng hạt nano silica chứa tâm màu là việc chế tạo ra được phức hợp giữa kháng thể đặc hiệu vi khuẩn đích với hạt silica phát quang bền vững. Có nhiều cách phát hiện vi khuẩn đích như: quan sát và đếm trực tiếp các tế bào vi khuẩn phát quang dưới kính hiển vi huỳnh quang.coli bằng phức hợp kháng thể + hạt nano silica phát quang Trong số các loại vi khuẩn gây ngộ độc thực phẩm.coli O157:H7 trên đĩa thạch SMAC sau khi ủ ấm ở 37oC trong 24 giờ.coli O157:H7 được xem là rất nguy hiểm với liều gây độc thấp (10-100 tế bào).

Silica. coli O157:H7 trong vòng 20 phút. Ảnh 1: TEM E. 1.coli O157:H7 được đánh dấu bởi phức hợp kháng thể + hạt nano silica đã chứng minh rằng phức hợp này có thể bao bọc đều hoàn toàn và như nhau lên bề mặt tế bào vi khuẩn.9mg. 2. coli O157:H7 được bao bọc bởi phức hợp kháng thể + hạt silica Hình ảnh SEM (kính hiển vi quét) và kính hiển vi đồng tiêu của tế bào E. (c) VK gắn với phức hợp kháng thể .[Type text] [Type text] [Type text] trong các điều kiện sau: EDAC/1 phản ứng là 0.QDs [Type text] Page 34 . tỉ lệ vi khuẩn đích gắn phức hợp và phát quang đạt > 60% và sau 3 ngày vẫn phức hợp vẫn giữ nguyên hoạt tính. Qua đó có thể khẳng định các hạt nano silica hợp sinh với kháng thể vẫn giữ nguyên tính chất phát quang hiệu quả và các phân tử kháng thể khi gắn với hạt nano silica vẫn giữ được hoạt tính và có khả năng nhận biết và liên kết với vi khuẩn đích Ảnh huỳnh quang: (a) phức hợp hạt nano silica – kháng thể. coli O157:H7 được bao bọc bởi phức hợp kháng thể + hạt silica Ảnh 2: SEM E. nhiệt độ ủ ở 300C. thơi gian phản ứng hợp sinh 3 giờ có lắc ngang . tỉ lệ kháng thể với hạt silica là 40/1. (b) VK gắn với phức hợp kháng thể . Phức hợp kháng thể và hạt silica được tạo thành này có khả năng nhận biết và liên kết đặc hiệu với vi khuẩn đích E. thời gian phát hiện nhanh hơn các phương pháp thông thường nhiều lần. Giới hạn phát hiện của kỹ thuật này đối vối vi khuẩn đích là 102 CFU/ml.

Viền màu đỏ bao bọc xung quanh tế bào vi khuẩn là phức hợp hạt silica + kháng thể đặc hiệu [Type text] Page 35 . coli O157:H7: chụp bằng kính hiển vi đồng tiêu Nikon C1plus – Ti-E. Đây là cơ sở để xây dựng đường chuẩn: cường độ phổ .số lượng E.coli O157:H7 để phát hiện nhanh. nhậy số lượng vi khuẩn này ở mật độ thấp Ảnh huỳnh quang phức hợp Silica – E. coli O157:H7.[Type text] [Type text] [Type text] Phổ huỳnh quang của phức hợp hạt silica – kháng thể gắn kết với vi khuẩn E.

[Type text] [Type text] [Type text] KẾT LUẬN Hiện nay. Do đó các phương pháp phát hiện vi khuẩn E.coli. Ngộ độc thực phẩm thường xảy ra do nguyên liệu dùng chế biến hay thực phẩm bị nhiễm vi khuẩn và độc tố của vi khuẩn.coli có vai trò quan trọng trong nhiệm vụ đảm bảo vệ sinh an toàn thực phẩm nhằm làm giảm tỷ lệ ngộ độc do vi khuẩn gây nên. theo dõi khảo sát đảm bảo vệ sinh an toàn thực phẩm để hạn chế sự ô nhiễm và tác hại của vi khuẩn trong quá trình thu hoạch các sản phẩm nông nghiệp. ngộ độc thực phẩm đã trở thành mối quan tâm của toàn xã hội. Có nhiều nguyên nhân gây ra các vụ ngộ độc thực phẩm nhưng phần lớn các trường hợp có nguồn gốc từ vi sinh vật. Trong thực tế cuộc sống. đánh bắt hải sản đến quá trình ‘bảo quản chế biến và nấu nướng tới tay người tiêu dùng thường rất phức tạp và gặp nhiều khó khăn. [Type text] Page 36 . Một trong những loại ngộc độc thực phẩm gây ra bởi vi sinh vật thường gặp là ngộ độc thực phẩm do vi khuẩn E. chăn nuôi.

Thử nghiệm sinh indol a. SIM (Sulfide Indol Motility)… khi cần kiểm tra cùng lúc nhiều đặc tính sinh hóa cần thiết.urea (-). Trytophanase xúc tác phản ứng loại nhóm amin để tạo thành indol. Đọc kết quả [Type text] Page 37 . Thử nghiệm này được dùng để phân biệt E. ủ ở nhiệt độ 370C trong 24-48 giờ. Viêc phát hiện indol được thực hiện bằng phản ứng của phân tử này với các thuốc thử chứa p-Dimethylaminobenzaldehyde (p-DMABA). Trước khi bổ sung thuốc thử có thể bổ sung 1ml ether hoặc xylene vào ống nghiệm.haemolytica (-) và P. Phương pháp tiến hành Môi trường sử dụng cho thử nghiệm này có thể là nước tryptone. b. Sinh khối chủng thuần được cấy vào ống môi trường lỏng thuộc một trong các loại nêu trên. Pasteurella multocida (+) và P. Chủng dùng làm đối chứng (+) cho thử nghiệm này là Proteus rettgeri. Heamophilus heamoglobinophilus (+) và H. hoặc các môi trường kết hợp như MIU (Motility Indol Urea).[Type text] [Type text] [Type text] PHỤ LỤC I. Nguyên tắc Trytophan là một acid amin có thể bị oxi hóa bởi một số vi sinh vật có hệ enzyme trytopanse tạo nên các sản phẩm chúa gốc indol. Bacillus alvei (+) với các Bacillus khác (thường là -). THỬ NGHIỆM SINH HÓA 1. để yên vài phút.influenzae (-) với các loài Haemophilus khác (thường là -). c. lắc đều để chiết tách indol lên lớp dung môi hữu cơ.coli (+) với Klebsiella (-).pneumotropica (+) với P. Phân tử này sau đó bị biến đổi theo hướng loại nhóm amin (deamination) thành indol hay theo hướng loại nhom1carboxyl (decarboxylation) thành skatol. Nhỏ 5 giọt thuốc thử vào ống dịch nuôi cấy. Phản ứng trung gian chính của phản ứng oxi hóa tryptophan là indolpyruvic acid IPA. theo dõi sự tạo màu đỏ trong lớp dung môi hữu cơ. Proteus mirabilis (-) với các loài Proteus khác (+). (-) là Serratia marcescens. hai loại thuốc thử có thể sử dụng cho thử nghiệm này là thuốc thử Kovacs và thuốc thử Erlich. Nhân pyrrol của indol chứa nhóm CH2 sẽ kết hợp với nhân benzene của p-DMABA tạo nên một phức chất dạng quione màu đỏ.

. sau 18-24 giờ nuôi cấy môi trường bề mặt của ống thạch nghiêng trở nên có pH kiềm và phần sâu trong ống có pH acid. ở phần sâu trong môi trường mới có điều kiện oxi không đầy đủ.1% glucose. Ngược lại. TSI a. lactose) và khả năng sinh H2S của chủng vi sinh vật Về nguồn carbon. . nếu trong môi trường có chất chỉ thị là đỏ phenol thì trên mặt thạch nghiêng sẽ có màu đỏ và phần sâu có màu vàng. Thử nghiệm KIA. glucose được lên men kỵ khí sinh ra các acid hữu cơ làm giảm pH của môi trường. Khả năng sử dụng cà hai nguồn đường là glucose và lactose hay chỉ sử dụng glucose để thu lấy năng lượng cần cho tăng trường là tùy thuộc vào di truyền của chủng vi sinh vật và có thể được theo dõi trên ống thạch chứa môi trường KIA. đôi khi có sự xuất hiện của màu cam do skatol. Điều này có thể được giải thích là lượng glucose trong phần bề mặt của môi trường được vi sinh vật oxi hóa hoàn toàn thành H2O và CO2 để thu năng lượng.Nếu vi sinh vật không sử dụng được cả hai nguồn carbon này. 2. có ba trường hợp có thể xảy ra đối với sự tăng trưởng của chủng vi sinh vật thử nghiệm: chỉ sử dụng glucose. Để đáp ứng nhu cầu năng lượng cho tăng trưởng.Nếu vi sinh vật có thể sử dụng cả glucose và lactose. . không sử dụng cà hai loại đường này. là (-) khi có lớp màu vàng của thuốc thử trên bề mặt môi trường. vi sinh vật tiến hành dị hóa pepton trong môi trường qua đó giải phóng NH3 làm phần bể mặt của môi trường mới có pH kiềm. môi trường TSI có thành phần như môi trường KIA nhưng có them 1% sucrose (saccharose). thì pepton được sử dụng để biến dưỡng thu năng lượng và vật chất cấn cho sự tăng trưởng của vi sinh vật. Khi chủng cấy lên môi trường này. là tiền chất methyl hóa của indol. Tương tự. tạo ra. môi trường KIA chứa hai loại đường là 1% lactose và 0. sử dụng các glucose và lactose. [Type text] Page 38 . Nguyên tắc Môi trường KIA (Ligler Iron agar) và môi trường TSI (Triple Sugar iron Agar) được sử dụng để kết hợp thử nghiệm đồng thời khả năng sử dụng các nguồn carbon khác nhau (glucose.[Type text] [Type text] [Type text] Thử nghiệm là (+) khi có sự xuất hiện của lớp màu đỏ trên bề mặt môi trường. Khả năng này của vi sinh vật có thể được xác định thong qua sự đổi màu của chỉ thị pH trong môi trường ở trên bề mặt và bên trong môi trường trong ống thạch nghiêng.Nếu vi sinh vật chỉ lên men glucose. sau 18-24 giờ nuôi toàn bộ môi trường đều trở nên có pH acid vì sự biến dưỡng đồng thời cá glucose và lactose ở bề mặt môi trường giúp vi sinh vật đủ năng lượng để tăng trưởng mà không cần phải sử dụng đến pepton.

Thử nghiệm khả năng sinh H2S có thể thực hiện đồng thời trên hai môi trường này do thành phần môi trường có chứa sodium thiosulphate. sự sinh khí ở phần sâu.Thử nghiệm sinh H2S: thử nghiệm là (+) nếu xuất hiện tủa màu nâu đen bên trong môi trường.5cm và phần sâu có chiều cao khoảng 2. các ống thạch nghiêng được ủ ở 370C từ 18-24 giờ. Trong khi đó. Chỉ thị này có màu thay đổi khác nhau tùy dãy pH hay nồng đô ion H+: đỏ khi ph thấp hơn 4. Chỉ thị đỏ methyl red giúp phân biệt nồng độ ion H + hiện diện trong môi trường sau khi vi sinh vật lên men glucose. Ghi nhận màu. sau đó ria trên bề mặt thạch nghiêng. Đọc kết quả . Trường hợp sử dụng môi trường TSI. là (-) nếu không xuất hiện tủa nâu đen. Trong các trường hợp nêu trên.[Type text] [Type text] [Type text] Tuy nhiên. Phương pháp tiến hành Môi trường KIA hay TSI được pha chế. các hiện tượng lien quan đến sử dụng nguồn carbon cũng xảy ra tương tự. c.Thử nghiệm khả năng sử dụng đường: xem mục nguyên tắc.5cm. Sau khi cấy giống.4 màu cam trong vùng pH [Type text] Page 39 . dung que cấy thẳng cấy sinh khối từ khuẩn lạc của chủng thuần vào phần sâu của ống thạch nghiêng nhưng tránh chạm đáy ống. . b. Thử nghiệm MR (Methyl Red) a. Nguyên tắc Thử nghiệm MR nhằm phân biện vi sinh vật dựa trên sự khác biệt về khả năng tạo ra và duy thì các sản phẩm biến dưỡng có tính acid bền trong môi trường trong quá trình lên men glucose. hấp khử trùng và chuyển vào các ống thạch nghiêng sao cho đỉnh thạch nghiêng cách nắp ống nghiệm khoảng 2. Vi sinh vật khử sulfate có thể khử hợp chất này để giải phóng H2S tạo ra sẽ được phát hiện dựa vào phản ứng tạo kết tủa màu đen FeS giữa H2S và ion Fe2+ của chỉ thị ferric ammonium citrate hiện diện trong môi trường. màu ở mặt thạch nghiêng. sự tạo thành màu nâu bởi FeS. 3. nếu sự lên men được tạo ra các sản phẩm khí thì khí sẽ tích tụ bên trong thành bọt khí hay sẽ làm vỡ thạch. phần môi trường sâu trong ống nghiệm sẽ không có hiện tược đổi màu. do pepton chỉ được biến dưỡng trong điều kiện hiếu khí nên hiện tượng kiềm hóa môi trường chỉ diển ra trên phần của bề mặt môi trường và chỉ phần này trở nên có màu đỏ.

khi héo dài thời gian nuôi cấy. Enterbacter aerogenes (-) với Enterbacter cloacae (+). Yersinia spp. Dung que cấy vòng cấy một lượng nhỏ sinh khối từ khuẩn lạc chủng thuần trên môi trường KIA. Đối với các vi sinh vật đường ruột. ủ ở 370C trong khoảng 2-5 ngày. ngược lại. Tuy nhiên các vi sinh vật này đều tạo acid trong môi trường ngay khi chúng bắt đầu tăng trưởng. trường hợp các vi sinh vật cho phản ứng MR(-) sẽ tiếp tục chuyển hóa các sản phẩm có tính acid đã được tạo ra thành các sản phẩm trung tính làm cho pH trong môi trường chuyển dần về phía trung tính. Phương pháp tiến hành Thử nghiệm được tiến hành trong các ống môi trường lỏng Glucose Phosphate (MR-VP broth). 4. (-) là Serratia marcescens. Thử nghiệm VP (Voges-Prokauer) a. Đọc kết quả Thử nghiệm MR là (+) khi môi trường có màu đỏ sau khi bổ sung thuốc thử. Trường hợp màu cam. Thử nghiệm này giúp phân biệt E. Chủng dùng làm đối chứng (+) cho thử nghiệm này là Proteus rettgeri. thời gian nuôi cấy để thử nghiệm phản ứng MR thường được xác định trpong khoảng 18-24 giờ. Họ Enterbacteriaceae có đặc tính [Type text] Page 40 . ở các loài vi sinh vật. (+) với các loài Bacillus Gram âm khác không thuộc đường ruột (-). các vi sinh vật có phản ứng MR (+) có đặc tính là tích lũy acid trong môi trường ngày càng nhiều hơn và độ pH trong môi trường ngày càng giảm. biến dưỡng năng lượng bằng phương thức lên men từ glucose qua con đường đường phân sẽ tạo ra chất trung gian chủ yếu là pyruvic acid. bảo quản ở 40C) vào trong ống nghiệm dịch nuôi cấy.[Type text] [Type text] [Type text] 5. màu vàng khi pH trên 6. b. Hàm lượng ion H + này phụ thuộc vào tỷ lệ CO2 và H2và con đường chuyển hóa đường của từng loài vi sinh vật. Them vài giọt thuốc thử methyl red (0. là (-) khi có màu vàng.0. xác định Listeria monocytogenes (+). Để khôi phục dự trữ NAD+ trong tế bào phục vụ cho con đường đường phân. đọc kết quả ngay. c. Thử nghiệm MR phụ thuộc rất nhiều vào thời gian nuôi cấy và thường được tiến hành trong thời gian khoảng 3-5 ngày ở 370C. cần tiếp tục ủ ống môi trường có giống trong 4 ngày và thục hiện lại thử nghiệm. sau đó pyruvic acid tiếp tục được chuyển hóa theo các con đường sinh hóa khác nhau tạo ra các sản phẩm lên men cuối cùng khác nhau. Nguyên tắc Ở vi sinh vật.0 – 5.8.02% trong hỗn hợp cần nước có tỷ lệ 3:2.coli (+) với Klepsiella (-).

(-) là Proteus rettgeri.3% creatine 40% KOH hoặc NaOH. phân biệt một số loài của Klebsiella. . trường hợp nghi ngờ nên tiến hành ủ các ống môi trường song song ở hai điều kiện nhiệt độ.3-bute\anediol dehydrogenase. 2. ethanol. H2 và CO2.Thuốc thử Barrit: gồm dung dịch A là 5% α-napthol trong cồn tuyệt đối. một số loài như Enterobacter hafniae có kết quả thử nghiệm VP không ổn định ở 370C nhưng cho (+) ở 25-300C. đến lượt mình acetion bị oxi hóa thành diacetyl. Chủng dùng làm đối chứng (+) cho thử nghiệm này là Serratia marcescens. Ngoài ra. Trong thuốc thử Koblentz và O’Meara có chứa creatime có tác dụng bổ sung nguồn nhân guanidine. AMC) từ 2. có 3 loại thuốc thử VP là: . Nhu vậy. .3-butanediol thành diacetyl. [Type text] Page 41 . dung dịch B là 40% KOH hoặc NaOH.3-butanediol bị chuyển hóa thành acetion. Dùng que cấy vòng cấy vào các ống môi trường MRVP một ít sinh khối ( trường hợp dùng thuốc thử Koblenntz như dưới đây thì cấy nhiều sinh khối) từ khuẩn lạc của chủng thuần đã ủ 18-24 giờ trên môi trường KIA hoặc TSI. Phương pháp tiến hành Môi trường được sử dụng cho thử nghiệm VP là môi trường lỏng Clark-Lubs (môi trường MR-VP). họ này có thể được chia thành hai nhóm là nhóm không sinh 2. Ủ yên các ống môi trường này ở 370C trong 20-48 giờ hoặc đến 10 ngày khi cần thiết. thử nghiệm VP có thể giúp phân biệt các loài trong Enterbacteriaceae dựa trên sự oxi hóa acetion (acetylmethylcarbinol. Diacetyl kết hợp với nhân guanidine có trong pepton kết tụ thành phức diacetyl-guanidine có màu đỏ. 2. Thử nghiệm VP được dung để phân biệt Klebsiella pneumonia (+) và Enterbacter (+) với E.Thuốc thử Koblentz: gồm dung dịch A là 5% α-napthol trong cồ 95%. acid acetic.Thuốc thử O’Meara: dung dịch 0. acetoin có thể bị khử thành 2. acid succinic.3-butanediol (ví dụ như Klebsiella. Như vậy. dung dịch B là 0.coli (-).3-butanediol do hoạt tính của enzyme diacetyl reductase. Do vậy. bổ sung thuốc thử trực tiếp vào ống môi trường.3butanediol (ví dụ như E.3-butanediol bị oxi hóa thành aceton nhờ xúc tác của enzyme 2. acetoin còn bị oxi hóa thành diacetyl. Enterobacter). Sau thời gian ủ. khi có oxi và pH kiềm. để xác định Listeria monocytogenes (+).3% creatine 40% KOH hoặc NaOH. b. Phân tử 2.3-butanediol có thể chuyển hóa qua lại thành aceton: trong điều kiện có oxi và môi trường có tính kiềm.(. có pH 6.coli) và nhóm sinh 2.[Type text] [Type text] [Type text] chung là lên men sinh hỗn hợp acid như acid formic. ngược lại. chất này tham gia vào phản ứng tạo màu trong thử nghiệm VP. Sự oxi hóa acetion thành diacetyl được tăng cường nhờ xúc tác của α-napthol.

Thử nghiệm khả năng biến dưỡng citrate a. (-) là Staphylococcus epidermidis.coli (-) trong thử nghiệm IMViC. Trước khi sử dụng nên kiểm tra thuốc thử bằng các chủng đố chứng như E. Sản phẩm biến dưỡng citrate thay đổi tùy pH của môi tường. [Type text] Page 42 . Sự phân giải của muối ammonium dùng làm nguồn đạm trong môi trường sẽ sinh NH3 làm kiềm hóa môi trường. lượng acetate cà formate tạo thành sẽ tăng trong khi lactate và CO 2 giảm. lắc nhẹ ống 1 phút để oxi hóa acetone. 5. khả năng tăng trưởng của chủng sẽ thể hiện qua khả năng biến dưỡng nguồn carbon citrate và nguồn đạm ammonium làm tăng giá trị pH của môi trường. Như vậy trong môi trường thử nghiệm khả năng sử dụng citrate làm nguồn carbon duy nhất có chứa đạm ở dạng muối ammonium. sản phẩm tạo ra chủ yếu là acetoin và lactate. c. trước tiên nhỏ 6 giọt dung dịch A. bổ sung 1ml thuốc thử vào ống môi trường. đối với thuốc thử 1 thanh2n phần. sau đó nhỏ 2 giọt dung dịch B. Nguyên tắc Một số vi sinh vật có khả năng sử dụng citrate làm nguồn carbon duy nhất để thu lấy năng lượng và vật chất.coli (VP-) và Enterobacter cloacae (VP+). Phương pháp tiến hành Môi trường sử dụng cho thử nghiệm khả năng biến dưỡng citrate là môi trường rắn Simmons Citrate Agar (CSA) hay môi trường Christensens Citrate Sulfide Agar (CCSA). Như vậy sự biến dưỡng citrate bởi vi sinh vật sẽ tạo ra CO2 làm kiềm hóa môi trường. Ở pH acid. môi trường chuyển sang kiềm. Đọc kết quả Thử nghiệm VP là (+) khi có màu đỏ trên bề mặt môi trường. Đọc kết quả sau 20 phút hoặc chậm nhất 4 giờ. hoặc để phân biệt Edwardsiella (-) với Salmonella (+). Mặt khác mọi vi sinh vật có khả năng sử dụng citrate làm nguồn carbon duy nhất đều có khả năng dùng muối ammonium làm nguồn đạm duy nhất. là (-) khi bề mặt môi trường không đổi màu. b. Enterbacter (+) với E.[Type text] [Type text] [Type text] Khi sử dụng các loại thuốc thử có 2 thành phần. Sự gia tăng giá trị pH này được chỉ thỉ bằng sự đổi màu của chỉ thị pH trong môi trường. Ở pH trung tính sản phẩm chủ yếu là COP2 và acetate. khi pH tăng. Chủng dùng làm đối chứng (+) cho thử nghiệm này là Proteus rettgeri. sự biến dưỡng citrate thường thong qua sự kết hợp với acetylCoA thành oxaloacetate để vào chu trình tricarboxylic acid (chu trình Krebs). Thử nghiệm này được dùng để phân biết nhóm Klebsiella.

Trường hợp môi trường CCSA.4. c.6.3 [Type text] 20 g 1.7. chỉ thị màu là phenol red. chinh pH môi trường khoảng 7. Rót vào mỗi ống nghiệm có chứa ống Durham 10ml môi trường BGBL.5 g Page 43 . II. pH 7. mật bò vào trong khoảng 200ml và brilliant green trong khoảng 100ml nước cất. 2.9. Môi trường CCSA chứa nguồn đạm là cystein. thử nghiệm la (+) khi xuất hiện khuẩn lạc và môi trường chuyển sang màu xanh dương. Đọc kết quả .2 ± 0.4) trở thành màu đỏ. (-) khi không có khuẩn lạc và môi trường giữ nguyên màu xanh lục.Trường hợp môi trường CSA. Chủng thuần trên môi trường KIA hoặc môi trường thích hợp khác được cấy ria trên bề mặt môi trường CSA rắn trong ống thạch nghiêng. .0133 g 1 lít Hòa tan peptone và lactose vào trong 500ml nước cất. màu chỉ thị trở thành vàng và ở pH kiềm (trên 8. pH 6. Chỉ thị này có màu vàng ở pH dưới 6. chỉ thị bromothymol blue. trộn đều 3 dung dịch đạt thể tích cuối là 1 lít.0 màu xanh lục ở pH trung tính và màu xanh dương ở ph lớn hơn 7. EC Broth ( Canh EC) Trypticase or tryptose Muối mật No.2 ở 250C. ống thạch được ủ ở 35 0C trong 24-48 giờ hoặc kéo dài đến 4 ngày khi cần thiết. pH 6. Chủng vi sinh vật được cấy và ủ trong điều kiện tương tự như trường hợp môi trường CSA. Môi trường chưa sử dụng có màu thay đổi từ màu kem đến nâu. Ở pH acid (dưới 6.[Type text] [Type text] [Type text] Môi trường CSA chứa sodium citrate hoặc potassium citrate làm nguồn carbon duy nhất.8). thử nghiệm là (+) khi môi trường chuyển sang màu đỏ. Hấp ở 1100C trong 15 phút. MỘT SỐ MÔI TRƯỜNG VÀ THUỐC THỬ THÔNG DỤNG 1. Brilliant Green Bile Lactose Broth (canh BGBL) Peptone Lactose Mật bò Brilliant green Nước cất 10 g 10 g 20 g 0. (-) khi môi trường không đổi màu.

0 g 5.0 g 20.0 g 0.015 g 1000. Tiệt khuẩn 5 phút ở 1210C. Canh thang EE Peptone Glucose Disodium hydrogen phosphate Potassium dihydrogen phosphate Ox bile Brilliant green Nước cất 10.2.0 g 1000.2.0 g 5. Canh thang dinh dưỡng Beef extract Peptone Nước cất Điều chỉnh pH tới 7.[Type text] [Type text] [Type text] Lactose K2HPO4 KH2PO4 NaCl Nước cất 5 g 4 g 1. 4.225 g Page 44 . Tiệt khuẩn 15 phút ở 1210C 5.9 ± 0.0 g 2.0. pH 6.5 g 5 g 1 lít Rót môi trường vào ống nghiệm có chứa ống Durham. 3. Canh thang KCN Proteose peptone Sodium chloride Potassium dihydrogen phosphate [Type text] 3.0 g 8. Hấp ở 1210C trong 15 phút.0 g 0.0 ml 3.0 g 5.0 ml Điều chỉnh pH tới 7. cứ mỗi bình 30ml. chia ra bình.

phân vào bình tam giác.[Type text] [Type text] [Type text] Nước cất 1000. mỗi bình 225 ml.0 g 5. Tiệt khuẩn 15 phút ở 1210C.8. 6.0 g 5. 8. Canh thang Nitrate Meat extract Peptone Potassium nitrate Nước cất [Type text] 3.75 g 5. mỗi ống 1 ml. Bằng cách vô khuẩn và thận trọng. Canh thang MacConkey Peptone Lactose Ox gall Bromocresol purple Nước cất 20.0 ml Page 45 .5% lạnh (5-80C) lắc nhẹ nhàng và phân ra ống nghiệm .3. mỗi ống 10 ml với ống Durham lộn ngược.1 g 1000.0 g 2. Phân ra ác ống nghiệm.0 g 1000.01 g 1000.6.75 g 2. Diệt khuẩn 15 phút ở 1210C. 7.0 g 0. cho thêm 15 ml cyanid 0.0 ml Điều chỉnh pH tới 6.0 ml Điều chỉnh pH tới 7. đóng nút bằng nút bần thấm perafin và bảo quản ở 5-60C.0 g 1.0 g 5.0 ml Điều chỉnh pH tới 7.0 g 10. Canh thang L-ST Tryptose.0 g 0. Tiệt khuẩn 10 phút ở 1210C. tryptone hoặc trypticase Lactose Dipotassium monohydrogen phosphate Potasssium dihydrogen phosphate Sodium chloride Sodium lauryl sulphate Nước cất 20. để nguội và cho vào tủ lạnh 580C.

[Type text] Page 46 . 11.[Type text] [Type text] [Type text] Điều chỉnh pH tới 7. mỗi ống 5 ml.0 ml Điều chỉnh pH tới 7.0 10.2.0 g 1000. phân ra ống nghiệm.0 g 1.0 10.1-7. 10.0 5. Môi trường lên men carbohydrate Meat extract Peptone Sodium chlotide Chỉ thị Nước cất 3.0 phân ra các ống nghiệm đường kính 16mm.0 ml Điều chỉnh pH 7.2. Lauryl Sulphate Broth LSB (canh Lauryl Sulphate) Trytose Lactose Sodium chloride K2HPO4 KH2PO4 Lauryl sulphate Nước cất 20 g 5 g 5 g 2. phân ra các ống nghiệm có ống Durham .0.75 g 0. Môi trường Indol Tryptone Sodium chloride DL-trytophan Nước cất 10.8 ± 0. Tiệt khuẩn 15 phút ở 1210C.0 g g g g 1000.1 g 1 lít Hấp ở 1210C trong 15 phút. Tiệt khuẩn 15 phút ở 1210C. 9. Tiệt khuẩn 15 phút ở 1210C.75 g 2.0 g 5. pH môi trường là 6.

9 và lọc.Peptone Lactose Dipotassium hydrogen phosphate Agar Nước cất [Type text] 10. trừ disaccharide phải tiệt khuẩn bằng lọc hoặc ở 1210C trong 10 phút và cho vào môi trường cơ bản đã tiệt khuẩn trước.0 g 5.0 g 1000.[Type text] [Type text] [Type text] Glucose.0 ml Điều chỉnh pH tới 6. 13. sucrose … đậm độ dùng cuối cùng là 1%. 12. Đường cho vào môi trường cơ bản phải diệt khuẩn trước . Phân phối vào 1/3 ống nghiệm có nắp 1 x 100 hoặc 16 x 150mm. hấp ở 1210C trong 15 phút.0 g 2. Đun sôi 1 – 2 phút cho đến khi hòa tan. Simmon Citrate Agar Sodium citrate NaCl K2HPO4 NH4H2PO4 MgSO4 Bromothylmol blue Agar Nước cất 2 g 5 g 1 g 1 g 0. Môi trường VP Peptone Glucose Dipotassium hydrogen phosphate Nước cất 7.2 g 0.2.0 g 1000.0 g 15. lactose.8 ± 0.0 ml Page 47 .0 g 5. Tiệt khuẩn 20 phút ở 1150C.0 g 10. 14. Thạch L-EMB a. Đặt nghiêng ống nghiệm. pH cuối 6.08 g 15 g 1 lít Đun nhẹ và thỉnh thoảng lắc.

0 g 3.0 g 0.0 g 15.Tiệt khuẩn 15 phút ở 1210C.03 g 0. Đun chảy trước khi dùng. Thạch MacConkey Peptone Lactose Bile salts Sodium chloride Agar Neutral red Crystal violet Nước cất 20.5 g 5.0 g 10.4 g 0.2.0065 g Pha dung dịch a.0 g 10.[Type text] [Type text] [Type text] b.1-7.0 g 0.1.3 ml dung dịch methylen blue 0. 16. pentahydrate Trisodium citrate dihydrate Sodium cholate Ox-gall Sodium chloride (NaCl) Ferric citrate Bromothymol blue 10.001 g 1000.0 g 20.0 g 10.0 g 10.04 g [Type text] Page 48 . điều chỉnh pH tới 7.0 g 1. Chia ra từng bình 100ml.Eosin Y Methylen blue 0.15% 15. Rót ra đĩa petri. và cứ 100ml cho thêm 2ml dung dịch eosin Y 2% và 4.0 g 1.0 ml Điều chỉnh pH tới 7. Tiệt khuẩn 15 phút ở 1210C.0 g 5.0 g 5. Thạch TCBS Peptone Yeast extract Sucrose Sodium thiosulphate.

Không tiệt khuẩn bằng hấp ướt. Thạch TSI Meat extract Yeast extract Peptone Sodium chloride Lactose Sucrose Glucose Ferri citrate Sodium thiosulphate Phenol red Agar Nước cất 3.0 g 10.4. phân ra các ống nghiệm.0 g 10. Nguội tới 500C và rót ra đĩa Petri.0 g 5. 17. Thạch urê 1.0 g 1000. Đun nhỏ lửa và khuấy liên tục để cho tan thạch. mỗi ống 10 ml.[Type text] [Type text] [Type text] Thymol blue Agar Nước cất pH 0.6 ± 0. để nghiêng phần thạch ở đáy ống cao 2.0 g Page 49 a.0 g 1000.0 g 1. 18.2 Hòa tất cả các thành phần trên trong nước cất.0 ml 8.04 g 15.3 g 0.0 g 1.024 g 12. Tiệt khuẩn 10 phút ở 1210C.0 ml Điều chỉnh pH tới 7.3 g 0.0 g 0.0 g 20.0 g 5. Đĩa môi trường để ở 40C dùng trong 24h (ISO 1990).0 g 3. Peptone Glucose Soium chloride [Type text] .5 cm.

Trypticase (Tryptic) Soy Agar (TSA) Trypticase peptone Phytone peptone NaCl Agar Nước cất 15 g 5 g 5 g 15 g 1 lít Đun nóng để hòa tan agar. 19. công them NaCl vào để nồng độ cuối đạt 2 – 3%. pH cuối 7. 20.2.[Type text] [Type text] [Type text] Potassium hydrogen phosphate Phenol red Agar Nước cất Tiệt khuẩn trong 2 phút ở 1210C b. Urea Nước cất vừa đủ 2. Cho 50 ml b) vào 950 ml a) ở điều kiện vô khuẩn. mỗi ống 10 ml và để nghiêng. Để sử dụng cho các chủng Vibrio spp.03 g 0. phân phối vào các erlen.0 g 1000.5 g 10 g 0.0 g 1000.0 ml 400. Hấp khử trừng 15 phút ở 1210C.0 ml Tiệt khuẩn bằng lọc.0 g 0. Violet Red Bile Agar (VRBA) Cao nấm men Peptone hoặc gelysate NaCl Muối mật Lactose Neutral red Crystal violet Agar [Type text] 3 g 7 g 5 g 1.002 g 15 g Page 50 . phân ra các ống nghiệm.012 g 15. Ưa muối.8.3 ± 0. điều chỉnh pH tới 6.

Dimethylaminobenzalhehyde (p-DMABA) Isoamyl alcohol HCl đậm đặc 10 g 150 ml 50 ml Hòa tan p-DMABA trong dung môi. Them nước cất vào cho đủ thể tích 500ml [Type text] Page 51 . 21. điều chỉnh về pH 7.[Type text] [Type text] [Type text] Nước cất 1 lít Hòa tan các thành phần trong nước. Sử dụng làm trong môi trường đổ đĩa. bổ sung và khuấy từng phần nhỏ HCl cho đến khi đủ lượng. thuốc thử được chứa trong chai màu tối tránh ánh sang ở 40C. có thể thay thế isoamyl alcohol bằng amyl alcohol hoặc butanol. không hấp khử trùng. 22. Đun sôi trong 2 phút. Thuốc thử methyl red Methyl red Ethanol 95% Nước cất (đủ) 0.10 g 300 ml 500 ml Hòa tan đỏ methyl vào 300ml ethanol. Thuốc thử kovacs p.2.4 ± 0.

Clin. 7. tập Kỹ thuật kiểm tra và chỉ tiêu dánh giá chất lượng an toàn thực phẩm. thực phẩm và mỹ phẩm. chủ biên PGS. and Feng P.Vi sinh vật thực phẩm. E. [Type text] Page 52 . coli O157 and other shiga toxin producing E. NXB Giáo dục. 1995.. E.[Type text] [Type text] [Type text] TÀI LIỆU THAM KHẢO 1. 2. NXB Giáo dục Việt nam. 4.250.2006. coli. Journal of water and health 04. 33: 248 . J. Jimmy Kwang (1996) “Monoclonal Antibodies for Dectiction of the H7 Antigen of Escherichia Coli”. Leo Heijnen and Gertjan Medema . Applied and enviromental microbiology. Quantitative detection of E.. Payne W. 9p 3325-3332.coli in water samples using a culture method combined with real-time PCR. L.Các phương pháp phân tích vi sinh vật trong nước. 5. Simultaneous Identification of Strains of Escherichia coli Serotype O157:H7 and Their Shiga – Like toxin Type by Mismatch Amplification Mutation Assay – Multiplex PCR. 3. TS Lê Văn Phủng. Vol-62 No. phân heo tiêu chảy và thịt bò. A.Keen. Vi khuẩn y học. 6. Ralph B. Cebula T.Travis Littledike.Westama..04. James. Microbiol. Bộ y tế. Trần Linh Thước. đề tài: Sử dụng kỹ thuật multilplex PCR để phát hiện các gen độc lực của vk Escherichia coli phân lập từ phân bò. NXB Y học. Khóa luận tốt nghiệp. . Youngsheng He. E.

[Type text] [Type text] [Type text] [Type text] Page 53 .

Sign up to vote on this title
UsefulNot useful