[Type text

]

[Type text]

[Type text]

Trường Đại Học Kỹ Thuật – Công Nghệ TP.HCM Khoa Công Nghê Thực Phẩm
  

Đề tài:

-Tp.HCM tháng 11/2011Mục lục
Chương 1 : Tổng quan..............................................................................................4
[Type text] Page 1

[Type text]

[Type text]

[Type text]

I. Sơ lược về vi khuẩn E.coli.....................................................................................4 1. Đặc điểm sinh học..................................................................................................4 1.1 Hình thái................................................................................................................4 1.2 Tính chất nuôi cấy.................................................................................................4 1.3 Tính chất hóa sinh..................................................................................................5 1.4 Kháng nguyên........................................................................................................6 1.5 Phân loại................................................................................................................6 2. Khả năng gây bệnh................................................................................................7 3. Chẩn đoán vi sinh vật............................................................................................12 3.1 Chẩn đoán trực tiếp................................................................................................12 3.2 Chẩn đoán gián tiếp...............................................................................................12 4. Nguyên tắc điều trị và phòng bệnh.......................................................................13 4.1 Điều trị...................................................................................................................13 4.2 Phòng bệnh............................................................................................................13 Chương II : Các phương pháp phát hiện E.coli......................................................14 I. Phương pháp truyền thống....................................................................................14 1. Định lượng E.coli bằng phương pháp MPN........................................................14 1.1 Nguyên tắc.............................................................................................................14 1.2 Quy trình phân tích................................................................................................14 1.3 Cách đọc kết quả....................................................................................................15 2. Định lượng E.coli bằng phương pháp đếm khuẩn lạc........................................15 2.1 Nguyên tắc.............................................................................................................15 2.2 Môi trường và hóa chất..........................................................................................15 2.3 Quy hoạch phân tích..............................................................................................16 2.4 Cách tính kết quả...................................................................................................16
[Type text] Page 2

[Type text]

[Type text]

[Type text]

3. Phương pháp làm giàu vi khuẩn...........................................................................17 3.1 Nguyên lý..............................................................................................................17 3.2 Thiết bị và đồ thủy tinh..........................................................................................17 3.3 Môi trường và thuốc thử........................................................................................17 3.4 Cách làm................................................................................................................17 II. Phương pháp hiện đại..............................................................................................22 1. Phương pháp PCR.................................................................................................22 1.1 Nguyên tắc.............................................................................................................22 1.2 Môi trường tăng sinh.............................................................................................22 1.3 Môi trường phân lập..............................................................................................22 1.4 Trích ly DNA.........................................................................................................22 1.5 Qui trình multiplex-PCR........................................................................................24 1.6 Ưu và nhược điểm của phương pháp PCR.............................................................24 2. Phương pháp ELISA.............................................................................................25 2.1 Nguyên tắc.............................................................................................................25 2.2 Các phương pháp ELISA.......................................................................................26 2.3 Phát hiện E.coli O157:H7 bằng phương pháp Elisa...............................................29 2.4 Ứng dụng của kháng thể đơn dòng trong xác định E.coli O157:H7.......................30 2.5 Ưu điểm của phương pháp E.lisa...........................................................................30 3. Phát hiện E.coli bằng phức hợp kháng thể + hạt nano silica phát quang..................30 Kết Luận.....................................................................................................................34 Phụ Lục......................................................................................................................35 Tài liệu tham khảo.....................................................................................................47

[Type text]

Page 3

[Type text]

[Type text]

[Type text]

Chương I: TỔNG QUAN VỀ VI KHUẨN ESCHERICHIA COLI

I. SƠ LƯỢC VỀ VI KHUẨN ESCHERICHIA COLI (E.COLI)

Escherichia coli do Theodore Escherich (1857-1911), một nhà vi khuẩn học người Áo, phát hiện lần đầu tiên năm 1885. Chi Escherichia thuộc họ vi khuẩn đường ruột. Trong các loài thuộc chi này, E.coli được chọn làm điển hình và có vai trò quan trọng nhất trong y học. E.coli là một trong những thành viên chính của hệ vi khuẩn bình thường ở ruột nhưng cũng là căn nguyên của nhiều bệnh nhiễm trùng, trong đó có những bệnh nó là căn nguyên đứng đầu.

E.coli đã được sử dụng làm mô hình nghiên cứu về sinh học phân tử trong lĩnh vực vi sinh học nói riêng và sinh học nói chung.
[Type text]

Hình 1.1: Hình chụp vi khuẩn E.coli dưới kính hiển vi với kích thước 2 µm

Page 4

[Type text]

[Type text]

[Type text]

E.coli K12 là vi khuẩn được sử dụng làm mô hình nghiên cứu nhiều nhất. nhiều thành tựu về di truyền học, hóa sinh học đã được thu trên cơ sở nghiên cứu vi khuẩn này. Ngày nay E.coli cũng được sử dụng nhiều trong công nghệ sinh học. Mặc dù E.coli là loài vi khuẩn được nghiên cứu sâu nhất, cho đến nay nó vẫn tiếp tục được quan tâm nghiên cứu, với rất nhiều phát hiện mới ở tầm phân tử, đặc biệt cơ chế bệnh sinh của các type gây bệnh (pathotype).
1. Đặc điểm sinh học

1.1 Hình thái E.coli là trực khuẩn Gram âm. Kích thước trung bình từ 2 đến 3µm x 0,5µm; trong những điều kiện không thích hợp (ví dụ như trong môi trường có kháng sinh) vi khuẩn có thể rất dài như sợi chỉ. Rất ít chủng E.coli có vỏ, nhưng hầu hết có lông và có khả năng di động. 1.2. Tính chất nuôi cấy E.coli phát triển dễ dàng trên các môi trường nuôi cấy thông thường. Một số có thể phát triển trên môi trường tổng hợp rất nghèo chất dinh dưỡng. Hiếu kỵ khí tùy ý. Có thể phát triển ở nhiệt độ từ 5-400C. Nhiệt độ thích hợp xung quanh 370C. Trong điều kiện thích hợp E.coli phát triển rất nhanh, thời gian thế hệ chỉ khoảng 20 đến 30 phút. Cấy vào môi trường lỏng (như canh thang) sau 3 đến 4 giờ đã làm đục nhẹ môi trường, sau 24 giờ làm đục đều; sau hai ngày trên mặt môi trường có váng mỏng. Những ngày sau, dưới đáy ống có thể thấy lắng cặn. E.coli không mọc trên canh thang Selenit. Trên môi trường thạch thường, sau khoảng 8 đến 10 giờ, dung kính lúp đã có thể quan sát được khuẩn lạc. Sau 24 giờ khuẩn lạc có kích thước khoảng 1,5mm. Hình thái khuẩn lạc điển hình dạng S, nhưng có thể gặp dạng R, hoặc M. Trên môi trường phân lập, tùy theo chất chỉ thị màu, E.coli có khuẩn lạc màu vàng (như trên thạch lactose) hoặc màu đỏ (như trên thạch MacConkey). Không mọc được trên môi trường SS. Một số loại E.coli có tính chất nuôi cấy riêng có giá trị trong sàng lọc nhanh, như EAEC tạo thành váng đặc trường khi nuôi cấy trên canh thang Muller-Hinton. 1.3. Tính chất hóa sinh E.coli có khả năng lên men nhiều loại đường và có sinh hơi. Hầu hết E.coli đều lên men lactose và sinh hơi, trừ E.coli trơ (inactive) (trong đó có EIEC) không hoặc lên men rất chậm. Một số chi khác trong họ vi khuẩn đường ruột cũng có khả năng lên

[Type text]

Page 5

coli (bình thường) + + + T T T + + E. Không sử dụng được nguồn carbon của citrate trong môi trường Simmons.blatta e + T + + + E. ornithin. vì vậy có khả năng khử carboxyl của lysine. sau 48 giờ có thể dương tính. E. Betagalactosidase dương tính.[Type text] [Type text] [Type text] men nhanh lactose (như Klebsiella. Bảng 1.coli (inactive ) T T + T T + E. Thử nghiệm VP (Voges Proskauer) sau 24 giờ âm tính. Có decarboxylase.alberti s i + + T T + + + T + + + T ? + + + + + + - D-Glucose sinh + + + hơi Lactose + T Sucrose T T D-Mannitol + + + Adonitol + Cellobiose + D-Sorbitol + T D-Arabitol L-Ramnose T T + + Sinh sắc tố vàng ONPG: Ortho-nitrophenyl-beta-Dgalactopyranoside +: >90% dương tính -: < 10% dương tính.coli có khả năng sinh indole. Serratia và Citrobacter) được gộp vào một nhóm vi khuẩn có tên chung là coliform.1: Tính chất hóa sinh của một số loài thuộc chi Escherichia Các loài Thử nghiệm CNPG Indole Đỏ methyl VogesProskauer Citrate (Simmons) Lysine decarboxylase Arginine dihydrolase Ornithine decarboxylase Di động D-Glucose acid E. Không sinh H2S.vulneri E. [Type text] Page 6 . Enterobacter.herma nnii + + + + + + + T T + + + + E.fergus onii T + + T + + + + E. arginin và acid glutamic.

1.coli gây bệnh đường ruột (IPEC) đã được biết gồm: EPEC (Enteropathogenic E.5 Phân loại Dựa vào cấu trúc kháng nguyên.coli): E.coli gây xuất huyết ruột - Hai loại E.coli): E.coli bám dính phân tán EHEC (Enterohaemorrhagic E. Dựa vào vị trí gây bệnh các E.coli) hay E. - Các loại E. K và H sẽ có rất nhiều type huyết thanh khác nhau.coli. Khả năng gây bệnh [Type text] Page 7 .coli xâm nhập ruột EAEC (Enteroaggregative E.coli): E.coli có khả năng gây bệnh ở người được chia thành 2 nhóm: thứ nhất là nhóm gây bệnh đường ruột (IPEC-intestinal pathogenic E. Kháng nguyên H: hơn 50 yếu tố kháng nguyên H đã được xác định.coli gây nhiễm khuẩn đường tiết niệu 2.coli sinh độc tố ruột EIEC (Enteroinvasive E.4.coli). thứ hai là nhóm gây bệnh ngoài đường ruột (ExPEC-extraintestinal pathogenic E. trong đó A dưới dạng vỏ quan sát được bằng kính hiển vi quang học thông thường. ví dụ O86B7 (yếu tố kháng nguyên O số 86.coli): E. Kháng nguyên Kháng nguyên O: người ta đã biết tới gần 160 yếu tố kháng nguyên O của E.[Type text] [Type text] [Type text] T: 10-90% dương tính 1.coli gây bệnh đường ruột ETEC (Enterotoxigenic E.coli): E.coli được chia thành các type huyết thanh.coli). E. Kháng nguyên K: Khoảng 100 yếu tố kháng nguyên K đã được xác định và được chia thành ba loại: A. B và L.coli): E.coli): E.coli ngưng tập ruột DAEC (Diffusely adherent E.coli gây bệnh ngoài đường ruột quan trọng nhất là: MAEC (Meningitidis-associated E. B và L dưới dạng màng rất mỏng chỉ có thể quan sát được nhờ kính hiển vi điện tử. Mỗi type huyết thanh được ký hiệu bằng kháng nguyên O và K.coli): E.coli gây viêm màng não UPEC (Uropathogenic E. yếu tố kháng nguyên K số 7 loại B). Với sự tổ hợp của các yếu tố kháng nguyên O.coli gây tiên chảy (DEC-Dierrheagenic E.

Quyết định khả năng gây tiêu chảy của ETEC là độc tố ruột. E. viêm đường mật. E.coli đứng thứ hai (sau S. Tuy nhiên.coli có thể sinh một trong hai hoặc cả hai độc tố đó. Hậu quả của quá trình này là áp lực thẩm thấu trong lòng ruột tăng. dẫn đến làm giảm hấp thu Na+.[Type text] [Type text] [Type text] E. E. nó đứng đầu trong các vi khuẩn gây tiêu chảy. đứng hàng đầu trong các căn nguyên gây nhiễm khuẩn huyết. Cơ chế gây bệnh của E. Theo báo cáo của chương trình quốc gia giám sát tính kháng thuốc của các vi khuẩn gây bệnh thường gặp (1988-1994) thì E. còn ST-Ia thì hầu hết từ động [Type text] Page 8 . O128B12.500 Dalton. Khả năng này có vai trò của kháng nguyên CFA (clonisation factor antigen) đã được mã hóa bởi gen trên plasmid. LT bám vào thụ thể GM1 của tế bào biểu mô ruột non nhờ tiểu phần B. O25B15. nước được kéo từ tế bào ra lòng ruột gây tiêu chảy.aureus) về tỷ lệ phân lập được (tính chung tất cả các loại bệnh phẩm) ở nước ta. Độc tố chịu nhiệt ST có trọng lượng phân tử xấp xỉ 5000 Dalton. Một chủng E. O126B16. GMP vòng gây rối loạn chuyển hóa nước và điện giải giống như AMP vòng. Hầu hết các chủng sản xuất ra ST-Ib phân lập được từ người. Cấu tạo của LT gồm 1 tiểu phần A (active) với phân tử lượng 25. O26B6.coli là thành viên thuộc nhóm vi hệ bình thường của đường tiêu hóa. Những type huyết thanh có khả năng gây bệnh thường gặp trên lâm sàng là: O111B4. gồm hai loại LT I được mã hóa bởi gen trên plasmid và LT II được mã hóa bởi gen trên nhiễm sắc thể.coli là căn nguyên thường gặp trong viêm màng não. ST tác động lên ruột bằng sự hoạt hóa enzyme guanylate cyclase làm tăng GMP vòng (cGMPcyclic guanosine monophosphate). O127B8. nhiễm trùng trong bỏng. Tiều phần A được đẩy vào tế bào biểu mô hoạt hóa enzyme adenylate cyclase làm tăng AMP vòng (cAMP-cyclic adenosine monophosphate).000 Dalton và năm tiển phần B (binding) với phân tử lượng 11.coli khác nhau tùy loại:  ETEC-E. Độc tố ruột LT là ngoại độc tố. ST còn làm mất hoặc làm teo một phần nhung mao của tế bào biểu mô ruột. viêm đường tiết niệu. O55B5. O119B4. LT I và LT II có cấu trúc và cơ chế tác động giống nhau và giống với độc tố ruột của vi khuẩn tả. chiếm tỷ lệ cao nhất trong số các vi khuẩn hiếu khí (khoảng 80%).coli cũng là 1 vi khuẩn gây bệnh quan trọng.coli sinh độc tố ruột Hai yếu tố động lực quyết định khả năng gây bệnh của ETEC là: khả năng bám dính vào niêm mac ruột và sản xuất độc tố. Có hai loại độc tố ruột: loại không chịu nhiệt LT (heat labile toxin) và loại chịu nhiệt ST (heat stable toxin). Khả năng bám dính và cư trú trên tế bào biểu mô ruột non là điều kiện đầu tiên để có thể gây bệnh. ST-I gồm ST-Ia và ST-Ib. tăng tiết Cl-. viêm phổi ở trẻ mới sinh. O86B7. Người ta đã nói đến ST-I và ST-II.coli còn gặp trong nhiễm trùng ngoại khoa.

Tiêu chảy do ETEC thường khởi phát đột ngột. Vì vậy trong y văn hiện nay viết căn nguyên gây bệnh lỵ trực khuẩn (bacillary dysentery) gồm Shigella và EIEC. EIEC cho kết quả (+) tính trong thử nghiệm khả năng gây viêm kết giác mạc chuột lang (thử nghiệm Sereny). Gen mã hóa cho độc tố này có tên là sen (Shigella enterotoxin). Cơ chế bệnh sinh trong tiêu chảy do EAEC vẫn chưa được sáng tỏ hoàn toàn. loại III có dạng sợi riêng biệt. máu. [Type text] Page 9 . phá hủy tế bào rối mới xâm lấn sang các tế bào khác. EIEC xâm nhập vào trong tế bào biểu mô đại tràng. Tổn thương nhất chính là viêm loét hoại tử niêm mạc đại tràng. protein Pet và độc tố EAST-1 (enteroaggregative heat-stable toxin-1). Các yếu tố độc lực nêu trên của EAEC phần lớn được mã hóa bởi các gen nằm trên plasmid có phân tử lượng 60 MDa. làm tiêu các túi thực bào và nhân lên trong bào tương. Yếu tố điều hòa bám dính kết tập aggR. Một số yếu tố độc lực đực mã hóa bởi các gen trên nhiễm sắc thể đang được nghiên cứu. EAST-1 có khả năng phá hủy tế bào biểu mô. Khả năng xâm nhập được mã hóa bởi gen trên plasmid 140MDa.coli thuộc loại EAEC. EAEC-E. AAF/II và AFF/III. Ipa-Invasion plasmid antigen). có lẫn nhày máu.[Type text] [Type text] [Type text] vật hoặc các thức ăn có nguồn gốc động vật. Tính chất này được dùng để sàng lọc nhanh các chủng E. EAEC tạo thành váng đặc trưng. nhất là ở trẻ em. trong đó loại I và II có cấu trúc bó. Nó cũng là một trong những căn nguyên quan trọng của nhiễm khuẩn đường tiêu hóa ở khách du lịch. Yếu tố aggR có vai trò điều hòa sự biểu hiện của các AFF. Triệu chứng lâm sàng điển hình là đi ngoài phân ít.  EIEC-Ecoli xâm nhập ruột EIEC gây bệnh chủ yếu do khả năng xâm nhập vào niêm mạc đại tràng. Các AFF tạo nên kiểu bám dính hình chồng gạch trên tế bào Hep-2. Các gen trên plasmid này mã hóa cho các kháng nguyên xâm nhập (IpaA đến IpaD. Chưa gặp các chủng sinh ST-II gây tiêu chảy ở người. Ngoài các yếu tố dộc lực nêu trên EAEC còn tiết ra 1 protein có khả năng làm tan máu và làm mất thăng bằng vận chuyển ion qua màng.coli bám dính kết tập ruột EAEC thường gây tiêu chảy kéo dài hoặc mạn tính. Protein Pet được tiết qua màng ngoài vi khuẩn. Ba loại AAF đã được nói đến là AAF/I. Những yếu tố động lực chính của EAEC được nói đến gồm các diềm bám dính kết tập AAF (aggregative adhesion fimbriae). Khi nuôi cấy trên canh thang Muller-Hinton. Diềm bám dính kết tập được cho là yếu tố quyết định độc lực. gây tích tụ dịch và gây độc cho biểu mô tiêu hóa. Cơ chế gây bệnh giống vi khuẩn lỵ. phân toàn nước không có nhày. EIEC còn có khả năng sản xuất độc tố ruột giống một số Shigela.

tăng cAMP – giảm hấp thu Na+/tăng tiết Cl.2: Tóm tắt các đặc điểm liên quan đến khả năng gây bệnh của các E. EspA. Tir. nhân lên gây IpaD viêm loét hoại tử niêm mạc đại tràng Điểm bám dính kết tập AAF AAF tạo nên kiểu bám (aggregative adhesion fimbriae) dính hình chồng gạch aggR điều hòa sự biểu Yếu tố điều hòa bám dính kết tập aggr hiện của AAF Protein pet gây tích tụ dịch và gây độc tố cho biểu mô tiêu hóa Độc tố EAST-1 (enteroaggregative EAST-1 phá hủy tế heat-stable toxin-1) bào biểu mô Protein làm tan máu và mất thăng Protein làm tan máu Tiêu chảy cấp. CFA-III (tạo bó). PAI nhiễm sắc thể (LEE) TTSS gồm: intimin (eaeA).. EspD.[Type text] [Type text] [Type text] Bảng 1. Per (plasmid-encoded regulator) và Ler (LEE-encoded regulator. EspF. EspB. EspG và MAP (mitochondriaassociated protein) EAST-1 CDT (Cytolethal distending toxin) Các CFA mã hóa bởi plasmid: CFA-I (fimbriae cứng). STa. CFA-II và CFA-IV (fimbriae mềm) và pili dài liên quan với type IV Đặc điểm lâm sàng Bám dính tại chỗ nhờ Các tổn BFP thương A/E Tổn thương mô A/E Tiêu chảy cấp Cơ chế gây bệnh EPEC ETEC Bám vào niêm mạc ruột non (CFA I-IV) và sản xuất các độc tố ruột LTI. phân thường toàn nước không có nhầy máu Hội chứng lỵ trực khuẩn Tiêu chảy kéo dài [Type text] Page 10 .tăng cGMP – tiết chloride và/hoặc giảm hấp thu NaCl – tiêu chảy Các gen trên plasmid 140 MDa mã Vi khuẩn bám và xâm hóa các kháng nguyên xâm nhập nhập vào biểu mô đại (invasion plasmid antigen) IPaA – tràng.tiêu chảy Độc tố vững bền với nhiệt STa và STb Hoạt hóa guanylate (mã hóa bởi plasmid và transposon) cyclase. các protein tiết. LTII.coli Gen động lực hoặc yếu tố độc lực Plasmid 50-70 MDa (EAF): Mã hóa BFP (bundle-forming pilus).coli gây bệnh đường ruột Loại E. STb ETEC EIEC EAEC Độc tố chịu nhiệt LT I và LT II (mã hóa bởi plasmid) Hoạt hóa adenylate cyclase.

Stx2 và Stx2v. Stx còn có thể gây hội chứng tăng ure huyết tan máu (HUS-haemorrhagic uremic syndrome). PAI nhiễm sắc thể . làm hẹp và tắc mao mạch tiểu cầu thận. EspP . Các độc tố này được mã hóa bởi các gen prophage thích hợp trên nhiễm sắc thể. Độc tố Shiga: LCT.coli gây bệnh đường ruột EPEC được bắt đầu nghiên cứu rất sớm. Stx vào máu đến thận gây tổn thương tế bào biểu mô tiểu cầu thân. gây tiêu chảy phân như máu. Stx2v) mã . dẫn đến làm chết tế bào. Hậu quả là viêm đại tràng xuất huyết.[Type text] [Type text] [Type text] bằng vận chuyển ion qua màng EHEC/ VTEC DAEC và làm mất thăng bằng vận chuyển ion qua màng Plasmid 60 MDa mã hóa heamolysin. Loại vi khuẩn này có vai trò rất quan trọng trong viêm dạ dày ruột gây tiêu chảy ở trẻ em.ức chế quá trình tổng hợp protein của tế bào biểu mô đại tràng.coli. Stx2.Hủy hoại các vi nhung mao hấp thu cả tế bào biểu mô ruột. Độc tố Shiga hủy hoại chọn lọc các vi nhung mao hất thu của tế bào biểu mô ruột. ức chế quá trình tổng hợp protein dẫn đến làm chết tế bào.coli sinh độc tố Shiga. Yếu tố động lực chính của EHEC là độc tố Stx (Shiga toxin) hay độc tố gây độc đối với tế bào Vero VT (veroccytotoxin) vì vậy loại này thuộc nhóm có tên là VTEC – Verocytotoxin E. bệnh nhân bị suy thận cấp.gây hội chứng HUS hóa bởi các gen trên nhiễm sắc thể Các yếu tố bám dính Afa/Dr Afa/Dr gây bám dính (AIDA) phân tán EAST-1 EAST-1 phá hủy tế bào biểu mô Các geb set (enterotoxin) Có thể có TTSS với esc Tiêu chảy ra máu (do xuất huyết đại tràng) Tiêu chảy phân thường không có máu EHEC còn được gọi là E. Hậu quả của quá trình này là mức lọc của thận suy giảm. từ những năm 1940. Hiện nay.  DAEC – E. Độc tố Shiga (Stx1. có ba loại Stx do EHEC sinh ra đã được xác định là Stx1.  EPEC – E.coli bám dính phân tán [Type text] Page 11 . Những trường hợp hoại tử nặng có thể gây thủng ruột. Nó cũng xâm nhập vào tế bào biểu mô đại tràng. EPEC bám dính vào niêm mạc ruột gây tổn thương đặc trưng là sự phá hủy vi nhung mao ở riềm bàn chải của niêm mạc ruột.

UPEC là nguyên nhân chủ yếu của nhiễm trùng đường tiết niệu.coli thì phản ứng sẽ dương tính. K2.coli cơ bản gống với qui trình chuẩn đoán các vi khuẩn đường ruột.coli. K12. những vi khuẩn này thường có các gen mã hóa cho các yếu tố độc lực như yếu tố bám dính. O7 và O75. Đối với viêm màng não mủ có thể phát hiện kháng nguyên đặc hiệu của vi khuẩn bằng phản ứng ngưng kết latex. Nhiều tác giả cho rằng có sự liên quan chủ yếu đến cơ địa của trẻ. Có thể làm tiêu bản soi trực tiếp đối với một số loại bệnh phẩm như cặn ly tâm nước tiểu hoặc nước não tủy. Các chủng có kháng nguyên K1. E.[Type text] [Type text] [Type text] DAEC là type gây bệnh được mô tả tương đối gần đây.1.coli gây bệnh được trộn dịch nảo tủy. tới 80% các trường hợp viêm màng não ở trẻ sơ sinh do E. Nguyên lý của phản ứng này như sau: các hạt latex có gắn kháng thể kháng E. cho kết quả rất nhanh và độ tin cậy rất cao. là một trong các kháng nguyên nhóm máu. nước tiểu với nhiễm khuẩn đường tiết niệu. Nó được xác định là một type gây bệnh riêng vì không có các gen độc lực đặc trưng của các type khác đã được mô tả trước. Dễ làm. Chẩn đoán trực tiếp Bệnh phẩm khác nhau tùy bệnh: là phân với nhiễm khuẩn đường tiêu hóa. 3. Tuy nhiên đã xác định được những gen độc lực của ExPEC thường gặp trong các nhiễm trùng ngoài đường ruột. O6.coli gây bệnh đường ruột (IPEC). Ngoài ra nó coàn có một số yếu tố độc lực khác cũng tham gia vào cơ chế gây bệnh.coli có thể gắn đặc hiệu vào kháng nguyên P. MAEC có kháng nguyên vỏ có liên quan về mặt hóa học và miễn dịch với polysaccharide nhóm B của Neisseria meningitides.coli gây bệnh ngoài đường ruột (ExPEC) là những vi khuẩn gây bệnh cơ hội khi “lạc chỗ”. hiểu biết về sự nhạy cảm của trẻ sơ sinh với loại E. Chẩn đoán vi sinh vật 3. K5. Nhờ Pili này.coli này chưa đầy đủ.K13 là hay gặp nhất. Theo kết quả của nhiều nghiên cứu. các độc tố. yếu tố độc lực quan trọng của UPEC là P-pili. Đó là phản ứng ngưng kết thụ động. Cho đến nay. v\các nhóm huyết thanh hay gặp là O1. nhất là ở những người có cơ chế đề kháng bị suy giảm. vào đường tiết niệu thì trở nên gây bệnh. K3. nếu trong bệnh phẩm có kháng nguyên đặc hiệu của E. Chúng có thể là thành viên của hệ vi khuẩn bình thường ở ruột nhưng khi vào máu. [Type text] Page 12 . O2. máu nếu là nhiễm khuẩn máu… Qui trình chuẩn đoán trực tiếp E. vỏ. vào dịch tủy não. Khác với E. O4. các E.

vì vậy cần phải làm kháng sinh đồ để chọn kháng sinh thích hợp. Nguyên tắc điều trị và phòng bệnh 4. 3.coli. Endo.coli trực tiếp từ bệnh phẩm đang được nghiên cứu phát triển. rút ống thông sớm nếu có thể được. Sau khi đã phân lập được vi khuẩn thuần nhất thì xác định tính chất sinh vật hóa học và định tên bằng phản ứng ngưng kết trên phiến kính với các kháng huyết thanh mẫu.2. Ở nước ta hiện nay chủ yếu mới sử dụng PCR trong định danh khi vi khuẩn đã được phân lập thuần nhất.1 Điều trị E. Để xác định các E. [Type text] Page 13 . thực hiện các biện pháp phòng bệnh chung không đặc hiệu giống như đối với các vi khuẩn đường ruột khác. phương pháp thử nghiệm trên tế bào nuôi. Để đề phòng nhiễm khuẩn đường tiêu hóa do E.2. nhất là các chủng phân lập được từ nước tiểu. hiện nay có môi trường uriselect vừa có giá trị cấy đếm. ELISA… Kỹ thuật khuếch đại gen PCR cũng đã được áp dụng trong chẩn đoán E. Bệnh phẩm phân được nuôi cấy trên môi trường phân lập có chất ức chế chọn lọc như DCL. phương pháp đồng ngưng kết. Phòng bệnh Hiện nay chưa có phương pháp nào phòng bệnh đặc hiệu. 4. một số việc khác rất có giá trị trong điều trị như bồi phụ nước.coli. giải quyết các cản trở trên đường tiết niệu. Tiến hành cấy máu khi nghi có nhiễm khuẩn máu. vừa có khả năng định danh. 4.coli thuộc vào các vi khuẩn có tỷ lệ kháng thuốc cao.[Type text] [Type text] [Type text] Phương pháp chuẩn đoán chủ yếu nhất là nuôi cấy phân lập.coli sinh độc tố người ta có thể sử dụng nhiều phương pháp khác nhau như phương pháp quai ruột. điện giải trong trường hơp ỉa chảy (việc này nhiều khi có vai trò quyết định để cứu sống bệnh nhân). Các kỹ thuật PCR xác định E. Nước tiểu giữa dòng được tiến hành cấy đếm trên môi trường đặc.coli. Ngoài việc sử dụng kháng sinh. trước đây thường sử dụng thạch thường. Chẩn đoán gián tiếp Trên thực tế phương pháp huyết thanh học không được sử dụng để chẩn đoán các nhiễm khuẩn do E.

Định lượng E. Phương pháp này dựa vào nguyên tắc mẫu được pha loãng thành một dãy thập phân (hai nồng độ kế tiếp khác nhau 10 lần). đây là các ống dương tính.[Type text] [Type text] [Type text] Thực hiện các biện pháp ngăn ngừa nhiễm trùng bệnh viên vì E.coli: thực hiện vệ sinh vùng hậu môn và bộ phận sinh dục ngoài. Phương pháp truyền thống 1. thực hiện nghiêm túc nguyên tắc vô trùng khi phải tiến hành thăm dò hoặc đặt thông đường tiết niệu. Để phòng nhiễm khuẩn đường tiết niệu do E.coli là một trong các vi khuẩn gây bệnh cơ hội quan trọng.coli bằng phương pháp MPN 1. Điều trị loại trừ các yếu tố nguy cơ khác. Mỗi nồng độ pha loãng được ủ từ 3 đến 5 ống lặp lại. Theo dõi sự sinh hơi và đổi màu để định tính sự hiện diện trong từng ống thử nghiệm. Chương II: CÁC PHƯƠNG PHÁP PHÁT HIỆN E.COLI I.1 Nguyên tắc Số lương E. Ghi nhận số ống nghiệm [Type text] Page 14 .coli trong mẫu nước. 3 hoặc 5 mẫu có độ pha loãng thập phân liên tiếp được ủ trong ống nghiệm chứa môi trường thích hợp có ống bẫy khí Durham. thực phẩm chứa mật độ thấp có thể được xác định bằng phương pháp MPN ( Most Probable Number).

20C trong 24 giờ.coli (E. Ủ các ống nghiệm ở 37 0C trong 48 giờ. Dùng que cấy vòng cấy chuyển dịch mẫu từ các ống LSB (+) sang các ống có chứa canh BGBL và ủ ở 37 0C ± 10C trong 48 giờ.[Type text] [Type text] [Type text] cho phản ứng dương tính ở mỗi nồng độ pha loãng và được vào bảng MPN để suy ra số lượng nhóm vi sinh vật tương ứng hiện diện trong 1g (hoặc 1ml) mẫu ban đầu. Môi trường và hóa chất : - Môi trường lỏng Lauryl Sulphate Broth LSB (canh Lauryl Sulphate) Môi trường lỏng Brilliant Green Lactose Bile Salt (canh BGBL) Môi trường lỏng E. Ghi nhận số ống cho kết quả (+) (có sinh hơi) ứng với mỗi độ pha loãng. Thực hiện tương tự với dịch mẫu đã pha loãng 10-2 và 10-3. Đây là trường hợp xác định MPN bằng hệ 3 dãy nồng độ và 3 ống nghiệm lặp lại (hệ 3 x 3 hay 9 ống nghiệm). Simmon Citrate Agar để thực hiện các thử nghiệm IMViC. Dùng que cấy vòng chuyển một vòng dịch mẫu từ các ống canh LSB (+) sang môi trường canh EC. dẹt hình đĩa và có ánh kim tím).coli [Type text] Page 15 . canh EC) - Các môi trường lỏng trên được chuẩn bị trong các ống nghiệm chứa ống Durham úp ngược. mỗi ống chứa 10ml canh LSB. Ghi nhận ống có sinh hơi.. I.coli.coli medium. Khuẩn lạc E. Chọn khuẩn lạc có đường kính lớn hơn 1mm và cấy vào các môi trường MRVP. ủ ở 44.2 Quy trình phân tích Tuần tự cấy 1ml dung dịch mẫu đã pha loãng 10 -1vào 3 ống nghiệm giống nhau. phải sử dụng các mẫu có bậc pha loãng cao hơn.5 ± 0.coli giả định cho kết quả thử nghiệm IMViC tuần tự là + + . nếu nghi ngờ số lượng vi sinh vật trong mẫu quá cao. Ống nghiệm cho kết quả trong môi trường EC và khuẩn lạc E. Ủ các đĩa này ở 370C trong 24 giờ để tìm khuẩn lạc E. Dùng que cấy vòng ria dịch mẫu từ các ông (+) trên môi trường canh EC sang môi trường thạch đĩa MBN. chỉ sử dụng các ống nghiệm không có bọt khí bên trong ống Durham. Sau khi khử trùng. Đếm số lượng các ống cho kết quả (+) (sinh hơi) ở mỗi độ pha loãng.coli giả định (tròn.chính là E. Môi trường thạch đĩa EMP Môi trường rắn Simmon Citrate Agar (thạch Simmon Citrate) Canh MR-PV Thuốc thử Methyl Read Thuốc thử α-napthol.

coli (+) ở mỗi độ pha loãng của mẫu.coli bằng phương pháp đếm khuẩn lạc 2.Môi trường canh Tryptone Broth được phân phối 5ml vào mỗi ống nghiệm.coli (+) ở mỗi độ pha loãng của mẫu. Thực hiện tương tự cho tất cả các ông nghiệm cho kết quả (+) trong môi trường EC và tạo được khuẩn lạc E. . Các ống EC này được bảo quản ở 2 – 80C.coli bằng các thử nghiệm IMViC. 2. để nguội và bảo quản ở 2-80C cho đến khi sử dụng.Môi trường thạch Simmon Citrate được chuẩn bị dưới dạng các ống thạch nghiêng có màu xanh lục.2 Môi trường và hóa chất . 1. .coli (+).Môi trường canh MR-VP Broth được phân phối 5ml vào mỗi ống nghiệm.Môi trường canh Lactose Tryptone Lautyl Sulphate Broth (LST Broth) được chuẩn bị tương tự môi trường canh EC. . hấp khử trùng để nguội và kiểm tra không có sự hiện diện của bọt khí trong ống Durham. hấp khử trùng.Môi trường canh Tryptone Soya Agar (TSA) và môi trường Violet Red Bile Agar (VRB) được chuẩn bị vô trùng trong các chai thủy tinh. hấp khử trùng. [Type text] Page 16 . Ghi nhận số lượng các ống nghiệm có E. đun chảy và làm nguội ở nhiệt độ 450C trong bể điều nhiệt trước khi sử dụng. từ số lượng các ông nghiệm có E.3 Cách đọc kết quả Ở tất cả các trường hợp nêu trên.coli giả định trên môi trường EMB.[Type text] [Type text] [Type text] giả định trên môi trường EMB cho kết quả thử nghiệm IMViC như trên là ống nghiệm có E. ủ ở 440C trong 24 giờ.1 Nguyên tắc Mẫu đã được đồng nhất hóa được cấy một lượng nhất định lên môi trường thạch chọn lọc thích hợp chứa lactose.Môi trường canh Escherichia coli broth (EC Broth) được phân phối 10ml trong mỗi ống nghiệm chứa ống Durham úp ngược. 2.Thuốc thử Kovac’s. dùng bảng MPN thích hợp (bảng 3 x 3 tức 9 ống nghiệm) để tính ra mật độ vi sinh vật trong mẫu và biểu diễn dưới dạng trị số MPN/g hay MPN/ml mẫu ban đầu chưa pha loãng. . Định lượng E. Khẳng định khuẩn lạc đã đếm là E. đếm các khuẩn lạc có hình dạng đặc trưng của Coliforms. . .

canh MR-VP. có vòng tủa muối mật.[Type text] 2. Tiếp tục thực hiện để được các độ pha loãng thập phân tiếp theo sao cho chứa <100 tế bào E.coli (+) ( IMViC là + + . Lắc tròn đĩa petri xuôi và ngược kim đồng hồ.5 mm). Methyl Read.50C trong 24 giờ. Bổ sung vào mỗi đĩa đã cấy mẫu khoảng 5ml môi trường TSA đã được đun chảy và ổn định trong bể điều nhiệt 450C. 2. ủ ở 44 ± 0. Chọn các ống cho kết quả (+) (sinh hơi) và dung que cấy vòng chuyền sang các môi trường sau: canh Tryptone. lật ngược đĩa và ủ ở 37 ± 10C trong 24 – 48 giờ. Dung dịch này có độ pha loãng 10-2. Lắc đều trong một thời gian nhất định (ít nhất là 2 phút đối với mẫu rắn). Citrate.-). Chờ cho môi trường trong đĩa đông đặc. Voges Proskauer. tính mật độ của E. Bổ sung vào mỗi đĩa 10 – 15ml môi trường thạch VRB ở nhiệt độ 450C trên môi trường TSA. sau đó tiếp tục chuyển 1ml dịch mẫu này vào ống nghiệm thứ hai chứa 9ml dung dịch pha loăng ta sẽ thu được dịch mẫu có độ pha loãng 10-3. Để nhiệt độ phòng trong 1 – 2 giờ để hồi phục các tế bào bị tổng thương. Ghi nhận khuẩn lạc cho thử nghiệm khẳng định E. Chuyển 1ml dịch pha loãng mẫu đã chọn vào đĩa petri. Dịch mẫu đồng nhất được tiếp tục pha loãng theo dãy thập phân bằng cách chuyển 1ml dịch mẫu vào ống nghiệm chứa 9ml dung dịch pha loãng. dung dịch mẫu thu được có độ pha loãng là 10-1 so với ban đầu. đường kính ≥ 0.coli trong 1ml dung dịch pha loãng. Ủ các môi trường trên ở 44 ± 0. thạch Simmon Citrate.4 Cách tính kết quả Dựa vào số khuẩn lạc đếm được và tỷ lệ khẳng định. dung que cấy vòng chuyền sang môi trường canh EC. mỗi chiều 3 – 5 lần để trộn dịch mẫu với môi trường.3 Quy trình phân tích [Type text] [Type text] Mẫu được đồng nhất hóa bằng cách đối với mẫu rắn xay nhuyễn mẫu trong điều kiện vô trùng rồi cân chính xác 10g (hoặc 25g). Chọn 5 khuẩn lạc nghi ngờ (khuẩn lạc màu đỏ đến đỏ đậm. bổ sung vào trong bình tam giác chứa 90ml (hay 225ml) nước SPW đã được hấp khử trùng.50C trong 24 giờ Thử nghiệm Indol. đối với mẫu lỏng hút 10ml (hoặc 25ml).coli theo công thức sau: A (CFU/mg hay CFU/ml) [Type text] =xR Page 17 . Thực hiện tương tự trên mẫu ở 2 nồng độ pha loãng liên tiếp sao cho mỗi đĩa xuất hiện từ 10 – 100 khuẩn lạc và lặp lại ít nhất 2 đĩa ứng với mỗi nồng độ pha loãng. Sau khi được làm đồng nhất bằng cách trên.

Những khuẩn lạc khả nghi được kiểm tra về đặc tính sinh hóa và huyết thanh của EEC. pipet. Canh thang EE (Enteric enrichement broth) (mt 14) 4. Ống nghiệm. Tủ ấm 350C 3. rồi làm giàu trong canh thang LST và EE sau đó ria lên thạch L-EMB.3 Môi trường và thuốc thử 1. Canh thang LST (Lauryl sulphate tryptose broth) (mt28) 6. Môi trường lên men (carbohydrate fermentation medium) (mt 46) 2. Canh thang MacConkey (mt 17) 8. Môi trường indole và thuốc thử (mt 44. mt 98) 5. Chậu nước 440C và 41. Thạch L-EMB (Levine’s methylene blue agar) (mt 76) 3.50C 2. đĩa Petri 3. Máy pha trộn 4.1 Nguyên lý Phương pháp này dựa vào làm giàu vi khuẩn trước trong canh thang dinh dưỡng và MacConkey.2 Thiết bị và đồ thủy tinh 1. Thạch MacConkey (mt 80) 7. 3. Canh thang nitrate (Nitrate broth) (mt 19) [Type text] Page 18 .[Type text] [Type text] [Type text] N: tổng số khuẩn lạc đếm được ni: số đĩa có số khuẩn lạc được chọn tại mỗi độ pha loãng V: dung tích mẫu (ml) cấy vào mỗi đĩa fi: độ pha loãng có số khuẩn lạc được chọn tại các đĩa đếm R: tỷ lệ khẳng định 3. Phương pháp làm giàu vi khuẩn 3.

Ủ ấm 440C trong 20h. Canh thang KCN (Potassium cyanide broth) (mt 3) 11. Xác nhận tính chất sinh vật hóa học : Ria từ canh thang LST dương tính lên thạch L-EMB và EE dương tính lên thạch MacConkey và thạch L-EMB. chuyển một quai cấy sang 30ml canh thang LST. Môi trường V. Chuẩn bị mẫu: Cân 25g mẫu bằng thao tác vô khuẩn rồi cho vào 225ml canh thang MacConkey và 225ml canh thang dinh dưỡng trong blender vô khuẩn và làm đồng nhất trong 30 giây (1:10) 2.5%. Chuyển một quai cấy sang 30ml canh thang EE. 3. 5. Kháng huyết thanh E. nhỏ một giọt canh thang của mỗi thứ lên trên phiến kính sạch và cho thêm một giọt huyết thanh đa giá OB và một giọt nước muối 0. Canh thang dinh dưỡng (Nutrient broth) (mt 6) 10. Ủ ấm 41.[Type text] [Type text] [Type text] 9. Ria thẳng Ria từ canh thang dinh dưỡng đồng nhất lên thạch L-EMB. Xét nghiệm sơ bộ về huyết thanh : Trung hòa canh thang LST và EE với 10% NaHCO3. Thạch TSI (Triple sugar iron agar) (mt 86) 12. Ủ ấm ở 350C trong 24h. thạch MacConkey. Làm giàu vi khuẩn : ủ ấm canh thang MacConkey ở 350C trong 20h . 4.P (Voges Proskauer medium) (mt 54) 14.Coli 3. Canh thang urê (các thành phần là thạch urê nhưng không có agar) (mt 93) 13.4 Cách làm 1. Ủ ấm canh thang dinh dưỡng 350C trong 6h. Trộn các giọt trên và xem ngưng kết. Ủ ấm 350C trong 24h. [Type text] Page 19 .50C trong 18h.

urease.[Type text] [Type text] [Type text] 5. hoặc ít nhất không đậm hơn so với màu sắc của các phương tiện truyền thông [Type text] Page 20 . có chứa thuốc nhuộm eosin và xanh methylene. VP.1 Chọn những khuẩn lạc điển hình và cấy vào môi trường TSI. Đặc tính sinh vật hóa học của E. Yếu hơn quá trình lên men kết quả lactose trong môi trường với một màu hơi hồng tím . Sản xuất axit mạnh mẽ bởi các sinh vật như E.Coli gây bệnh đường ruột - Thạch EMB Thạch Eosin methylene thạch màu xanh. Thuộc địa của men nonlactose vẫn không màu. citrate và adonitol.P. EMB agar chọn lọc bởi vì thuốc nhuộm anilin trong phương tiện truyền thông tím ức chế sự phát triển của sinh vật Gram dương.coli kết quả trong một ánh xanh kim loại. gây ra một sự thay đổi màu sắc trên môi trường. Lactose men chuyển hóa đường lactose trong các phương tiện truyền thông và sản xuất các sản phẩm phụ axit. Đồng thời cấy lên mặt thạch nghiêng PCA cùng một khuẩn lạc dùng để kiểm tra huyết thanh. indole. KCN. EMB cũng là một phương tiện khác biệt .Coli TSI (H2S) V. Indole Urease KCN Adonitol Cytochrome oxidase + + + acid 5.2 Nhận diện huyết thanh E. Vì vậy.

coli (+) [Type text] (1) (2) Hình 2.[Type text] [Type text] [Type text] Hình 2.5: Thử nghiệm Cytochrome oxidase với vi khuẩn E.coli Page 21 (B) (A) (A) Cho kết quả (-) (B) Cho kết quả (+) .coli cho kết quả dương tính Ống 2: E.coli (-) .4: Thử nghiệm Urease (1): E.coli trên môi trường thạch EMB (a) (b) (1) (2) ư Hình 2.coli cho kết quả âm tính Hình 2.3: Thử nghiệm Indole Ống 1: E.1: Khuẩn lạc E. (2): E.

coli (+).coli (-) [Type text] Page 22 . (b): E. (b): E.coli (-) Hình 2.7: Thử nghiệm MR (a): E.coli (+).6: Thử nghiệm VP (a): E.[Type text] [Type text] [Type text] (a) (b) Hình 2.

Phương pháp PCR (polymerase Chain Reaction) 1. cho nên trước khi phân lập cần sử dụng môi trường tăng sinh pepton đệm có bổ sung kháng sinh cefiximw (0.2 Môi trường tăng sinh Do số lượng E.0125mg/l) và vancomycin (8mg/l) để ức chế các vi khuẩn Gram dương và vi khuẩn sống hoại sinh khác. đặc biệt là E.coli gây bệnh hiện diện trong thực phẩm rất ít.coli (a): E.coli (+) (b): E.1 Nguyên tắc Phương pháp PCR (Polymerase Chain Reaction) là một phương pháp invitro để tổng hợp DNA dựa trên khuôn là một trình tự đích DNA ban đầu khuếch đại. Phương pháp hiện đại 1.coli (-) II. 1.3 Môi trường phân lập [Type text] Page 23 .coli nhóm STEC. : Thử nghiệm Citrate với vi khuẩn E. 1.[Type text] [Type text] [Type text] Hình2.8. nhân số lượng bản sao của khuôn này thành hàng triệu bản sao nhờ hoạt động của enzyme polymerase và một cặp mồi (primer) đặc hiệu cho đoạn DNA này.

Mẫu MAC (370C/24 giờ) SMAC (370C/24 giờ) Pepton (vancomycin. lấy ra và chuyển vào tủ âm -700C giữ trong 10 phút. SMAC. Trên từng loại môi trường MAC. hoặc CT-SMAC) cho vào eppendorf đựng sẵn 0. Làm thử nghiệm sinh hóa IMViC cho từng khuẩn lac riêng lẻ thuộc nhóm đó để xác định E.5mg/l). E. trên môi trường MAC.coli lên men sorbitol cho khuẩn lạc màu hồng. ly tâm 13000 vòng trong 3 phút. Sau khi rã đông hoàn toàn. Khoảng 90% E.coli đều lên men đường lactose. Sorbitol MacConkey (SMAC). những dòng E. cấy từng khuẩn lạc được chọn vào từng ống thạch nghiêng NA. CT-SMAC chọn ngẫu nhiên 6-10 khuẩn lạc rời rạc đại diện cho mỗi nhóm hình thái.coli không lên men đường sorbitol nên cho khuẩn lạc màu trắng. cefixime) (370C/24 giờ) CT-SMAC (370C/24 giờ) [Type text] Page 24 .coli trên môi trường thạch (MAC hoặc SMAC.05mg/l) và tellurite (2. E. Để yên và hút phần dung dịch ở phía trên làm DNA khuôn mẫu (DNA xét nghiệm). trên môi trường SMAC và CT-SMAC.5 ml nước cất hai lần vô trùng. đun sôi 10 phút.coli. 1. Sorbitol MacConkey (CT-SMAC) có bổ sung kháng sinh cefixime (0.[Type text] [Type text] [Type text] Môi trường phân lập là môi trường MacConkey (MAC).4-0.4 Trích ly DNA Việc trích ly DNA được thực hiện như sau: thu khoảng 6-10 khhuẩn lạc E.coli điển hình có khuẩn lạc màu đỏ.

-) Ly trích DNA (DNA nhóm khuẩn lạc) (-) Multiplex-PCR (+) Ly trích DNA riêng theo từng ống NA Loại bỏ ống NA đã giữ Multiplex-PCR Sơ đồ 1: Qui trình phân lập.4-0.5 ml H2O cất khử ion 2 lần Thử IMViC (+ + .[Type text] [Type text] [Type text] Chọn 6-10 khuẩn lạc đỏ hồng Chọn 6-10 khuẩn lạc theo từng nhóm riêng: trắng hoặc đỏ hoặc cả hai Cấy từng khuẩn lạc được chọn vào từng ống thạch nghiêng NA (370C/24 giờ) Thu tất cả phần còn lại của những khuẩn lạc đã chọn theo từng nhóm riêng và mỗi nhóm cho vào eppendorf chứa sẵn 0. coli [Type text] Page 25 . định tính và phát hiện gen độc lực E.

1.1 X. DNA 2µl.5. Taq 2.Ủ bắt cặp 610C/1 phút [Type text] Page 26 .[Type text] [Type text] [Type text] 1.Tiền biến tính 950C/5 phút .2. MgCl2 3mM.5. và nước cất vừa đủ 25µl. Các thành phần của phản ứng PCR: Mỗi phản ứng là 25µl.1 Trình tự các đoạn mồi sử dụng trong Multiplex-PCR Mồi (primer) Eae-F Eae-R EhxA-F EhxA-R Stx1-F Stx1-R Stx2-F Stx2-R Uid-F Uid-R Trình tự oligonucleotide (5’3’) ATTACCATCCACACAGACGGT ACAGCGTGGTTGGATCAACCT GTTTATTCTGGGGCAGGCTC CTTCACGTCACCATACATAT CAGTTAATGTGGTGGCGAAGG CACCAGACAATGTAACCGCTG ATCCTATTCCCGGGAGTTTACG GCGTCATCGTATACACAGGAGC GCGAAAACTGTGGAATTGGG TGATGCTCCATCACTTCCTG Kích cỡ DNA được khuếch đại (bp) 397 158 348 584 252 1.3. gồm các thành phần sau : PCR buffer 1. mỗi loại primer 7. Chu kỳ nhiệt .5 Qui trình multiplex-PCR 1.5 µl.Biến tính 940C/1 phút .5. mỗi dNTP 200µM.5 pmol.

có thể thực hiện ở hiện trường. 1. gel được ngâm trong dung dịch ethidium bromide khoảng 30 phút. .Có thể phát hiện được nhưng vi sinh vật khó nuôi cấy. do vậy có thể dẫn đến trường hợp dương tính giả do DNA từ tế bào chết.Ít tốn kém về mặt nhân sự. Sau khi điện di.6% trong TBE.Thời gian cho kết quả nhanh . Tuy nhiên. . việc chiết tách và tinh chế DNA từ thực phẩm hay môi trường khi thực hiện phương pháp PCR thường cho phép loại bỏ những hợp chất ức chế. Thang chuẩn (ladder) cũng được điện di đồng thời.Điện di.Sự ức chế Taq DNA polymerase bởi thành phần của mẫu vật do mẫu thực phẩm thường có những thành phần phức tạp.Phương pháp này không phân biệt được tế báo sống với tế bào chết. không cần dụng cụ và môi trường chẩn đoán phức tạp.Kéo dài 720C/1 phút . đọc kết quả Lấy 10µl sản phẩm PCR cùng với 2µl loading dye được điện di trên gel agarrose 1. ngược lại phương pháp [Type text] Page 27 .[Type text] . thời gian điện di 30-35 phút ở 90V và 250 mA. Ưu điểm và nhược điểm của phương pháp PCR  Ưu điểm: .  Nhược điểm: . nên trong đa số trường hợp cần có bước nuôi cấy làm giàu để có được mật độ đủ để phát hiện bằng PCR.Mật độ vi sinh vật gây bệnh hiện diện trong mẫu thực phẩm thường thấp. Các sản phẩm PCR được xác định bằng cách so với các băng băng của đối chứng dương và thang ledder 100bp.Hóa chất cần cho phản ứng PCR dễ tìm và dễ tồn trữ hơn so với trường hợp huyết thanh học. Sau đó rửa sạch bằng nước và chụp hình gel với tia UV bằng máy chụp gel. có thể tự động hóa để làm giảm chi phí phát hiện các vi sinh vật gây bệnh trong thực phẩm. việc tăng sinh là đơi giản hơn và đôi khi không cần thiết . .6.kéo dài chuỗi 720C/7 phút [Type text] [Type text] .

Elisa có thể sử dụng phát hiện và định lượng vi sinh trong thực phẩm trong thời gian vài giờ sau khi tăng sinh. Kháng nguyên (Antigen) là những chất có khả năng huy động hệ miễn dịch tiết ra kháng thể đặc hiệu với chúng gây ra phản ứng miễn dịch đặc hiệu. Khi bổ sung một cơ chất đặc hiệu enzyme vào giếng. Bằng cách theo dõi sự đổi màu.2 Các phương pháp Elisa : 2. Cấu trúc kháng nguyên:  E.2. 2.[Type text] [Type text] [Type text] này cho phép phát hiện bào tử. Kháng nguyên bao gồm protein lạ. Các kháng nguyên này sẽ được phát hiện bằng cách sử dụng kháng thể thứ cấp có gắn với enzyme như horseradish peroxidase hay alkaline phosphate. Microplate đã trở thành một công cụ tiêu chuẩn trong nghiên cứu phân tích và phòng thí nghiệm thử nghiệm lâm sàng chẩn đoán.9: Đĩa giếng (microplate) Elisa đã được sử dụng rộng rãi dưới dạng các bộ hóa chất (kit).coli có 3 cấu trúc kháng nguyên với tên gọi là O ( kháng nguyên thân). dạng tiềm sinh hay tế bào đã chết của các vi sinh vật gây bệnh hoặc gây ngộ độc. kháng nguyên này sẽ được giữ lại trên bề mặt giếng. Phương pháp ELISA 2. K (Kháng nguyên bề mặt) và H (kháng nguyên lông). Kỹ thuật này có độ nhạy phát hiện khoảng 106CFU/ml(một số báo cáo cho rằng giới hạn này có thể đạt được 104) II.1 Nguyên tắc [Type text] Page 28 .1 Nguyên tắc Sử dụng kháng thể đơn dòng phủ bên ngoài những đĩa giếng (microplate). Nếu có sự hiện diện của kháng nguyên mục tiêu trong mẫu. Hình2. Một sử dụng rất phổ biến trong các khảo nghiệm miễn dịch liên kết enzyme ( ELISA). axit nucleic. enzyme sẽ xúc tác phản ứng thủy phân cơ chất để tạo ra các phản ứng có màu hay phát sáng. một số lipit và poli saccarit. Kháng thể ( Antibody ) là protein ‫ ﻹ‬globulin được sinh ra bởi tế bào lympo tham gia phản ứng miễn dịch đặc hiệu với kháng nguyên Đĩa giếng ( microplate) là một tấm phẳng với nhiều "giếng" được sử dụng như ống nghiệm nhỏ. có thể phát hiện sự hiện diện và định lượng kháng nguyên. các cơ sở xét nghiệm chẩn đoán y tế hiện đại nhất ở người và động vật.

. kháng nguyên này sẽ được giữ lại trên bề mặt giếng. KT thứ cấp sẽ kết hợp với bất kỳ một KT còn dư (bước này có thể được bỏ qua nếu kháng thể dùng để phát hiện KN đã gắn với enzyme).Thêm KT thứ cấp (secondary antibody).Thêm dung dịch protein không tương tác (non-interacting protein) như albumin huyết thanh bê (bovine serum albumin) hay casein vào tất cả các mẫu (kể cả mẫu chuẩn). KN sẽ được cố định trên bề mặt. có thể phát hiện sự hiện diện và định lượng kháng nguyên. Nồng độ của các mẫu kháng nguyên này dùng để thiết lập đường chuẩn cho việc tính nồng độ của kháng nguyên trong các mẫu chưa biết. một số lipit và poli saccarit. .Rửa bề mặt đĩa sau đó chuyển kháng thể (biết trước) vào tất cả các giếng của đĩa. Elisa có thể sử dụng phát hiện và định lượng vi sinh trong thực phẩm trong thời gian vài giờ sau khi tăng sinh. KT sẽ kết hợp với các KN đã được cố định mà không kết hợp với protein của huyết thanh. Bước này được gọi là "blockin" do protein huyết thanh có tác dụng ngăn cản sự hấp phụ của các protein khác lên bề mặt của đĩa. [Type text] Page 29 .coli có 3 cấu trúc kháng nguyên với tên gọi là O ( kháng nguyên thân). Kháng thể ( Antibody ) là protein ‫ . Bằng cách theo dõi sự đổi màu. Khi bổ sung một cơ chất đặc hiệu enzyme vào giếng.1.2. Nếu có sự hiện diện của kháng nguyên mục tiêu trong mẫu.Chuyển KN đã biết lên bề mặt cứng ( được gọi chung là các đĩa).2 Các phương pháp Elisa : 2. ELISA gián tiếp (indirect ELISA) gồm các bước chính: . enzyme sẽ xúc tác phản ứng thủy phân cơ chất để tạo ra các phản ứng có màu hay phát sáng.2. KN chưa biết được hòa tan trong cùng một loại dung dịch đệm giống các mẫu KN chuẩn. 2. Kháng nguyên ( Antigen ) là những chất có khả năng huy động hệ miễn dịch tiết ra kháng thể đặc hiệu với chúng gây ra phản ứng miễn dịch đặc hiệu. Các kháng nguyên này sẽ được phát hiện bằng cách sử dụng kháng thể thứ cấp có gắn với enzyme như horseradish peroxidase hay alkaline phosphate. K (Kháng nguyên bề mặt) và H (kháng nguyên lông). . Kháng nguyên bao gốm protein lạ. Kỹ thuật này có độ nhạy phát hiện khoảng 106CFU/ml(một số báo cáo cho rằng giới hạn này có thể đạt được 104).2.[Type text] [Type text] [Type text] Sử dụng kháng thể đơn dòng phủ bên ngoài những đĩa giếng (microplate). .ﻹ‬globulin được sinh ra bởi tế lympo tham gia phản ứng miễn dịch đặc hiệu với kháng nguyên Elisa đã được sử dụng rộng rãi dưới dạng các bộ hóa chất (kit). axit nucleic.Chuyển các mẫu KN chưa biết vào các giếng khác. Cấu trúc kháng nguyên:  E.

[Type text] [Type text] [Type text] . tín hiệu huỳng quang. KN (nếu có) sẽ gắn với KT.Rửa đĩa. qua đó xác định sự có mặt và hàm lượng KT.2. (3) kháng thể dùng để phát hiện được thêm vào và kết hợp với KN. (8) Thêm cơ chất.Thêm cơ chất. (4) Thêm KT thứ cấp liên kết với enzyme.10: Các bước tiến hành trong Sanwich ELISA Các bước trong Sandwich ELISA. (3) Phủ mẫu chứa kháng KN cần xác định (4) Rửa đĩa. 2.. phát quang hay tín hiệu hóa điện. Nhược điểm cơ bản: Bước cố định KN không có tính đặc hiệu nên bất kỳ protein nào cũng gắn với bề mặt đĩa vì vậy KN (có nồng độ thấp) phải cạnh tranh với các protein khác trong huyết thanh khi gắn kết với bề mặt của điwax. Enzyme sẽ làm biến đổi cơ chất làm sản sinh tín hiệu huỳnh quang hay tín hiệu điện hóa học (enzyme có tác dụng như yếu tố khuyếch đại). Hình 2. Sandwich ELISA hạn chế được nhược điểm này. tín hiệu điện hóa. phần không gắn kết sẽ bị rửa trôi. (1) Phủ đĩa bằng KT (2) Thêm mẫu cần xác định KN. các kháng thể gắn enzyme còn dư sẽ được loại bỏ. Enzym sẽ biến đổi cơ chất tạo màu. kháng KN không được gắn kết sẽ bị rửa trôi (5) Thêm các KT đặc hiệu cho KN cần chẩn đoán (6) Thêm KT thứ cấp đã được gắn với enzym (KT thứ cấp đặc hiệu cho KT sơ cấp ở bước 5) (7) Rửa đĩa..2 Sandwich ELISA: Phương pháp được sử dụng để phát hiện KN trong mẫu nghiên cứu và bao gồm các bước cơ bản sau (quy trình có thể được thay đổi trong nhiều trường hợp): (1) Chuẩn bị bề mặt (microtiter) có gắn KT (2) Khóa tất cả những vị trí gắn kết không đặc hiệu trên bề mặt.2. . (9) Đo cường độ ánh sáng. KT thứ cấp sẽ gắn với [Type text] Page 30 .

(5) Thêm cơ chất. Lượng KN càng lớn. (5) Thêm cơ chất. lượng KT gắn thành công với KN trong đĩa càng thấp do "cạnh tranh". b. 0. Sữa tách bơ(casein).Kháng nguyên chuẩn.2. Lượng enzym còn dư sẽ giải phóng tín hiệu hỳnh quang hay tín hiệu màu.Microplate .conjugate (chất gắn kết) có gắn enzym peroxidase. thường là TMBZ (3. Nguyên liệu: . ủ ở nhiệt độ phòng trong 2 giờ hoặc lắc ở 37oC sau 1 giờ. Enzym sẽ làm biến đổi cơ chất và phát tín hiệu có thể phát hiện và đo được. .3. Phủ kháng nguyên 100µl kháng nguyên pha loãng ở nồng độ thích hợp được gắn trưc tiếp vào đĩa microplate. (4) Thêm KT thứ cấp (KT của KT ở bước 1). Phản ứng Elisa gián tiếp: a. Phủ đĩa bằng 200µl dung dịch sữa tách bơ 5% mỗi giếng. 2. Một số trường hợp. KT không được gắn kết sẽ bị rửa trôi. 2.2.3. hàm lượng KN gốc càng cao.Bước 1. ELISA cạnh tranh: (1) "Ủ" KT không được đánh dấu với KN. Trình tự phản ứng: . và đập khô.1.coli O157:H7 bằng phương pháp Elisa: 2. huyết thanh thỏ.[Type text] [Type text] [Type text] KT dùng để phát hiện. Rồi [Type text] Page 31 . (2) Đưa hỗn hợp này vào các giếng của vi phiếm có chứa KN.5’ tetramethybenzodine)).3. Phát hiện E. Rồi dùng dung dịch PBS( Phosphate Buffer Saline) có chứa Tween 20. (3) Rửa đĩa. Trong phương pháp này.Máy đọc phản ứng. tín hiệu sản sinh càng yếu. Đổ bỏ dung dịch có trong microplate. PBS.05% rửa đĩa 3 lần. .PBS-Tween.3’ 5. bub ∆ = trate (chất tạo màu phản ứng. KT thứ cấp gắn với enzym. enzym được gắn với KN chứ không phải KT. Đổ bỏ dung dịch có trong microplate. Thời gian ủ kháng nguyên thường là qua đêm ở nhiệt độ 4oC hoặc 37oC trong 2h.Bước 2.

2.Bước 6. . 2. và đập khô.coli O157:H7.05% rửa đĩa 3 lần. Gắn kháng thể : 100µl huyết thanh pha loãng ở nồng độ thích hợp bằng dung dịch PBS-sữa tách bơ 5%.Kháng nguyên thu hoạch như trên. để nhiệt độ phòng 15 phút. . 0.Thời gian xét nghiệm lâu.Kháng thể đơn dòng có thể chi phí nhiều hơn so với các kháng thể đa dòng. Rồi dùng dung dịch PBS( Phosphate Buffer Saline) cò chứa Tween 20. 0.Bước 5.Bước 3. Vì vậy. o Kháng thể MAB 13C4 nhận biết theo hướng nhận biết kháng nguyên độc tố Stx1 của E. . . . và đập khô.Chỉ có các kháng thể đơn dòng có thể được sử dụng như cặp phù hợp. Đổ bỏ dung dịch có trong microplate. Cơ chất tạo màu : 100µl TMB vào mỗi giếng. 0. Đổ bỏ dung dịch có trong microplate. Nhược điểm: .000 lần.coli O157:H7 o E. o Kháng thể đơn dòng đặc hiệu MAB 46E9-9 nhận biết đặc hiệu kháng nguyên lông H7 của loài E. Kháng thể ủ trong đĩa ở nhiệt độ 37 oC. . nhỏ mỗi giếng và ủ ở 37oC trong 30 phút.05% rửa đĩa 3 lần.5 Ưu điểm của phương pháp Elisa Ưu điểm: .[Type text] [Type text] [Type text] dùng dung dịch PBS( Phosphate Buffer Saline) cò chứa Tween 20.coli . . kháng thể đơn dòng đặc hiệu với các epitop của hai loại kháng nguyên này thường sử dụng để xác định vi khuẩn trong các hệ thống chuẩn đoán huyết thanh.05% rửa đĩa 5 lần. . [Type text] Page 32 .Nhanh chóng và thuận tiện .coli O157:H7 có hai loại kháng ngyên có ý nghĩa trong chuẩn đoán là 0 kháng nguyên O157 và H7. và đập khô. Rồi dùng dung dịch PBS( Phosphate Buffer Saline) cò chứa Tween 20. lắc sau 30 phút. Dừng phản ứng bằng dung dịch H2SO4 1M. Đọc đĩa trên máy đọc đĩa ELISA ở bước sóng 450 nm.Kháng nguyên của nồng độ rất thấp hoặc không biết có thể được phát hiện kể từ khi bắt giữ kháng thể chỉ lấy kháng nguyên cụ thể .4 Ứng dụng của kháng thể đơn dòng trong xác định E.Bước 4. đươc đo nồng độ protein và giữa ở nhiệt độ -20 C. lúc này phàn ứng có màu vàng. phản ứng sẽ chuyển sang màu xanh lục nếu là dương tính. Kháng thể đặc hiệu loài : 100µl conjugate pha loãng bằng PBS với độ pha loãng là 10.

Nhưng nhìn chung. Khâu cốt lõi của kỹ thuật sử dụng hạt nano silica chứa tâm màu là việc chế tạo ra được phức hợp giữa kháng thể đặc hiệu vi khuẩn đích với hạt silica phát quang bền vững. đầu dò enzym.coli bằng phức hợp kháng thể + hạt nano silica phát quang Trong số các loại vi khuẩn gây ngộ độc thực phẩm. miễn dịch học bằng enzym. Phát hiện E. xác định số lượng vi khuẩn (VK) đích bằng đường chuẩn giữa cường độ phát quang của VK gắn hạt nano và số lượng VK trong dung dịch chuẩn. Ở Việt Nam. Để khắc phục nhược điểm nêu trên. đếm khuẩn lạc trên đĩa thạch. Cường độ phát huỳnh quang là hàm số f của số lượng tế bào vi khuẩn đích trong mẫu. tiến hành kiểm tra các tính chất sinh hóa và ngưng kết đặc hiệu để khẳng định là E. tiến hành kỹ thuật miễn dịch huỳnh quang để phát hiện và xác định số lượng vi khuẩn đích.[Type text] [Type text] [Type text] - Enzyme / chất nền phản ứng trong microwells phải được đọc càng sớm càng tốt 3. người ta đã và đang ứng dụng các loại vật liệu nano phát quang như hạt silica chứa tâm màu hay chấm lượng tử QD chứa các nhóm chức năng sinh học trên bề mặt như một chất đánh dấu huỳnh quang để phát hiện nhanh và chính xác số lượng vi khuẩn gây bệnh thực phẩm bằng kỹ thuật miễn dịch huỳnh quang. Phương pháp phát hiện E. Tuy nhiên. Người ta đã sử dụng nhiều phương pháp khác nhau để phát hiện chúng như: đếm tế bào dưới kính hiển vi. càng nhiều cầu nối trung gian giữa kháng thể và hạt nano chứa tâm màu phát quang càng làm cho phức hợp bền vững hơn và kháng thể không mất hoạt tính lâu hơn.coli O157:H7. sử dụng SMCC làm xúc tác tạo cặp sulfhydryl-amine. ELISA. hiện nay có 5 cách để tạo ra phức hợp này là: gắn kết trực tiếp thông qua liên kết amine–carboxylic. xác định khuẩn lạc nghi ngờ E. gắn kết không hóa trị của hạt nano silica được bọc streptavidin với các kháng thể được biotin hóa biotinylated.coli O157:H7 trên đĩa thạch SMAC sau khi ủ ấm ở 37oC trong 24 giờ. Phức hợp hạt nano silica + kháng thể đặc hiệu có thể được tạo ra bởi nhiều cơ chế khác nhau. Có nhiều cách phát hiện vi khuẩn đích như: quan sát và đếm trực tiếp các tế bào vi khuẩn phát quang dưới kính hiển vi huỳnh quang. các nhà khoa học đã chế tạo thành công công thức phức hợp kháng thể đặc hiệu vi khuẩn đích + hạt nano silica băng cách găn trực tiếp các phân tử kháng thể lên bề mặt hạt silica thông qua liên kết amine-carbonxylic với sự có mặt của chất xúc tác EDAC (1-Ethyl-3-(3-dimethylaminopropyl carbodiimide hydrochloride) [Type text] Page 33 . gắn kết các peptide được gắn histidine hoặc các kháng thể lên các chấm lượng tử được Ni-NIA hóa. gắn kết trực tiếp thông qua các nhóm carbon-hydrate bị oxy hóa trên phần Fc của kháng thể. E.coli O157:H7 trong thực phẩm mang tính pháp lý ở Việt Nam là sử dụng kỹ thuật làm giầu. Sau khi tạo được phức hợp kháng thể đặc hiệu + hạt nano silica. Từ những khuẩn lạc nghi ngờ. Mỗi kiểu gắn kết có những ưu điểm và hạn chế riêng.coli O157:H7 được xem là rất nguy hiểm với liều gây độc thấp (10-100 tế bào). tất cả các phương pháp nêu trên đều không thể phát hiện chính xác số lượng vi khuẩn ở nồng độ thấp. kít chuẩn PCR.

thời gian phát hiện nhanh hơn các phương pháp thông thường nhiều lần. coli O157:H7 được bao bọc bởi phức hợp kháng thể + hạt silica Ảnh 2: SEM E. (c) VK gắn với phức hợp kháng thể . tỉ lệ vi khuẩn đích gắn phức hợp và phát quang đạt > 60% và sau 3 ngày vẫn phức hợp vẫn giữ nguyên hoạt tính.Silica. 1. Phức hợp kháng thể và hạt silica được tạo thành này có khả năng nhận biết và liên kết đặc hiệu với vi khuẩn đích E. tỉ lệ kháng thể với hạt silica là 40/1. 2. Ảnh 1: TEM E.QDs [Type text] Page 34 . nhiệt độ ủ ở 300C. coli O157:H7 trong vòng 20 phút. thơi gian phản ứng hợp sinh 3 giờ có lắc ngang . Giới hạn phát hiện của kỹ thuật này đối vối vi khuẩn đích là 102 CFU/ml. Qua đó có thể khẳng định các hạt nano silica hợp sinh với kháng thể vẫn giữ nguyên tính chất phát quang hiệu quả và các phân tử kháng thể khi gắn với hạt nano silica vẫn giữ được hoạt tính và có khả năng nhận biết và liên kết với vi khuẩn đích Ảnh huỳnh quang: (a) phức hợp hạt nano silica – kháng thể.coli O157:H7 được đánh dấu bởi phức hợp kháng thể + hạt nano silica đã chứng minh rằng phức hợp này có thể bao bọc đều hoàn toàn và như nhau lên bề mặt tế bào vi khuẩn. (b) VK gắn với phức hợp kháng thể .[Type text] [Type text] [Type text] trong các điều kiện sau: EDAC/1 phản ứng là 0. coli O157:H7 được bao bọc bởi phức hợp kháng thể + hạt silica Hình ảnh SEM (kính hiển vi quét) và kính hiển vi đồng tiêu của tế bào E.9mg.

số lượng E.[Type text] [Type text] [Type text] Phổ huỳnh quang của phức hợp hạt silica – kháng thể gắn kết với vi khuẩn E. coli O157:H7. Đây là cơ sở để xây dựng đường chuẩn: cường độ phổ . Viền màu đỏ bao bọc xung quanh tế bào vi khuẩn là phức hợp hạt silica + kháng thể đặc hiệu [Type text] Page 35 . coli O157:H7: chụp bằng kính hiển vi đồng tiêu Nikon C1plus – Ti-E.coli O157:H7 để phát hiện nhanh. nhậy số lượng vi khuẩn này ở mật độ thấp Ảnh huỳnh quang phức hợp Silica – E.

[Type text] [Type text] [Type text] KẾT LUẬN Hiện nay. theo dõi khảo sát đảm bảo vệ sinh an toàn thực phẩm để hạn chế sự ô nhiễm và tác hại của vi khuẩn trong quá trình thu hoạch các sản phẩm nông nghiệp. ngộ độc thực phẩm đã trở thành mối quan tâm của toàn xã hội. chăn nuôi. Trong thực tế cuộc sống. Một trong những loại ngộc độc thực phẩm gây ra bởi vi sinh vật thường gặp là ngộ độc thực phẩm do vi khuẩn E. Do đó các phương pháp phát hiện vi khuẩn E.coli có vai trò quan trọng trong nhiệm vụ đảm bảo vệ sinh an toàn thực phẩm nhằm làm giảm tỷ lệ ngộ độc do vi khuẩn gây nên. Ngộ độc thực phẩm thường xảy ra do nguyên liệu dùng chế biến hay thực phẩm bị nhiễm vi khuẩn và độc tố của vi khuẩn. Có nhiều nguyên nhân gây ra các vụ ngộ độc thực phẩm nhưng phần lớn các trường hợp có nguồn gốc từ vi sinh vật.coli. đánh bắt hải sản đến quá trình ‘bảo quản chế biến và nấu nướng tới tay người tiêu dùng thường rất phức tạp và gặp nhiều khó khăn. [Type text] Page 36 .

Trước khi bổ sung thuốc thử có thể bổ sung 1ml ether hoặc xylene vào ống nghiệm. Đọc kết quả [Type text] Page 37 . (-) là Serratia marcescens. Nhỏ 5 giọt thuốc thử vào ống dịch nuôi cấy. Sinh khối chủng thuần được cấy vào ống môi trường lỏng thuộc một trong các loại nêu trên. Viêc phát hiện indol được thực hiện bằng phản ứng của phân tử này với các thuốc thử chứa p-Dimethylaminobenzaldehyde (p-DMABA). Pasteurella multocida (+) và P. Bacillus alvei (+) với các Bacillus khác (thường là -). Phản ứng trung gian chính của phản ứng oxi hóa tryptophan là indolpyruvic acid IPA. lắc đều để chiết tách indol lên lớp dung môi hữu cơ. THỬ NGHIỆM SINH HÓA 1. ủ ở nhiệt độ 370C trong 24-48 giờ. theo dõi sự tạo màu đỏ trong lớp dung môi hữu cơ.urea (-). Phương pháp tiến hành Môi trường sử dụng cho thử nghiệm này có thể là nước tryptone. Thử nghiệm sinh indol a.haemolytica (-) và P. hai loại thuốc thử có thể sử dụng cho thử nghiệm này là thuốc thử Kovacs và thuốc thử Erlich. Nhân pyrrol của indol chứa nhóm CH2 sẽ kết hợp với nhân benzene của p-DMABA tạo nên một phức chất dạng quione màu đỏ. hoặc các môi trường kết hợp như MIU (Motility Indol Urea). Heamophilus heamoglobinophilus (+) và H. Thử nghiệm này được dùng để phân biệt E.[Type text] [Type text] [Type text] PHỤ LỤC I. Phân tử này sau đó bị biến đổi theo hướng loại nhóm amin (deamination) thành indol hay theo hướng loại nhom1carboxyl (decarboxylation) thành skatol. Chủng dùng làm đối chứng (+) cho thử nghiệm này là Proteus rettgeri.coli (+) với Klebsiella (-). Nguyên tắc Trytophan là một acid amin có thể bị oxi hóa bởi một số vi sinh vật có hệ enzyme trytopanse tạo nên các sản phẩm chúa gốc indol.influenzae (-) với các loài Haemophilus khác (thường là -). b. Trytophanase xúc tác phản ứng loại nhóm amin để tạo thành indol. SIM (Sulfide Indol Motility)… khi cần kiểm tra cùng lúc nhiều đặc tính sinh hóa cần thiết. để yên vài phút. Proteus mirabilis (-) với các loài Proteus khác (+).pneumotropica (+) với P. c.

tạo ra. lactose) và khả năng sinh H2S của chủng vi sinh vật Về nguồn carbon. sử dụng các glucose và lactose. thì pepton được sử dụng để biến dưỡng thu năng lượng và vật chất cấn cho sự tăng trưởng của vi sinh vật.Nếu vi sinh vật không sử dụng được cả hai nguồn carbon này. TSI a. Khả năng sử dụng cà hai nguồn đường là glucose và lactose hay chỉ sử dụng glucose để thu lấy năng lượng cần cho tăng trường là tùy thuộc vào di truyền của chủng vi sinh vật và có thể được theo dõi trên ống thạch chứa môi trường KIA. Điều này có thể được giải thích là lượng glucose trong phần bề mặt của môi trường được vi sinh vật oxi hóa hoàn toàn thành H2O và CO2 để thu năng lượng. Tương tự. Nguyên tắc Môi trường KIA (Ligler Iron agar) và môi trường TSI (Triple Sugar iron Agar) được sử dụng để kết hợp thử nghiệm đồng thời khả năng sử dụng các nguồn carbon khác nhau (glucose. đôi khi có sự xuất hiện của màu cam do skatol.Nếu vi sinh vật chỉ lên men glucose. có ba trường hợp có thể xảy ra đối với sự tăng trưởng của chủng vi sinh vật thử nghiệm: chỉ sử dụng glucose. . . sau 18-24 giờ nuôi cấy môi trường bề mặt của ống thạch nghiêng trở nên có pH kiềm và phần sâu trong ống có pH acid. [Type text] Page 38 . nếu trong môi trường có chất chỉ thị là đỏ phenol thì trên mặt thạch nghiêng sẽ có màu đỏ và phần sâu có màu vàng. . môi trường TSI có thành phần như môi trường KIA nhưng có them 1% sucrose (saccharose). ở phần sâu trong môi trường mới có điều kiện oxi không đầy đủ. 2. Ngược lại. Thử nghiệm KIA.Nếu vi sinh vật có thể sử dụng cả glucose và lactose. sau 18-24 giờ nuôi toàn bộ môi trường đều trở nên có pH acid vì sự biến dưỡng đồng thời cá glucose và lactose ở bề mặt môi trường giúp vi sinh vật đủ năng lượng để tăng trưởng mà không cần phải sử dụng đến pepton. môi trường KIA chứa hai loại đường là 1% lactose và 0. Khi chủng cấy lên môi trường này. Khả năng này của vi sinh vật có thể được xác định thong qua sự đổi màu của chỉ thị pH trong môi trường ở trên bề mặt và bên trong môi trường trong ống thạch nghiêng. vi sinh vật tiến hành dị hóa pepton trong môi trường qua đó giải phóng NH3 làm phần bể mặt của môi trường mới có pH kiềm. glucose được lên men kỵ khí sinh ra các acid hữu cơ làm giảm pH của môi trường.[Type text] [Type text] [Type text] Thử nghiệm là (+) khi có sự xuất hiện của lớp màu đỏ trên bề mặt môi trường.1% glucose. là tiền chất methyl hóa của indol. không sử dụng cà hai loại đường này. là (-) khi có lớp màu vàng của thuốc thử trên bề mặt môi trường. Để đáp ứng nhu cầu năng lượng cho tăng trưởng.

3. b. Thử nghiệm khả năng sinh H2S có thể thực hiện đồng thời trên hai môi trường này do thành phần môi trường có chứa sodium thiosulphate. Sau khi cấy giống. nếu sự lên men được tạo ra các sản phẩm khí thì khí sẽ tích tụ bên trong thành bọt khí hay sẽ làm vỡ thạch. phần môi trường sâu trong ống nghiệm sẽ không có hiện tược đổi màu. Vi sinh vật khử sulfate có thể khử hợp chất này để giải phóng H2S tạo ra sẽ được phát hiện dựa vào phản ứng tạo kết tủa màu đen FeS giữa H2S và ion Fe2+ của chỉ thị ferric ammonium citrate hiện diện trong môi trường. sự tạo thành màu nâu bởi FeS. sau đó ria trên bề mặt thạch nghiêng.Thử nghiệm sinh H2S: thử nghiệm là (+) nếu xuất hiện tủa màu nâu đen bên trong môi trường. hấp khử trùng và chuyển vào các ống thạch nghiêng sao cho đỉnh thạch nghiêng cách nắp ống nghiệm khoảng 2. do pepton chỉ được biến dưỡng trong điều kiện hiếu khí nên hiện tượng kiềm hóa môi trường chỉ diển ra trên phần của bề mặt môi trường và chỉ phần này trở nên có màu đỏ. c. Ghi nhận màu. Nguyên tắc Thử nghiệm MR nhằm phân biện vi sinh vật dựa trên sự khác biệt về khả năng tạo ra và duy thì các sản phẩm biến dưỡng có tính acid bền trong môi trường trong quá trình lên men glucose. Chỉ thị đỏ methyl red giúp phân biệt nồng độ ion H + hiện diện trong môi trường sau khi vi sinh vật lên men glucose. Trong khi đó. Trường hợp sử dụng môi trường TSI. Chỉ thị này có màu thay đổi khác nhau tùy dãy pH hay nồng đô ion H+: đỏ khi ph thấp hơn 4.[Type text] [Type text] [Type text] Tuy nhiên. Đọc kết quả . là (-) nếu không xuất hiện tủa nâu đen. Phương pháp tiến hành Môi trường KIA hay TSI được pha chế.5cm.4 màu cam trong vùng pH [Type text] Page 39 . các ống thạch nghiêng được ủ ở 370C từ 18-24 giờ. sự sinh khí ở phần sâu.Thử nghiệm khả năng sử dụng đường: xem mục nguyên tắc. Thử nghiệm MR (Methyl Red) a. dung que cấy thẳng cấy sinh khối từ khuẩn lạc của chủng thuần vào phần sâu của ống thạch nghiêng nhưng tránh chạm đáy ống. màu ở mặt thạch nghiêng. các hiện tượng lien quan đến sử dụng nguồn carbon cũng xảy ra tương tự.5cm và phần sâu có chiều cao khoảng 2. . Trong các trường hợp nêu trên.

coli (+) với Klepsiella (-). Them vài giọt thuốc thử methyl red (0. cần tiếp tục ủ ống môi trường có giống trong 4 ngày và thục hiện lại thử nghiệm. Phương pháp tiến hành Thử nghiệm được tiến hành trong các ống môi trường lỏng Glucose Phosphate (MR-VP broth). khi héo dài thời gian nuôi cấy. ủ ở 370C trong khoảng 2-5 ngày. Hàm lượng ion H + này phụ thuộc vào tỷ lệ CO2 và H2và con đường chuyển hóa đường của từng loài vi sinh vật. Đối với các vi sinh vật đường ruột.0 – 5. thời gian nuôi cấy để thử nghiệm phản ứng MR thường được xác định trpong khoảng 18-24 giờ. Trường hợp màu cam. Thử nghiệm VP (Voges-Prokauer) a. 4. c.02% trong hỗn hợp cần nước có tỷ lệ 3:2. đọc kết quả ngay. sau đó pyruvic acid tiếp tục được chuyển hóa theo các con đường sinh hóa khác nhau tạo ra các sản phẩm lên men cuối cùng khác nhau.0. Tuy nhiên các vi sinh vật này đều tạo acid trong môi trường ngay khi chúng bắt đầu tăng trưởng. b. ngược lại. màu vàng khi pH trên 6. Họ Enterbacteriaceae có đặc tính [Type text] Page 40 . xác định Listeria monocytogenes (+). trường hợp các vi sinh vật cho phản ứng MR(-) sẽ tiếp tục chuyển hóa các sản phẩm có tính acid đã được tạo ra thành các sản phẩm trung tính làm cho pH trong môi trường chuyển dần về phía trung tính. các vi sinh vật có phản ứng MR (+) có đặc tính là tích lũy acid trong môi trường ngày càng nhiều hơn và độ pH trong môi trường ngày càng giảm. Enterbacter aerogenes (-) với Enterbacter cloacae (+).8. là (-) khi có màu vàng. (-) là Serratia marcescens. (+) với các loài Bacillus Gram âm khác không thuộc đường ruột (-). bảo quản ở 40C) vào trong ống nghiệm dịch nuôi cấy. Nguyên tắc Ở vi sinh vật. Chủng dùng làm đối chứng (+) cho thử nghiệm này là Proteus rettgeri.[Type text] [Type text] [Type text] 5. Thử nghiệm này giúp phân biệt E. Yersinia spp. Đọc kết quả Thử nghiệm MR là (+) khi môi trường có màu đỏ sau khi bổ sung thuốc thử. Để khôi phục dự trữ NAD+ trong tế bào phục vụ cho con đường đường phân. ở các loài vi sinh vật. Dung que cấy vòng cấy một lượng nhỏ sinh khối từ khuẩn lạc chủng thuần trên môi trường KIA. Thử nghiệm MR phụ thuộc rất nhiều vào thời gian nuôi cấy và thường được tiến hành trong thời gian khoảng 3-5 ngày ở 370C. biến dưỡng năng lượng bằng phương thức lên men từ glucose qua con đường đường phân sẽ tạo ra chất trung gian chủ yếu là pyruvic acid.

Ngoài ra. 2. Ủ yên các ống môi trường này ở 370C trong 20-48 giờ hoặc đến 10 ngày khi cần thiết. . Thử nghiệm VP được dung để phân biệt Klebsiella pneumonia (+) và Enterbacter (+) với E. ethanol. chất này tham gia vào phản ứng tạo màu trong thử nghiệm VP. dung dịch B là 40% KOH hoặc NaOH. Dùng que cấy vòng cấy vào các ống môi trường MRVP một ít sinh khối ( trường hợp dùng thuốc thử Koblenntz như dưới đây thì cấy nhiều sinh khối) từ khuẩn lạc của chủng thuần đã ủ 18-24 giờ trên môi trường KIA hoặc TSI.3% creatine 40% KOH hoặc NaOH. khi có oxi và pH kiềm. Sự oxi hóa acetion thành diacetyl được tăng cường nhờ xúc tác của α-napthol. Diacetyl kết hợp với nhân guanidine có trong pepton kết tụ thành phức diacetyl-guanidine có màu đỏ. H2 và CO2.Thuốc thử O’Meara: dung dịch 0.3-bute\anediol dehydrogenase. acid succinic. Phân tử 2. dung dịch B là 0.3butanediol (ví dụ như E. Như vậy. thử nghiệm VP có thể giúp phân biệt các loài trong Enterbacteriaceae dựa trên sự oxi hóa acetion (acetylmethylcarbinol. Phương pháp tiến hành Môi trường được sử dụng cho thử nghiệm VP là môi trường lỏng Clark-Lubs (môi trường MR-VP). để xác định Listeria monocytogenes (+). họ này có thể được chia thành hai nhóm là nhóm không sinh 2.3-butanediol do hoạt tính của enzyme diacetyl reductase. AMC) từ 2.3-butanediol (ví dụ như Klebsiella. (-) là Proteus rettgeri.3% creatine 40% KOH hoặc NaOH. có pH 6. [Type text] Page 41 . Sau thời gian ủ.Thuốc thử Koblentz: gồm dung dịch A là 5% α-napthol trong cồ 95%. trường hợp nghi ngờ nên tiến hành ủ các ống môi trường song song ở hai điều kiện nhiệt độ. . phân biệt một số loài của Klebsiella. acetoin còn bị oxi hóa thành diacetyl.3-butanediol bị oxi hóa thành aceton nhờ xúc tác của enzyme 2.Thuốc thử Barrit: gồm dung dịch A là 5% α-napthol trong cồn tuyệt đối.coli (-). Chủng dùng làm đối chứng (+) cho thử nghiệm này là Serratia marcescens. 2. đến lượt mình acetion bị oxi hóa thành diacetyl.3-butanediol bị chuyển hóa thành acetion. Trong thuốc thử Koblentz và O’Meara có chứa creatime có tác dụng bổ sung nguồn nhân guanidine. có 3 loại thuốc thử VP là: . bổ sung thuốc thử trực tiếp vào ống môi trường.(.3-butanediol có thể chuyển hóa qua lại thành aceton: trong điều kiện có oxi và môi trường có tính kiềm. acid acetic. ngược lại.[Type text] [Type text] [Type text] chung là lên men sinh hỗn hợp acid như acid formic. Do vậy. Enterobacter). Nhu vậy. b. một số loài như Enterobacter hafniae có kết quả thử nghiệm VP không ổn định ở 370C nhưng cho (+) ở 25-300C.3-butanediol thành diacetyl. acetoin có thể bị khử thành 2.coli) và nhóm sinh 2.

Enterbacter (+) với E. c. Ở pH acid. bổ sung 1ml thuốc thử vào ống môi trường. Đọc kết quả sau 20 phút hoặc chậm nhất 4 giờ. Trước khi sử dụng nên kiểm tra thuốc thử bằng các chủng đố chứng như E. Thử nghiệm này được dùng để phân biết nhóm Klebsiella.[Type text] [Type text] [Type text] Khi sử dụng các loại thuốc thử có 2 thành phần. Phương pháp tiến hành Môi trường sử dụng cho thử nghiệm khả năng biến dưỡng citrate là môi trường rắn Simmons Citrate Agar (CSA) hay môi trường Christensens Citrate Sulfide Agar (CCSA). Như vậy sự biến dưỡng citrate bởi vi sinh vật sẽ tạo ra CO2 làm kiềm hóa môi trường. Đọc kết quả Thử nghiệm VP là (+) khi có màu đỏ trên bề mặt môi trường. Thử nghiệm khả năng biến dưỡng citrate a. đối với thuốc thử 1 thanh2n phần. Sản phẩm biến dưỡng citrate thay đổi tùy pH của môi tường. lượng acetate cà formate tạo thành sẽ tăng trong khi lactate và CO 2 giảm. trước tiên nhỏ 6 giọt dung dịch A. b. Ở pH trung tính sản phẩm chủ yếu là COP2 và acetate. Nguyên tắc Một số vi sinh vật có khả năng sử dụng citrate làm nguồn carbon duy nhất để thu lấy năng lượng và vật chất. sau đó nhỏ 2 giọt dung dịch B. Chủng dùng làm đối chứng (+) cho thử nghiệm này là Proteus rettgeri. [Type text] Page 42 . khi pH tăng. sản phẩm tạo ra chủ yếu là acetoin và lactate. khả năng tăng trưởng của chủng sẽ thể hiện qua khả năng biến dưỡng nguồn carbon citrate và nguồn đạm ammonium làm tăng giá trị pH của môi trường.coli (VP-) và Enterobacter cloacae (VP+).coli (-) trong thử nghiệm IMViC. hoặc để phân biệt Edwardsiella (-) với Salmonella (+). là (-) khi bề mặt môi trường không đổi màu. Sự phân giải của muối ammonium dùng làm nguồn đạm trong môi trường sẽ sinh NH3 làm kiềm hóa môi trường. sự biến dưỡng citrate thường thong qua sự kết hợp với acetylCoA thành oxaloacetate để vào chu trình tricarboxylic acid (chu trình Krebs). (-) là Staphylococcus epidermidis. Như vậy trong môi trường thử nghiệm khả năng sử dụng citrate làm nguồn carbon duy nhất có chứa đạm ở dạng muối ammonium. Mặt khác mọi vi sinh vật có khả năng sử dụng citrate làm nguồn carbon duy nhất đều có khả năng dùng muối ammonium làm nguồn đạm duy nhất. lắc nhẹ ống 1 phút để oxi hóa acetone. môi trường chuyển sang kiềm. 5. Sự gia tăng giá trị pH này được chỉ thỉ bằng sự đổi màu của chỉ thị pH trong môi trường.

Chủng vi sinh vật được cấy và ủ trong điều kiện tương tự như trường hợp môi trường CSA. Rót vào mỗi ống nghiệm có chứa ống Durham 10ml môi trường BGBL.4. . EC Broth ( Canh EC) Trypticase or tryptose Muối mật No.4) trở thành màu đỏ.3 [Type text] 20 g 1. Chủng thuần trên môi trường KIA hoặc môi trường thích hợp khác được cấy ria trên bề mặt môi trường CSA rắn trong ống thạch nghiêng. Đọc kết quả . trộn đều 3 dung dịch đạt thể tích cuối là 1 lít. chỉ thị bromothymol blue. thử nghiệm la (+) khi xuất hiện khuẩn lạc và môi trường chuyển sang màu xanh dương.0133 g 1 lít Hòa tan peptone và lactose vào trong 500ml nước cất.9. II.5 g Page 43 . (-) khi môi trường không đổi màu.[Type text] [Type text] [Type text] Môi trường CSA chứa sodium citrate hoặc potassium citrate làm nguồn carbon duy nhất.6.2 ± 0. chỉ thị màu là phenol red.7. ống thạch được ủ ở 35 0C trong 24-48 giờ hoặc kéo dài đến 4 ngày khi cần thiết. c.8). pH 6.Trường hợp môi trường CSA. Brilliant Green Bile Lactose Broth (canh BGBL) Peptone Lactose Mật bò Brilliant green Nước cất 10 g 10 g 20 g 0. Môi trường CCSA chứa nguồn đạm là cystein. (-) khi không có khuẩn lạc và môi trường giữ nguyên màu xanh lục. mật bò vào trong khoảng 200ml và brilliant green trong khoảng 100ml nước cất. Môi trường chưa sử dụng có màu thay đổi từ màu kem đến nâu.Trường hợp môi trường CCSA. 2. pH 6.2 ở 250C. MỘT SỐ MÔI TRƯỜNG VÀ THUỐC THỬ THÔNG DỤNG 1. thử nghiệm là (+) khi môi trường chuyển sang màu đỏ. chinh pH môi trường khoảng 7. Hấp ở 1100C trong 15 phút.0 màu xanh lục ở pH trung tính và màu xanh dương ở ph lớn hơn 7. màu chỉ thị trở thành vàng và ở pH kiềm (trên 8. pH 7. Chỉ thị này có màu vàng ở pH dưới 6. Ở pH acid (dưới 6.

015 g 1000.0 ml Điều chỉnh pH tới 7.9 ± 0. Tiệt khuẩn 5 phút ở 1210C.5 g 5 g 1 lít Rót môi trường vào ống nghiệm có chứa ống Durham. cứ mỗi bình 30ml. 3. Canh thang EE Peptone Glucose Disodium hydrogen phosphate Potassium dihydrogen phosphate Ox bile Brilliant green Nước cất 10. Tiệt khuẩn 15 phút ở 1210C 5.0 g 0.0 g 8.0 g 5.0 g 5. 4.[Type text] [Type text] [Type text] Lactose K2HPO4 KH2PO4 NaCl Nước cất 5 g 4 g 1.0.0 g 5.2.2.0 ml 3.225 g Page 44 . Hấp ở 1210C trong 15 phút.0 g 20.0 g 0. Canh thang dinh dưỡng Beef extract Peptone Nước cất Điều chỉnh pH tới 7. chia ra bình.0 g 2. pH 6.0 g 1000. Canh thang KCN Proteose peptone Sodium chloride Potassium dihydrogen phosphate [Type text] 3.

Canh thang MacConkey Peptone Lactose Ox gall Bromocresol purple Nước cất 20. phân vào bình tam giác.0 g 0.0 g 1.0 ml Page 45 . mỗi ống 10 ml với ống Durham lộn ngược. cho thêm 15 ml cyanid 0.0 g 2.0 g 1000.3.0 ml Điều chỉnh pH tới 7.75 g 2.0 g 5. Tiệt khuẩn 10 phút ở 1210C.8.0 g 5.0 g 10.0 g 0. mỗi ống 1 ml.0 ml Điều chỉnh pH tới 7. để nguội và cho vào tủ lạnh 580C. Tiệt khuẩn 15 phút ở 1210C. 8.75 g 5. Bằng cách vô khuẩn và thận trọng.0 ml Điều chỉnh pH tới 6. 7. tryptone hoặc trypticase Lactose Dipotassium monohydrogen phosphate Potasssium dihydrogen phosphate Sodium chloride Sodium lauryl sulphate Nước cất 20. Diệt khuẩn 15 phút ở 1210C. Phân ra ác ống nghiệm. đóng nút bằng nút bần thấm perafin và bảo quản ở 5-60C.5% lạnh (5-80C) lắc nhẹ nhàng và phân ra ống nghiệm .6.1 g 1000.[Type text] [Type text] [Type text] Nước cất 1000. mỗi bình 225 ml. Canh thang Nitrate Meat extract Peptone Potassium nitrate Nước cất [Type text] 3. Canh thang L-ST Tryptose.0 g 5. 6.01 g 1000.

0 ml Điều chỉnh pH tới 7.0 g 5.0 5.1-7. 11. mỗi ống 5 ml.0 g 1000.0 ml Điều chỉnh pH 7. phân ra các ống nghiệm có ống Durham .0 10. Tiệt khuẩn 15 phút ở 1210C.0 phân ra các ống nghiệm đường kính 16mm. phân ra ống nghiệm.0 g 1. Lauryl Sulphate Broth LSB (canh Lauryl Sulphate) Trytose Lactose Sodium chloride K2HPO4 KH2PO4 Lauryl sulphate Nước cất 20 g 5 g 5 g 2.2. 9.75 g 0.8 ± 0.0.2. 10.1 g 1 lít Hấp ở 1210C trong 15 phút.75 g 2.[Type text] [Type text] [Type text] Điều chỉnh pH tới 7. Tiệt khuẩn 15 phút ở 1210C. Tiệt khuẩn 15 phút ở 1210C. pH môi trường là 6.0 10.0 g g g g 1000. Môi trường Indol Tryptone Sodium chloride DL-trytophan Nước cất 10. [Type text] Page 46 . Môi trường lên men carbohydrate Meat extract Peptone Sodium chlotide Chỉ thị Nước cất 3.

pH cuối 6.[Type text] [Type text] [Type text] Glucose.0 ml Điều chỉnh pH tới 6.0 g 2. Đường cho vào môi trường cơ bản phải diệt khuẩn trước .0 g 1000. Đun sôi 1 – 2 phút cho đến khi hòa tan. Simmon Citrate Agar Sodium citrate NaCl K2HPO4 NH4H2PO4 MgSO4 Bromothylmol blue Agar Nước cất 2 g 5 g 1 g 1 g 0.8 ± 0.08 g 15 g 1 lít Đun nhẹ và thỉnh thoảng lắc.Peptone Lactose Dipotassium hydrogen phosphate Agar Nước cất [Type text] 10. Môi trường VP Peptone Glucose Dipotassium hydrogen phosphate Nước cất 7. hấp ở 1210C trong 15 phút.9 và lọc. 13.0 g 5. Đặt nghiêng ống nghiệm. sucrose … đậm độ dùng cuối cùng là 1%.0 g 1000. 12.0 ml Page 47 .0 g 5. 14. lactose. Tiệt khuẩn 20 phút ở 1150C.2 g 0. trừ disaccharide phải tiệt khuẩn bằng lọc hoặc ở 1210C trong 10 phút và cho vào môi trường cơ bản đã tiệt khuẩn trước. Thạch L-EMB a.2.0 g 10.0 g 15. Phân phối vào 1/3 ống nghiệm có nắp 1 x 100 hoặc 16 x 150mm.

pentahydrate Trisodium citrate dihydrate Sodium cholate Ox-gall Sodium chloride (NaCl) Ferric citrate Bromothymol blue 10.001 g 1000.4 g 0. 16.0 g 1.3 ml dung dịch methylen blue 0.2.[Type text] [Type text] [Type text] b. Đun chảy trước khi dùng. và cứ 100ml cho thêm 2ml dung dịch eosin Y 2% và 4.04 g [Type text] Page 48 .0065 g Pha dung dịch a. Thạch MacConkey Peptone Lactose Bile salts Sodium chloride Agar Neutral red Crystal violet Nước cất 20.0 g 10.5 g 5.0 g 15.0 g 20.1.0 g 0.15% 15. Thạch TCBS Peptone Yeast extract Sucrose Sodium thiosulphate.0 g 10.1-7.0 g 0. điều chỉnh pH tới 7.0 g 3.Tiệt khuẩn 15 phút ở 1210C. Rót ra đĩa petri.0 ml Điều chỉnh pH tới 7. Tiệt khuẩn 15 phút ở 1210C.0 g 10.0 g 1.Eosin Y Methylen blue 0. Chia ra từng bình 100ml.0 g 10.03 g 0.0 g 5.0 g 5.

mỗi ống 10 ml.2 Hòa tất cả các thành phần trên trong nước cất.0 g 1000. Không tiệt khuẩn bằng hấp ướt.0 g 5. Đun nhỏ lửa và khuấy liên tục để cho tan thạch.0 ml 8.04 g 15.0 ml Điều chỉnh pH tới 7. Nguội tới 500C và rót ra đĩa Petri. Tiệt khuẩn 10 phút ở 1210C. Peptone Glucose Soium chloride [Type text] . để nghiêng phần thạch ở đáy ống cao 2.4. Đĩa môi trường để ở 40C dùng trong 24h (ISO 1990).024 g 12. 17.6 ± 0.0 g 0.3 g 0.0 g 1.3 g 0.0 g 10. Thạch TSI Meat extract Yeast extract Peptone Sodium chloride Lactose Sucrose Glucose Ferri citrate Sodium thiosulphate Phenol red Agar Nước cất 3.0 g 20. phân ra các ống nghiệm.5 cm.0 g 3.0 g 5. 18.0 g 10. Thạch urê 1.0 g 1000.[Type text] [Type text] [Type text] Thymol blue Agar Nước cất pH 0.0 g Page 49 a.0 g 1.

công them NaCl vào để nồng độ cuối đạt 2 – 3%.0 g 1000. 20. Cho 50 ml b) vào 950 ml a) ở điều kiện vô khuẩn.0 g 1000. điều chỉnh pH tới 6. Urea Nước cất vừa đủ 2. phân phối vào các erlen.002 g 15 g Page 50 . Ưa muối.0 ml 400.3 ± 0. mỗi ống 10 ml và để nghiêng.0 g 0. Để sử dụng cho các chủng Vibrio spp.[Type text] [Type text] [Type text] Potassium hydrogen phosphate Phenol red Agar Nước cất Tiệt khuẩn trong 2 phút ở 1210C b. Violet Red Bile Agar (VRBA) Cao nấm men Peptone hoặc gelysate NaCl Muối mật Lactose Neutral red Crystal violet Agar [Type text] 3 g 7 g 5 g 1. phân ra các ống nghiệm. Hấp khử trừng 15 phút ở 1210C.5 g 10 g 0. pH cuối 7.0 ml Tiệt khuẩn bằng lọc. 19.8.03 g 0.012 g 15. Trypticase (Tryptic) Soy Agar (TSA) Trypticase peptone Phytone peptone NaCl Agar Nước cất 15 g 5 g 5 g 15 g 1 lít Đun nóng để hòa tan agar.2.

Thuốc thử methyl red Methyl red Ethanol 95% Nước cất (đủ) 0. Đun sôi trong 2 phút. điều chỉnh về pH 7. có thể thay thế isoamyl alcohol bằng amyl alcohol hoặc butanol. Thuốc thử kovacs p. 22. 21. bổ sung và khuấy từng phần nhỏ HCl cho đến khi đủ lượng.10 g 300 ml 500 ml Hòa tan đỏ methyl vào 300ml ethanol. thuốc thử được chứa trong chai màu tối tránh ánh sang ở 40C. Sử dụng làm trong môi trường đổ đĩa.4 ± 0.Dimethylaminobenzalhehyde (p-DMABA) Isoamyl alcohol HCl đậm đặc 10 g 150 ml 50 ml Hòa tan p-DMABA trong dung môi.2. Them nước cất vào cho đủ thể tích 500ml [Type text] Page 51 .[Type text] [Type text] [Type text] Nước cất 1 lít Hòa tan các thành phần trong nước. không hấp khử trùng.

2006. 1995. Trần Linh Thước. J. James.Travis Littledike. 5. Simultaneous Identification of Strains of Escherichia coli Serotype O157:H7 and Their Shiga – Like toxin Type by Mismatch Amplification Mutation Assay – Multiplex PCR. E.. E.04.Westama.Các phương pháp phân tích vi sinh vật trong nước. Cebula T. A. L. Clin. [Type text] Page 52 . Vi khuẩn y học. Ralph B. coli. tập Kỹ thuật kiểm tra và chỉ tiêu dánh giá chất lượng an toàn thực phẩm. 33: 248 . TS Lê Văn Phủng. E. coli O157 and other shiga toxin producing E. NXB Y học.250. and Feng P. 3.coli in water samples using a culture method combined with real-time PCR. thực phẩm và mỹ phẩm. chủ biên PGS. Quantitative detection of E. 4. Payne W. Bộ y tế. ..[Type text] [Type text] [Type text] TÀI LIỆU THAM KHẢO 1. 2. Leo Heijnen and Gertjan Medema .Keen. 9p 3325-3332. Journal of water and health 04. 7. 6. NXB Giáo dục Việt nam. Youngsheng He. Khóa luận tốt nghiệp. Applied and enviromental microbiology. NXB Giáo dục. phân heo tiêu chảy và thịt bò. Jimmy Kwang (1996) “Monoclonal Antibodies for Dectiction of the H7 Antigen of Escherichia Coli”. đề tài: Sử dụng kỹ thuật multilplex PCR để phát hiện các gen độc lực của vk Escherichia coli phân lập từ phân bò.. Vol-62 No. Microbiol.Vi sinh vật thực phẩm.

[Type text] [Type text] [Type text] [Type text] Page 53 .

Sign up to vote on this title
UsefulNot useful