[Type text

]

[Type text]

[Type text]

Trường Đại Học Kỹ Thuật – Công Nghệ TP.HCM Khoa Công Nghê Thực Phẩm
  

Đề tài:

-Tp.HCM tháng 11/2011Mục lục
Chương 1 : Tổng quan..............................................................................................4
[Type text] Page 1

[Type text]

[Type text]

[Type text]

I. Sơ lược về vi khuẩn E.coli.....................................................................................4 1. Đặc điểm sinh học..................................................................................................4 1.1 Hình thái................................................................................................................4 1.2 Tính chất nuôi cấy.................................................................................................4 1.3 Tính chất hóa sinh..................................................................................................5 1.4 Kháng nguyên........................................................................................................6 1.5 Phân loại................................................................................................................6 2. Khả năng gây bệnh................................................................................................7 3. Chẩn đoán vi sinh vật............................................................................................12 3.1 Chẩn đoán trực tiếp................................................................................................12 3.2 Chẩn đoán gián tiếp...............................................................................................12 4. Nguyên tắc điều trị và phòng bệnh.......................................................................13 4.1 Điều trị...................................................................................................................13 4.2 Phòng bệnh............................................................................................................13 Chương II : Các phương pháp phát hiện E.coli......................................................14 I. Phương pháp truyền thống....................................................................................14 1. Định lượng E.coli bằng phương pháp MPN........................................................14 1.1 Nguyên tắc.............................................................................................................14 1.2 Quy trình phân tích................................................................................................14 1.3 Cách đọc kết quả....................................................................................................15 2. Định lượng E.coli bằng phương pháp đếm khuẩn lạc........................................15 2.1 Nguyên tắc.............................................................................................................15 2.2 Môi trường và hóa chất..........................................................................................15 2.3 Quy hoạch phân tích..............................................................................................16 2.4 Cách tính kết quả...................................................................................................16
[Type text] Page 2

[Type text]

[Type text]

[Type text]

3. Phương pháp làm giàu vi khuẩn...........................................................................17 3.1 Nguyên lý..............................................................................................................17 3.2 Thiết bị và đồ thủy tinh..........................................................................................17 3.3 Môi trường và thuốc thử........................................................................................17 3.4 Cách làm................................................................................................................17 II. Phương pháp hiện đại..............................................................................................22 1. Phương pháp PCR.................................................................................................22 1.1 Nguyên tắc.............................................................................................................22 1.2 Môi trường tăng sinh.............................................................................................22 1.3 Môi trường phân lập..............................................................................................22 1.4 Trích ly DNA.........................................................................................................22 1.5 Qui trình multiplex-PCR........................................................................................24 1.6 Ưu và nhược điểm của phương pháp PCR.............................................................24 2. Phương pháp ELISA.............................................................................................25 2.1 Nguyên tắc.............................................................................................................25 2.2 Các phương pháp ELISA.......................................................................................26 2.3 Phát hiện E.coli O157:H7 bằng phương pháp Elisa...............................................29 2.4 Ứng dụng của kháng thể đơn dòng trong xác định E.coli O157:H7.......................30 2.5 Ưu điểm của phương pháp E.lisa...........................................................................30 3. Phát hiện E.coli bằng phức hợp kháng thể + hạt nano silica phát quang..................30 Kết Luận.....................................................................................................................34 Phụ Lục......................................................................................................................35 Tài liệu tham khảo.....................................................................................................47

[Type text]

Page 3

[Type text]

[Type text]

[Type text]

Chương I: TỔNG QUAN VỀ VI KHUẨN ESCHERICHIA COLI

I. SƠ LƯỢC VỀ VI KHUẨN ESCHERICHIA COLI (E.COLI)

Escherichia coli do Theodore Escherich (1857-1911), một nhà vi khuẩn học người Áo, phát hiện lần đầu tiên năm 1885. Chi Escherichia thuộc họ vi khuẩn đường ruột. Trong các loài thuộc chi này, E.coli được chọn làm điển hình và có vai trò quan trọng nhất trong y học. E.coli là một trong những thành viên chính của hệ vi khuẩn bình thường ở ruột nhưng cũng là căn nguyên của nhiều bệnh nhiễm trùng, trong đó có những bệnh nó là căn nguyên đứng đầu.

E.coli đã được sử dụng làm mô hình nghiên cứu về sinh học phân tử trong lĩnh vực vi sinh học nói riêng và sinh học nói chung.
[Type text]

Hình 1.1: Hình chụp vi khuẩn E.coli dưới kính hiển vi với kích thước 2 µm

Page 4

[Type text]

[Type text]

[Type text]

E.coli K12 là vi khuẩn được sử dụng làm mô hình nghiên cứu nhiều nhất. nhiều thành tựu về di truyền học, hóa sinh học đã được thu trên cơ sở nghiên cứu vi khuẩn này. Ngày nay E.coli cũng được sử dụng nhiều trong công nghệ sinh học. Mặc dù E.coli là loài vi khuẩn được nghiên cứu sâu nhất, cho đến nay nó vẫn tiếp tục được quan tâm nghiên cứu, với rất nhiều phát hiện mới ở tầm phân tử, đặc biệt cơ chế bệnh sinh của các type gây bệnh (pathotype).
1. Đặc điểm sinh học

1.1 Hình thái E.coli là trực khuẩn Gram âm. Kích thước trung bình từ 2 đến 3µm x 0,5µm; trong những điều kiện không thích hợp (ví dụ như trong môi trường có kháng sinh) vi khuẩn có thể rất dài như sợi chỉ. Rất ít chủng E.coli có vỏ, nhưng hầu hết có lông và có khả năng di động. 1.2. Tính chất nuôi cấy E.coli phát triển dễ dàng trên các môi trường nuôi cấy thông thường. Một số có thể phát triển trên môi trường tổng hợp rất nghèo chất dinh dưỡng. Hiếu kỵ khí tùy ý. Có thể phát triển ở nhiệt độ từ 5-400C. Nhiệt độ thích hợp xung quanh 370C. Trong điều kiện thích hợp E.coli phát triển rất nhanh, thời gian thế hệ chỉ khoảng 20 đến 30 phút. Cấy vào môi trường lỏng (như canh thang) sau 3 đến 4 giờ đã làm đục nhẹ môi trường, sau 24 giờ làm đục đều; sau hai ngày trên mặt môi trường có váng mỏng. Những ngày sau, dưới đáy ống có thể thấy lắng cặn. E.coli không mọc trên canh thang Selenit. Trên môi trường thạch thường, sau khoảng 8 đến 10 giờ, dung kính lúp đã có thể quan sát được khuẩn lạc. Sau 24 giờ khuẩn lạc có kích thước khoảng 1,5mm. Hình thái khuẩn lạc điển hình dạng S, nhưng có thể gặp dạng R, hoặc M. Trên môi trường phân lập, tùy theo chất chỉ thị màu, E.coli có khuẩn lạc màu vàng (như trên thạch lactose) hoặc màu đỏ (như trên thạch MacConkey). Không mọc được trên môi trường SS. Một số loại E.coli có tính chất nuôi cấy riêng có giá trị trong sàng lọc nhanh, như EAEC tạo thành váng đặc trường khi nuôi cấy trên canh thang Muller-Hinton. 1.3. Tính chất hóa sinh E.coli có khả năng lên men nhiều loại đường và có sinh hơi. Hầu hết E.coli đều lên men lactose và sinh hơi, trừ E.coli trơ (inactive) (trong đó có EIEC) không hoặc lên men rất chậm. Một số chi khác trong họ vi khuẩn đường ruột cũng có khả năng lên

[Type text]

Page 5

alberti s i + + T T + + + T + + + T ? + + + + + + - D-Glucose sinh + + + hơi Lactose + T Sucrose T T D-Mannitol + + + Adonitol + Cellobiose + D-Sorbitol + T D-Arabitol L-Ramnose T T + + Sinh sắc tố vàng ONPG: Ortho-nitrophenyl-beta-Dgalactopyranoside +: >90% dương tính -: < 10% dương tính. Enterobacter. arginin và acid glutamic.coli có khả năng sinh indole. vì vậy có khả năng khử carboxyl của lysine.[Type text] [Type text] [Type text] men nhanh lactose (như Klebsiella. Thử nghiệm VP (Voges Proskauer) sau 24 giờ âm tính. Serratia và Citrobacter) được gộp vào một nhóm vi khuẩn có tên chung là coliform. Có decarboxylase. Không sinh H2S.1: Tính chất hóa sinh của một số loài thuộc chi Escherichia Các loài Thử nghiệm CNPG Indole Đỏ methyl VogesProskauer Citrate (Simmons) Lysine decarboxylase Arginine dihydrolase Ornithine decarboxylase Di động D-Glucose acid E. Betagalactosidase dương tính. Bảng 1.fergus onii T + + T + + + + E.vulneri E. Không sử dụng được nguồn carbon của citrate trong môi trường Simmons.coli (inactive ) T T + T T + E.herma nnii + + + + + + + T T + + + + E. sau 48 giờ có thể dương tính.coli (bình thường) + + + T T T + + E. E. ornithin.blatta e + T + + + E. [Type text] Page 6 .

E. Kháng nguyên H: hơn 50 yếu tố kháng nguyên H đã được xác định.coli): E.coli): E.coli gây nhiễm khuẩn đường tiết niệu 2.coli): E.coli): E.coli xâm nhập ruột EAEC (Enteroaggregative E. thứ hai là nhóm gây bệnh ngoài đường ruột (ExPEC-extraintestinal pathogenic E.4.coli). Kháng nguyên Kháng nguyên O: người ta đã biết tới gần 160 yếu tố kháng nguyên O của E.coli): E.coli gây viêm màng não UPEC (Uropathogenic E.5 Phân loại Dựa vào cấu trúc kháng nguyên.coli ngưng tập ruột DAEC (Diffusely adherent E.coli).coli) hay E. trong đó A dưới dạng vỏ quan sát được bằng kính hiển vi quang học thông thường. K và H sẽ có rất nhiều type huyết thanh khác nhau.[Type text] [Type text] [Type text] T: 10-90% dương tính 1. - Các loại E. yếu tố kháng nguyên K số 7 loại B). 1. Kháng nguyên K: Khoảng 100 yếu tố kháng nguyên K đã được xác định và được chia thành ba loại: A.coli.coli): E.coli): E.coli gây bệnh đường ruột ETEC (Enterotoxigenic E. B và L dưới dạng màng rất mỏng chỉ có thể quan sát được nhờ kính hiển vi điện tử. Dựa vào vị trí gây bệnh các E.coli gây xuất huyết ruột - Hai loại E.coli gây bệnh đường ruột (IPEC) đã được biết gồm: EPEC (Enteropathogenic E. ví dụ O86B7 (yếu tố kháng nguyên O số 86.coli được chia thành các type huyết thanh.coli bám dính phân tán EHEC (Enterohaemorrhagic E. Mỗi type huyết thanh được ký hiệu bằng kháng nguyên O và K.coli): E.coli sinh độc tố ruột EIEC (Enteroinvasive E. Khả năng gây bệnh [Type text] Page 7 . B và L.coli có khả năng gây bệnh ở người được chia thành 2 nhóm: thứ nhất là nhóm gây bệnh đường ruột (IPEC-intestinal pathogenic E.coli gây tiên chảy (DEC-Dierrheagenic E. Với sự tổ hợp của các yếu tố kháng nguyên O.coli gây bệnh ngoài đường ruột quan trọng nhất là: MAEC (Meningitidis-associated E.

Hậu quả của quá trình này là áp lực thẩm thấu trong lòng ruột tăng. GMP vòng gây rối loạn chuyển hóa nước và điện giải giống như AMP vòng. Tiều phần A được đẩy vào tế bào biểu mô hoạt hóa enzyme adenylate cyclase làm tăng AMP vòng (cAMP-cyclic adenosine monophosphate). Có hai loại độc tố ruột: loại không chịu nhiệt LT (heat labile toxin) và loại chịu nhiệt ST (heat stable toxin). chiếm tỷ lệ cao nhất trong số các vi khuẩn hiếu khí (khoảng 80%).500 Dalton. nước được kéo từ tế bào ra lòng ruột gây tiêu chảy.coli khác nhau tùy loại:  ETEC-E. O25B15. O119B4. dẫn đến làm giảm hấp thu Na+.coli còn gặp trong nhiễm trùng ngoại khoa. viêm phổi ở trẻ mới sinh. Tuy nhiên. O26B6. Người ta đã nói đến ST-I và ST-II. Quyết định khả năng gây tiêu chảy của ETEC là độc tố ruột. đứng hàng đầu trong các căn nguyên gây nhiễm khuẩn huyết.coli là thành viên thuộc nhóm vi hệ bình thường của đường tiêu hóa.coli có thể sinh một trong hai hoặc cả hai độc tố đó.coli đứng thứ hai (sau S.coli cũng là 1 vi khuẩn gây bệnh quan trọng. O86B7. E.coli sinh độc tố ruột Hai yếu tố động lực quyết định khả năng gây bệnh của ETEC là: khả năng bám dính vào niêm mac ruột và sản xuất độc tố. nhiễm trùng trong bỏng. Cơ chế gây bệnh của E. LT I và LT II có cấu trúc và cơ chế tác động giống nhau và giống với độc tố ruột của vi khuẩn tả. Độc tố ruột LT là ngoại độc tố. Theo báo cáo của chương trình quốc gia giám sát tính kháng thuốc của các vi khuẩn gây bệnh thường gặp (1988-1994) thì E. tăng tiết Cl-. Khả năng này có vai trò của kháng nguyên CFA (clonisation factor antigen) đã được mã hóa bởi gen trên plasmid.000 Dalton và năm tiển phần B (binding) với phân tử lượng 11. còn ST-Ia thì hầu hết từ động [Type text] Page 8 . O55B5. Khả năng bám dính và cư trú trên tế bào biểu mô ruột non là điều kiện đầu tiên để có thể gây bệnh. O126B16. Độc tố chịu nhiệt ST có trọng lượng phân tử xấp xỉ 5000 Dalton. O128B12. LT bám vào thụ thể GM1 của tế bào biểu mô ruột non nhờ tiểu phần B. Cấu tạo của LT gồm 1 tiểu phần A (active) với phân tử lượng 25. ST còn làm mất hoặc làm teo một phần nhung mao của tế bào biểu mô ruột. nó đứng đầu trong các vi khuẩn gây tiêu chảy. E. ST tác động lên ruột bằng sự hoạt hóa enzyme guanylate cyclase làm tăng GMP vòng (cGMPcyclic guanosine monophosphate).aureus) về tỷ lệ phân lập được (tính chung tất cả các loại bệnh phẩm) ở nước ta. O127B8. Những type huyết thanh có khả năng gây bệnh thường gặp trên lâm sàng là: O111B4. viêm đường tiết niệu. E. ST-I gồm ST-Ia và ST-Ib. Hầu hết các chủng sản xuất ra ST-Ib phân lập được từ người.coli là căn nguyên thường gặp trong viêm màng não.[Type text] [Type text] [Type text] E. viêm đường mật. Một chủng E. gồm hai loại LT I được mã hóa bởi gen trên plasmid và LT II được mã hóa bởi gen trên nhiễm sắc thể.

loại III có dạng sợi riêng biệt. Một số yếu tố độc lực đực mã hóa bởi các gen trên nhiễm sắc thể đang được nghiên cứu. Các AFF tạo nên kiểu bám dính hình chồng gạch trên tế bào Hep-2. Nó cũng là một trong những căn nguyên quan trọng của nhiễm khuẩn đường tiêu hóa ở khách du lịch. phá hủy tế bào rối mới xâm lấn sang các tế bào khác. Chưa gặp các chủng sinh ST-II gây tiêu chảy ở người. Tổn thương nhất chính là viêm loét hoại tử niêm mạc đại tràng. máu. Ipa-Invasion plasmid antigen). có lẫn nhày máu. protein Pet và độc tố EAST-1 (enteroaggregative heat-stable toxin-1). Triệu chứng lâm sàng điển hình là đi ngoài phân ít.coli bám dính kết tập ruột EAEC thường gây tiêu chảy kéo dài hoặc mạn tính. Ngoài các yếu tố dộc lực nêu trên EAEC còn tiết ra 1 protein có khả năng làm tan máu và làm mất thăng bằng vận chuyển ion qua màng. phân toàn nước không có nhày. làm tiêu các túi thực bào và nhân lên trong bào tương. gây tích tụ dịch và gây độc cho biểu mô tiêu hóa. EIEC cho kết quả (+) tính trong thử nghiệm khả năng gây viêm kết giác mạc chuột lang (thử nghiệm Sereny). Cơ chế bệnh sinh trong tiêu chảy do EAEC vẫn chưa được sáng tỏ hoàn toàn. EIEC xâm nhập vào trong tế bào biểu mô đại tràng. EAEC-E. EIEC còn có khả năng sản xuất độc tố ruột giống một số Shigela. Khả năng xâm nhập được mã hóa bởi gen trên plasmid 140MDa. EAEC tạo thành váng đặc trưng. Vì vậy trong y văn hiện nay viết căn nguyên gây bệnh lỵ trực khuẩn (bacillary dysentery) gồm Shigella và EIEC. Các gen trên plasmid này mã hóa cho các kháng nguyên xâm nhập (IpaA đến IpaD.[Type text] [Type text] [Type text] vật hoặc các thức ăn có nguồn gốc động vật. Tính chất này được dùng để sàng lọc nhanh các chủng E. Khi nuôi cấy trên canh thang Muller-Hinton. nhất là ở trẻ em. Những yếu tố động lực chính của EAEC được nói đến gồm các diềm bám dính kết tập AAF (aggregative adhesion fimbriae).coli thuộc loại EAEC. Ba loại AAF đã được nói đến là AAF/I. AAF/II và AFF/III. Tiêu chảy do ETEC thường khởi phát đột ngột. EAST-1 có khả năng phá hủy tế bào biểu mô. Cơ chế gây bệnh giống vi khuẩn lỵ. Protein Pet được tiết qua màng ngoài vi khuẩn. Yếu tố điều hòa bám dính kết tập aggR. Gen mã hóa cho độc tố này có tên là sen (Shigella enterotoxin). trong đó loại I và II có cấu trúc bó.  EIEC-Ecoli xâm nhập ruột EIEC gây bệnh chủ yếu do khả năng xâm nhập vào niêm mạc đại tràng. [Type text] Page 9 . Diềm bám dính kết tập được cho là yếu tố quyết định độc lực. Các yếu tố độc lực nêu trên của EAEC phần lớn được mã hóa bởi các gen nằm trên plasmid có phân tử lượng 60 MDa. Yếu tố aggR có vai trò điều hòa sự biểu hiện của các AFF.

[Type text] [Type text] [Type text] Bảng 1. phân thường toàn nước không có nhầy máu Hội chứng lỵ trực khuẩn Tiêu chảy kéo dài [Type text] Page 10 ..tăng cAMP – giảm hấp thu Na+/tăng tiết Cl.tiêu chảy Độc tố vững bền với nhiệt STa và STb Hoạt hóa guanylate (mã hóa bởi plasmid và transposon) cyclase. nhân lên gây IpaD viêm loét hoại tử niêm mạc đại tràng Điểm bám dính kết tập AAF AAF tạo nên kiểu bám (aggregative adhesion fimbriae) dính hình chồng gạch aggR điều hòa sự biểu Yếu tố điều hòa bám dính kết tập aggr hiện của AAF Protein pet gây tích tụ dịch và gây độc tố cho biểu mô tiêu hóa Độc tố EAST-1 (enteroaggregative EAST-1 phá hủy tế heat-stable toxin-1) bào biểu mô Protein làm tan máu và mất thăng Protein làm tan máu Tiêu chảy cấp. EspG và MAP (mitochondriaassociated protein) EAST-1 CDT (Cytolethal distending toxin) Các CFA mã hóa bởi plasmid: CFA-I (fimbriae cứng). EspF. CFA-II và CFA-IV (fimbriae mềm) và pili dài liên quan với type IV Đặc điểm lâm sàng Bám dính tại chỗ nhờ Các tổn BFP thương A/E Tổn thương mô A/E Tiêu chảy cấp Cơ chế gây bệnh EPEC ETEC Bám vào niêm mạc ruột non (CFA I-IV) và sản xuất các độc tố ruột LTI. EspD. STa. PAI nhiễm sắc thể (LEE) TTSS gồm: intimin (eaeA). Tir. EspA.coli Gen động lực hoặc yếu tố độc lực Plasmid 50-70 MDa (EAF): Mã hóa BFP (bundle-forming pilus). Per (plasmid-encoded regulator) và Ler (LEE-encoded regulator. LTII. STb ETEC EIEC EAEC Độc tố chịu nhiệt LT I và LT II (mã hóa bởi plasmid) Hoạt hóa adenylate cyclase. các protein tiết. EspB. CFA-III (tạo bó).coli gây bệnh đường ruột Loại E.2: Tóm tắt các đặc điểm liên quan đến khả năng gây bệnh của các E.tăng cGMP – tiết chloride và/hoặc giảm hấp thu NaCl – tiêu chảy Các gen trên plasmid 140 MDa mã Vi khuẩn bám và xâm hóa các kháng nguyên xâm nhập nhập vào biểu mô đại (invasion plasmid antigen) IPaA – tràng.

Stx2 và Stx2v. ức chế quá trình tổng hợp protein dẫn đến làm chết tế bào.ức chế quá trình tổng hợp protein của tế bào biểu mô đại tràng. Stx còn có thể gây hội chứng tăng ure huyết tan máu (HUS-haemorrhagic uremic syndrome). từ những năm 1940. bệnh nhân bị suy thận cấp. Stx2.coli sinh độc tố Shiga.coli bám dính phân tán [Type text] Page 11 . Loại vi khuẩn này có vai trò rất quan trọng trong viêm dạ dày ruột gây tiêu chảy ở trẻ em. Độc tố Shiga hủy hoại chọn lọc các vi nhung mao hất thu của tế bào biểu mô ruột. Stx2v) mã . dẫn đến làm chết tế bào.gây hội chứng HUS hóa bởi các gen trên nhiễm sắc thể Các yếu tố bám dính Afa/Dr Afa/Dr gây bám dính (AIDA) phân tán EAST-1 EAST-1 phá hủy tế bào biểu mô Các geb set (enterotoxin) Có thể có TTSS với esc Tiêu chảy ra máu (do xuất huyết đại tràng) Tiêu chảy phân thường không có máu EHEC còn được gọi là E.coli gây bệnh đường ruột EPEC được bắt đầu nghiên cứu rất sớm. Độc tố Shiga: LCT. Nó cũng xâm nhập vào tế bào biểu mô đại tràng. PAI nhiễm sắc thể .coli. Hậu quả là viêm đại tràng xuất huyết.  DAEC – E. Những trường hợp hoại tử nặng có thể gây thủng ruột. EspP .[Type text] [Type text] [Type text] bằng vận chuyển ion qua màng EHEC/ VTEC DAEC và làm mất thăng bằng vận chuyển ion qua màng Plasmid 60 MDa mã hóa heamolysin. Yếu tố động lực chính của EHEC là độc tố Stx (Shiga toxin) hay độc tố gây độc đối với tế bào Vero VT (veroccytotoxin) vì vậy loại này thuộc nhóm có tên là VTEC – Verocytotoxin E. Hiện nay. Độc tố Shiga (Stx1. Các độc tố này được mã hóa bởi các gen prophage thích hợp trên nhiễm sắc thể. Hậu quả của quá trình này là mức lọc của thận suy giảm.  EPEC – E. EPEC bám dính vào niêm mạc ruột gây tổn thương đặc trưng là sự phá hủy vi nhung mao ở riềm bàn chải của niêm mạc ruột. có ba loại Stx do EHEC sinh ra đã được xác định là Stx1.Hủy hoại các vi nhung mao hấp thu cả tế bào biểu mô ruột. gây tiêu chảy phân như máu. làm hẹp và tắc mao mạch tiểu cầu thận. Stx vào máu đến thận gây tổn thương tế bào biểu mô tiểu cầu thân.

coli. vào dịch tủy não. O4. tới 80% các trường hợp viêm màng não ở trẻ sơ sinh do E. v\các nhóm huyết thanh hay gặp là O1. K2. 3. Cho đến nay. cho kết quả rất nhanh và độ tin cậy rất cao. nước tiểu với nhiễm khuẩn đường tiết niệu. Tuy nhiên đã xác định được những gen độc lực của ExPEC thường gặp trong các nhiễm trùng ngoài đường ruột. các E. hiểu biết về sự nhạy cảm của trẻ sơ sinh với loại E. O7 và O75. K3. Ngoài ra nó coàn có một số yếu tố độc lực khác cũng tham gia vào cơ chế gây bệnh. E. Theo kết quả của nhiều nghiên cứu. MAEC có kháng nguyên vỏ có liên quan về mặt hóa học và miễn dịch với polysaccharide nhóm B của Neisseria meningitides. Chúng có thể là thành viên của hệ vi khuẩn bình thường ở ruột nhưng khi vào máu.coli gây bệnh được trộn dịch nảo tủy. Đối với viêm màng não mủ có thể phát hiện kháng nguyên đặc hiệu của vi khuẩn bằng phản ứng ngưng kết latex. nhất là ở những người có cơ chế đề kháng bị suy giảm. là một trong các kháng nguyên nhóm máu. những vi khuẩn này thường có các gen mã hóa cho các yếu tố độc lực như yếu tố bám dính.coli có thể gắn đặc hiệu vào kháng nguyên P. UPEC là nguyên nhân chủ yếu của nhiễm trùng đường tiết niệu. Nhiều tác giả cho rằng có sự liên quan chủ yếu đến cơ địa của trẻ. Có thể làm tiêu bản soi trực tiếp đối với một số loại bệnh phẩm như cặn ly tâm nước tiểu hoặc nước não tủy. vào đường tiết niệu thì trở nên gây bệnh. Nguyên lý của phản ứng này như sau: các hạt latex có gắn kháng thể kháng E. K5. Chẩn đoán vi sinh vật 3. Chẩn đoán trực tiếp Bệnh phẩm khác nhau tùy bệnh: là phân với nhiễm khuẩn đường tiêu hóa. Các chủng có kháng nguyên K1.coli gây bệnh ngoài đường ruột (ExPEC) là những vi khuẩn gây bệnh cơ hội khi “lạc chỗ”.1.K13 là hay gặp nhất.coli cơ bản gống với qui trình chuẩn đoán các vi khuẩn đường ruột. Khác với E. vỏ.coli này chưa đầy đủ. [Type text] Page 12 . O2. Đó là phản ứng ngưng kết thụ động. O6. các độc tố. máu nếu là nhiễm khuẩn máu… Qui trình chuẩn đoán trực tiếp E. yếu tố độc lực quan trọng của UPEC là P-pili. Dễ làm. K12.coli thì phản ứng sẽ dương tính. Nhờ Pili này.coli gây bệnh đường ruột (IPEC).[Type text] [Type text] [Type text] DAEC là type gây bệnh được mô tả tương đối gần đây. Nó được xác định là một type gây bệnh riêng vì không có các gen độc lực đặc trưng của các type khác đã được mô tả trước. nếu trong bệnh phẩm có kháng nguyên đặc hiệu của E.

coli. Sau khi đã phân lập được vi khuẩn thuần nhất thì xác định tính chất sinh vật hóa học và định tên bằng phản ứng ngưng kết trên phiến kính với các kháng huyết thanh mẫu. Bệnh phẩm phân được nuôi cấy trên môi trường phân lập có chất ức chế chọn lọc như DCL. Nước tiểu giữa dòng được tiến hành cấy đếm trên môi trường đặc. vừa có khả năng định danh. Chẩn đoán gián tiếp Trên thực tế phương pháp huyết thanh học không được sử dụng để chẩn đoán các nhiễm khuẩn do E.2. ELISA… Kỹ thuật khuếch đại gen PCR cũng đã được áp dụng trong chẩn đoán E.2. rút ống thông sớm nếu có thể được.coli. Ở nước ta hiện nay chủ yếu mới sử dụng PCR trong định danh khi vi khuẩn đã được phân lập thuần nhất. vì vậy cần phải làm kháng sinh đồ để chọn kháng sinh thích hợp.coli thuộc vào các vi khuẩn có tỷ lệ kháng thuốc cao. 4.coli trực tiếp từ bệnh phẩm đang được nghiên cứu phát triển. phương pháp đồng ngưng kết. nhất là các chủng phân lập được từ nước tiểu. Endo. Ngoài việc sử dụng kháng sinh.1 Điều trị E. thực hiện các biện pháp phòng bệnh chung không đặc hiệu giống như đối với các vi khuẩn đường ruột khác. Để đề phòng nhiễm khuẩn đường tiêu hóa do E. hiện nay có môi trường uriselect vừa có giá trị cấy đếm. giải quyết các cản trở trên đường tiết niệu. Để xác định các E. Tiến hành cấy máu khi nghi có nhiễm khuẩn máu.coli.coli sinh độc tố người ta có thể sử dụng nhiều phương pháp khác nhau như phương pháp quai ruột. Các kỹ thuật PCR xác định E. 3. một số việc khác rất có giá trị trong điều trị như bồi phụ nước. điện giải trong trường hơp ỉa chảy (việc này nhiều khi có vai trò quyết định để cứu sống bệnh nhân). Phòng bệnh Hiện nay chưa có phương pháp nào phòng bệnh đặc hiệu. [Type text] Page 13 . 4. trước đây thường sử dụng thạch thường.[Type text] [Type text] [Type text] Phương pháp chuẩn đoán chủ yếu nhất là nuôi cấy phân lập. Nguyên tắc điều trị và phòng bệnh 4. phương pháp thử nghiệm trên tế bào nuôi.

Theo dõi sự sinh hơi và đổi màu để định tính sự hiện diện trong từng ống thử nghiệm.1 Nguyên tắc Số lương E. đây là các ống dương tính. Mỗi nồng độ pha loãng được ủ từ 3 đến 5 ống lặp lại. Chương II: CÁC PHƯƠNG PHÁP PHÁT HIỆN E. Ghi nhận số ống nghiệm [Type text] Page 14 . thực phẩm chứa mật độ thấp có thể được xác định bằng phương pháp MPN ( Most Probable Number).COLI I.coli: thực hiện vệ sinh vùng hậu môn và bộ phận sinh dục ngoài.coli bằng phương pháp MPN 1. Phương pháp này dựa vào nguyên tắc mẫu được pha loãng thành một dãy thập phân (hai nồng độ kế tiếp khác nhau 10 lần). Định lượng E. Phương pháp truyền thống 1.[Type text] [Type text] [Type text] Thực hiện các biện pháp ngăn ngừa nhiễm trùng bệnh viên vì E. Để phòng nhiễm khuẩn đường tiết niệu do E. Điều trị loại trừ các yếu tố nguy cơ khác. thực hiện nghiêm túc nguyên tắc vô trùng khi phải tiến hành thăm dò hoặc đặt thông đường tiết niệu.coli trong mẫu nước.coli là một trong các vi khuẩn gây bệnh cơ hội quan trọng. 3 hoặc 5 mẫu có độ pha loãng thập phân liên tiếp được ủ trong ống nghiệm chứa môi trường thích hợp có ống bẫy khí Durham.

20C trong 24 giờ.[Type text] [Type text] [Type text] cho phản ứng dương tính ở mỗi nồng độ pha loãng và được vào bảng MPN để suy ra số lượng nhóm vi sinh vật tương ứng hiện diện trong 1g (hoặc 1ml) mẫu ban đầu. Ghi nhận ống có sinh hơi.coli [Type text] Page 15 .. Chọn khuẩn lạc có đường kính lớn hơn 1mm và cấy vào các môi trường MRVP.2 Quy trình phân tích Tuần tự cấy 1ml dung dịch mẫu đã pha loãng 10 -1vào 3 ống nghiệm giống nhau. Sau khi khử trùng. ủ ở 44. Môi trường thạch đĩa EMP Môi trường rắn Simmon Citrate Agar (thạch Simmon Citrate) Canh MR-PV Thuốc thử Methyl Read Thuốc thử α-napthol. Môi trường và hóa chất : - Môi trường lỏng Lauryl Sulphate Broth LSB (canh Lauryl Sulphate) Môi trường lỏng Brilliant Green Lactose Bile Salt (canh BGBL) Môi trường lỏng E. Đây là trường hợp xác định MPN bằng hệ 3 dãy nồng độ và 3 ống nghiệm lặp lại (hệ 3 x 3 hay 9 ống nghiệm). canh EC) - Các môi trường lỏng trên được chuẩn bị trong các ống nghiệm chứa ống Durham úp ngược. Ủ các ống nghiệm ở 37 0C trong 48 giờ. Ống nghiệm cho kết quả trong môi trường EC và khuẩn lạc E. Thực hiện tương tự với dịch mẫu đã pha loãng 10-2 và 10-3. Ủ các đĩa này ở 370C trong 24 giờ để tìm khuẩn lạc E. mỗi ống chứa 10ml canh LSB. phải sử dụng các mẫu có bậc pha loãng cao hơn. Dùng que cấy vòng ria dịch mẫu từ các ông (+) trên môi trường canh EC sang môi trường thạch đĩa MBN.5 ± 0.coli.coli (E. Dùng que cấy vòng cấy chuyển dịch mẫu từ các ống LSB (+) sang các ống có chứa canh BGBL và ủ ở 37 0C ± 10C trong 48 giờ. nếu nghi ngờ số lượng vi sinh vật trong mẫu quá cao. chỉ sử dụng các ống nghiệm không có bọt khí bên trong ống Durham. dẹt hình đĩa và có ánh kim tím). I.coli medium.coli giả định cho kết quả thử nghiệm IMViC tuần tự là + + .coli giả định (tròn. Simmon Citrate Agar để thực hiện các thử nghiệm IMViC.chính là E. Khuẩn lạc E. Ghi nhận số ống cho kết quả (+) (có sinh hơi) ứng với mỗi độ pha loãng. Đếm số lượng các ống cho kết quả (+) (sinh hơi) ở mỗi độ pha loãng. Dùng que cấy vòng chuyển một vòng dịch mẫu từ các ống canh LSB (+) sang môi trường canh EC.

coli bằng phương pháp đếm khuẩn lạc 2.coli bằng các thử nghiệm IMViC. hấp khử trùng. [Type text] Page 16 . .2 Môi trường và hóa chất .coli (+) ở mỗi độ pha loãng của mẫu. 2. đếm các khuẩn lạc có hình dạng đặc trưng của Coliforms.1 Nguyên tắc Mẫu đã được đồng nhất hóa được cấy một lượng nhất định lên môi trường thạch chọn lọc thích hợp chứa lactose. . từ số lượng các ông nghiệm có E.coli (+) ở mỗi độ pha loãng của mẫu. hấp khử trùng. Khẳng định khuẩn lạc đã đếm là E.Môi trường canh Tryptone Broth được phân phối 5ml vào mỗi ống nghiệm. đun chảy và làm nguội ở nhiệt độ 450C trong bể điều nhiệt trước khi sử dụng. ủ ở 440C trong 24 giờ.coli (+).3 Cách đọc kết quả Ở tất cả các trường hợp nêu trên. .Môi trường canh Lactose Tryptone Lautyl Sulphate Broth (LST Broth) được chuẩn bị tương tự môi trường canh EC. Các ống EC này được bảo quản ở 2 – 80C.Môi trường canh Tryptone Soya Agar (TSA) và môi trường Violet Red Bile Agar (VRB) được chuẩn bị vô trùng trong các chai thủy tinh. . Định lượng E. Ghi nhận số lượng các ống nghiệm có E.[Type text] [Type text] [Type text] giả định trên môi trường EMB cho kết quả thử nghiệm IMViC như trên là ống nghiệm có E.Môi trường canh MR-VP Broth được phân phối 5ml vào mỗi ống nghiệm. để nguội và bảo quản ở 2-80C cho đến khi sử dụng.Môi trường canh Escherichia coli broth (EC Broth) được phân phối 10ml trong mỗi ống nghiệm chứa ống Durham úp ngược. .Môi trường thạch Simmon Citrate được chuẩn bị dưới dạng các ống thạch nghiêng có màu xanh lục. 1. dùng bảng MPN thích hợp (bảng 3 x 3 tức 9 ống nghiệm) để tính ra mật độ vi sinh vật trong mẫu và biểu diễn dưới dạng trị số MPN/g hay MPN/ml mẫu ban đầu chưa pha loãng.Thuốc thử Kovac’s.coli giả định trên môi trường EMB. hấp khử trùng để nguội và kiểm tra không có sự hiện diện của bọt khí trong ống Durham. Thực hiện tương tự cho tất cả các ông nghiệm cho kết quả (+) trong môi trường EC và tạo được khuẩn lạc E. . 2.

2. Chọn 5 khuẩn lạc nghi ngờ (khuẩn lạc màu đỏ đến đỏ đậm. Chờ cho môi trường trong đĩa đông đặc. đường kính ≥ 0.[Type text] 2. sau đó tiếp tục chuyển 1ml dịch mẫu này vào ống nghiệm thứ hai chứa 9ml dung dịch pha loăng ta sẽ thu được dịch mẫu có độ pha loãng 10-3. Ghi nhận khuẩn lạc cho thử nghiệm khẳng định E. tính mật độ của E.50C trong 24 giờ. Bổ sung vào mỗi đĩa 10 – 15ml môi trường thạch VRB ở nhiệt độ 450C trên môi trường TSA. Dung dịch này có độ pha loãng 10-2. Dịch mẫu đồng nhất được tiếp tục pha loãng theo dãy thập phân bằng cách chuyển 1ml dịch mẫu vào ống nghiệm chứa 9ml dung dịch pha loãng.-). Methyl Read. Để nhiệt độ phòng trong 1 – 2 giờ để hồi phục các tế bào bị tổng thương. Lắc tròn đĩa petri xuôi và ngược kim đồng hồ.3 Quy trình phân tích [Type text] [Type text] Mẫu được đồng nhất hóa bằng cách đối với mẫu rắn xay nhuyễn mẫu trong điều kiện vô trùng rồi cân chính xác 10g (hoặc 25g). dung dịch mẫu thu được có độ pha loãng là 10-1 so với ban đầu.coli theo công thức sau: A (CFU/mg hay CFU/ml) [Type text] =xR Page 17 . Citrate. Sau khi được làm đồng nhất bằng cách trên. Lắc đều trong một thời gian nhất định (ít nhất là 2 phút đối với mẫu rắn). Thực hiện tương tự trên mẫu ở 2 nồng độ pha loãng liên tiếp sao cho mỗi đĩa xuất hiện từ 10 – 100 khuẩn lạc và lặp lại ít nhất 2 đĩa ứng với mỗi nồng độ pha loãng. mỗi chiều 3 – 5 lần để trộn dịch mẫu với môi trường. lật ngược đĩa và ủ ở 37 ± 10C trong 24 – 48 giờ. Bổ sung vào mỗi đĩa đã cấy mẫu khoảng 5ml môi trường TSA đã được đun chảy và ổn định trong bể điều nhiệt 450C. canh MR-VP. Voges Proskauer.50C trong 24 giờ Thử nghiệm Indol. Ủ các môi trường trên ở 44 ± 0.coli trong 1ml dung dịch pha loãng. bổ sung vào trong bình tam giác chứa 90ml (hay 225ml) nước SPW đã được hấp khử trùng. Chọn các ống cho kết quả (+) (sinh hơi) và dung que cấy vòng chuyền sang các môi trường sau: canh Tryptone.coli (+) ( IMViC là + + . dung que cấy vòng chuyền sang môi trường canh EC.4 Cách tính kết quả Dựa vào số khuẩn lạc đếm được và tỷ lệ khẳng định. Tiếp tục thực hiện để được các độ pha loãng thập phân tiếp theo sao cho chứa <100 tế bào E. đối với mẫu lỏng hút 10ml (hoặc 25ml). có vòng tủa muối mật.5 mm). thạch Simmon Citrate. Chuyển 1ml dịch pha loãng mẫu đã chọn vào đĩa petri. ủ ở 44 ± 0.

Môi trường indole và thuốc thử (mt 44. Canh thang nitrate (Nitrate broth) (mt 19) [Type text] Page 18 . Ống nghiệm. Canh thang EE (Enteric enrichement broth) (mt 14) 4. mt 98) 5. 3. Tủ ấm 350C 3. Canh thang LST (Lauryl sulphate tryptose broth) (mt28) 6.2 Thiết bị và đồ thủy tinh 1. Phương pháp làm giàu vi khuẩn 3. Những khuẩn lạc khả nghi được kiểm tra về đặc tính sinh hóa và huyết thanh của EEC. Chậu nước 440C và 41. Máy pha trộn 4. pipet.1 Nguyên lý Phương pháp này dựa vào làm giàu vi khuẩn trước trong canh thang dinh dưỡng và MacConkey.[Type text] [Type text] [Type text] N: tổng số khuẩn lạc đếm được ni: số đĩa có số khuẩn lạc được chọn tại mỗi độ pha loãng V: dung tích mẫu (ml) cấy vào mỗi đĩa fi: độ pha loãng có số khuẩn lạc được chọn tại các đĩa đếm R: tỷ lệ khẳng định 3. Môi trường lên men (carbohydrate fermentation medium) (mt 46) 2. Canh thang MacConkey (mt 17) 8. Thạch MacConkey (mt 80) 7.3 Môi trường và thuốc thử 1. Thạch L-EMB (Levine’s methylene blue agar) (mt 76) 3. đĩa Petri 3. rồi làm giàu trong canh thang LST và EE sau đó ria lên thạch L-EMB.50C 2.

Ủ ấm canh thang dinh dưỡng 350C trong 6h. Ủ ấm ở 350C trong 24h. Chuyển một quai cấy sang 30ml canh thang EE. Môi trường V. Canh thang urê (các thành phần là thạch urê nhưng không có agar) (mt 93) 13. Ủ ấm 41. thạch MacConkey. Xác nhận tính chất sinh vật hóa học : Ria từ canh thang LST dương tính lên thạch L-EMB và EE dương tính lên thạch MacConkey và thạch L-EMB. Chuẩn bị mẫu: Cân 25g mẫu bằng thao tác vô khuẩn rồi cho vào 225ml canh thang MacConkey và 225ml canh thang dinh dưỡng trong blender vô khuẩn và làm đồng nhất trong 30 giây (1:10) 2. 3. Kháng huyết thanh E. nhỏ một giọt canh thang của mỗi thứ lên trên phiến kính sạch và cho thêm một giọt huyết thanh đa giá OB và một giọt nước muối 0. chuyển một quai cấy sang 30ml canh thang LST. Làm giàu vi khuẩn : ủ ấm canh thang MacConkey ở 350C trong 20h .50C trong 18h.[Type text] [Type text] [Type text] 9.Coli 3. [Type text] Page 19 . Canh thang KCN (Potassium cyanide broth) (mt 3) 11. Xét nghiệm sơ bộ về huyết thanh : Trung hòa canh thang LST và EE với 10% NaHCO3. 5. 4.P (Voges Proskauer medium) (mt 54) 14. Trộn các giọt trên và xem ngưng kết.5%. Ủ ấm 440C trong 20h. Thạch TSI (Triple sugar iron agar) (mt 86) 12. Ria thẳng Ria từ canh thang dinh dưỡng đồng nhất lên thạch L-EMB.4 Cách làm 1. Canh thang dinh dưỡng (Nutrient broth) (mt 6) 10. Ủ ấm 350C trong 24h.

urease.P. citrate và adonitol. VP. EMB agar chọn lọc bởi vì thuốc nhuộm anilin trong phương tiện truyền thông tím ức chế sự phát triển của sinh vật Gram dương. Yếu hơn quá trình lên men kết quả lactose trong môi trường với một màu hơi hồng tím . Sản xuất axit mạnh mẽ bởi các sinh vật như E. Lactose men chuyển hóa đường lactose trong các phương tiện truyền thông và sản xuất các sản phẩm phụ axit. Đặc tính sinh vật hóa học của E. có chứa thuốc nhuộm eosin và xanh methylene. Đồng thời cấy lên mặt thạch nghiêng PCA cùng một khuẩn lạc dùng để kiểm tra huyết thanh.coli kết quả trong một ánh xanh kim loại. KCN. gây ra một sự thay đổi màu sắc trên môi trường. hoặc ít nhất không đậm hơn so với màu sắc của các phương tiện truyền thông [Type text] Page 20 . indole. Indole Urease KCN Adonitol Cytochrome oxidase + + + acid 5.1 Chọn những khuẩn lạc điển hình và cấy vào môi trường TSI. Thuộc địa của men nonlactose vẫn không màu.[Type text] [Type text] [Type text] 5.Coli TSI (H2S) V.Coli gây bệnh đường ruột - Thạch EMB Thạch Eosin methylene thạch màu xanh. Vì vậy. EMB cũng là một phương tiện khác biệt .2 Nhận diện huyết thanh E.

3: Thử nghiệm Indole Ống 1: E.[Type text] [Type text] [Type text] Hình 2.coli cho kết quả dương tính Ống 2: E.coli cho kết quả âm tính Hình 2.coli trên môi trường thạch EMB (a) (b) (1) (2) ư Hình 2.coli Page 21 (B) (A) (A) Cho kết quả (-) (B) Cho kết quả (+) . (2): E.coli (-) .4: Thử nghiệm Urease (1): E.1: Khuẩn lạc E.coli (+) [Type text] (1) (2) Hình 2.5: Thử nghiệm Cytochrome oxidase với vi khuẩn E.

7: Thử nghiệm MR (a): E.coli (+).[Type text] [Type text] [Type text] (a) (b) Hình 2. (b): E.coli (-) [Type text] Page 22 . (b): E.coli (+).6: Thử nghiệm VP (a): E.coli (-) Hình 2.

đặc biệt là E. cho nên trước khi phân lập cần sử dụng môi trường tăng sinh pepton đệm có bổ sung kháng sinh cefiximw (0.coli nhóm STEC. : Thử nghiệm Citrate với vi khuẩn E. 1.[Type text] [Type text] [Type text] Hình2.3 Môi trường phân lập [Type text] Page 23 .coli (a): E.coli (+) (b): E.2 Môi trường tăng sinh Do số lượng E. 1.coli gây bệnh hiện diện trong thực phẩm rất ít. Phương pháp PCR (polymerase Chain Reaction) 1. Phương pháp hiện đại 1.coli (-) II.0125mg/l) và vancomycin (8mg/l) để ức chế các vi khuẩn Gram dương và vi khuẩn sống hoại sinh khác.1 Nguyên tắc Phương pháp PCR (Polymerase Chain Reaction) là một phương pháp invitro để tổng hợp DNA dựa trên khuôn là một trình tự đích DNA ban đầu khuếch đại. nhân số lượng bản sao của khuôn này thành hàng triệu bản sao nhờ hoạt động của enzyme polymerase và một cặp mồi (primer) đặc hiệu cho đoạn DNA này.8.

E. Trên từng loại môi trường MAC. đun sôi 10 phút. Để yên và hút phần dung dịch ở phía trên làm DNA khuôn mẫu (DNA xét nghiệm).coli đều lên men đường lactose.coli điển hình có khuẩn lạc màu đỏ. 1.5 ml nước cất hai lần vô trùng.coli lên men sorbitol cho khuẩn lạc màu hồng. CT-SMAC chọn ngẫu nhiên 6-10 khuẩn lạc rời rạc đại diện cho mỗi nhóm hình thái.4-0. SMAC.coli trên môi trường thạch (MAC hoặc SMAC.coli. Khoảng 90% E. trên môi trường SMAC và CT-SMAC.4 Trích ly DNA Việc trích ly DNA được thực hiện như sau: thu khoảng 6-10 khhuẩn lạc E.05mg/l) và tellurite (2. những dòng E. trên môi trường MAC. ly tâm 13000 vòng trong 3 phút. lấy ra và chuyển vào tủ âm -700C giữ trong 10 phút. cefixime) (370C/24 giờ) CT-SMAC (370C/24 giờ) [Type text] Page 24 . hoặc CT-SMAC) cho vào eppendorf đựng sẵn 0.5mg/l). cấy từng khuẩn lạc được chọn vào từng ống thạch nghiêng NA. Sorbitol MacConkey (SMAC). Mẫu MAC (370C/24 giờ) SMAC (370C/24 giờ) Pepton (vancomycin. E. Sorbitol MacConkey (CT-SMAC) có bổ sung kháng sinh cefixime (0. Làm thử nghiệm sinh hóa IMViC cho từng khuẩn lac riêng lẻ thuộc nhóm đó để xác định E. Sau khi rã đông hoàn toàn.coli không lên men đường sorbitol nên cho khuẩn lạc màu trắng.[Type text] [Type text] [Type text] Môi trường phân lập là môi trường MacConkey (MAC).

định tính và phát hiện gen độc lực E.5 ml H2O cất khử ion 2 lần Thử IMViC (+ + .-) Ly trích DNA (DNA nhóm khuẩn lạc) (-) Multiplex-PCR (+) Ly trích DNA riêng theo từng ống NA Loại bỏ ống NA đã giữ Multiplex-PCR Sơ đồ 1: Qui trình phân lập. coli [Type text] Page 25 .4-0.[Type text] [Type text] [Type text] Chọn 6-10 khuẩn lạc đỏ hồng Chọn 6-10 khuẩn lạc theo từng nhóm riêng: trắng hoặc đỏ hoặc cả hai Cấy từng khuẩn lạc được chọn vào từng ống thạch nghiêng NA (370C/24 giờ) Thu tất cả phần còn lại của những khuẩn lạc đã chọn theo từng nhóm riêng và mỗi nhóm cho vào eppendorf chứa sẵn 0.

5 µl. Chu kỳ nhiệt .5.Biến tính 940C/1 phút .5. DNA 2µl. mỗi dNTP 200µM. và nước cất vừa đủ 25µl.5.1 X.5 pmol. mỗi loại primer 7.1 Trình tự các đoạn mồi sử dụng trong Multiplex-PCR Mồi (primer) Eae-F Eae-R EhxA-F EhxA-R Stx1-F Stx1-R Stx2-F Stx2-R Uid-F Uid-R Trình tự oligonucleotide (5’3’) ATTACCATCCACACAGACGGT ACAGCGTGGTTGGATCAACCT GTTTATTCTGGGGCAGGCTC CTTCACGTCACCATACATAT CAGTTAATGTGGTGGCGAAGG CACCAGACAATGTAACCGCTG ATCCTATTCCCGGGAGTTTACG GCGTCATCGTATACACAGGAGC GCGAAAACTGTGGAATTGGG TGATGCTCCATCACTTCCTG Kích cỡ DNA được khuếch đại (bp) 397 158 348 584 252 1. Taq 2.2.Ủ bắt cặp 610C/1 phút [Type text] Page 26 . MgCl2 3mM. Các thành phần của phản ứng PCR: Mỗi phản ứng là 25µl.[Type text] [Type text] [Type text] 1.Tiền biến tính 950C/5 phút . gồm các thành phần sau : PCR buffer 1.5 Qui trình multiplex-PCR 1.3. 1.

 Nhược điểm: . việc tăng sinh là đơi giản hơn và đôi khi không cần thiết . . Sau khi điện di.6.Có thể phát hiện được nhưng vi sinh vật khó nuôi cấy. Sau đó rửa sạch bằng nước và chụp hình gel với tia UV bằng máy chụp gel. Thang chuẩn (ladder) cũng được điện di đồng thời. ngược lại phương pháp [Type text] Page 27 .6% trong TBE.Kéo dài 720C/1 phút . . .kéo dài chuỗi 720C/7 phút [Type text] [Type text] . do vậy có thể dẫn đến trường hợp dương tính giả do DNA từ tế bào chết. đọc kết quả Lấy 10µl sản phẩm PCR cùng với 2µl loading dye được điện di trên gel agarrose 1. nên trong đa số trường hợp cần có bước nuôi cấy làm giàu để có được mật độ đủ để phát hiện bằng PCR.Phương pháp này không phân biệt được tế báo sống với tế bào chết. thời gian điện di 30-35 phút ở 90V và 250 mA. 1.[Type text] . có thể tự động hóa để làm giảm chi phí phát hiện các vi sinh vật gây bệnh trong thực phẩm. Tuy nhiên.Sự ức chế Taq DNA polymerase bởi thành phần của mẫu vật do mẫu thực phẩm thường có những thành phần phức tạp. Các sản phẩm PCR được xác định bằng cách so với các băng băng của đối chứng dương và thang ledder 100bp.Thời gian cho kết quả nhanh .Điện di.Mật độ vi sinh vật gây bệnh hiện diện trong mẫu thực phẩm thường thấp. việc chiết tách và tinh chế DNA từ thực phẩm hay môi trường khi thực hiện phương pháp PCR thường cho phép loại bỏ những hợp chất ức chế. không cần dụng cụ và môi trường chẩn đoán phức tạp. gel được ngâm trong dung dịch ethidium bromide khoảng 30 phút. có thể thực hiện ở hiện trường.Ít tốn kém về mặt nhân sự. Ưu điểm và nhược điểm của phương pháp PCR  Ưu điểm: .Hóa chất cần cho phản ứng PCR dễ tìm và dễ tồn trữ hơn so với trường hợp huyết thanh học.

Kháng nguyên (Antigen) là những chất có khả năng huy động hệ miễn dịch tiết ra kháng thể đặc hiệu với chúng gây ra phản ứng miễn dịch đặc hiệu. Microplate đã trở thành một công cụ tiêu chuẩn trong nghiên cứu phân tích và phòng thí nghiệm thử nghiệm lâm sàng chẩn đoán. axit nucleic. Kháng nguyên bao gồm protein lạ. Elisa có thể sử dụng phát hiện và định lượng vi sinh trong thực phẩm trong thời gian vài giờ sau khi tăng sinh.coli có 3 cấu trúc kháng nguyên với tên gọi là O ( kháng nguyên thân).1 Nguyên tắc Sử dụng kháng thể đơn dòng phủ bên ngoài những đĩa giếng (microplate). Kháng thể ( Antibody ) là protein ‫ ﻹ‬globulin được sinh ra bởi tế bào lympo tham gia phản ứng miễn dịch đặc hiệu với kháng nguyên Đĩa giếng ( microplate) là một tấm phẳng với nhiều "giếng" được sử dụng như ống nghiệm nhỏ. Kỹ thuật này có độ nhạy phát hiện khoảng 106CFU/ml(một số báo cáo cho rằng giới hạn này có thể đạt được 104) II. Các kháng nguyên này sẽ được phát hiện bằng cách sử dụng kháng thể thứ cấp có gắn với enzyme như horseradish peroxidase hay alkaline phosphate. các cơ sở xét nghiệm chẩn đoán y tế hiện đại nhất ở người và động vật. enzyme sẽ xúc tác phản ứng thủy phân cơ chất để tạo ra các phản ứng có màu hay phát sáng. Hình2. một số lipit và poli saccarit.9: Đĩa giếng (microplate) Elisa đã được sử dụng rộng rãi dưới dạng các bộ hóa chất (kit).[Type text] [Type text] [Type text] này cho phép phát hiện bào tử. kháng nguyên này sẽ được giữ lại trên bề mặt giếng. dạng tiềm sinh hay tế bào đã chết của các vi sinh vật gây bệnh hoặc gây ngộ độc. Khi bổ sung một cơ chất đặc hiệu enzyme vào giếng.2.1 Nguyên tắc [Type text] Page 28 . K (Kháng nguyên bề mặt) và H (kháng nguyên lông). Bằng cách theo dõi sự đổi màu. Nếu có sự hiện diện của kháng nguyên mục tiêu trong mẫu. Cấu trúc kháng nguyên:  E. có thể phát hiện sự hiện diện và định lượng kháng nguyên. Phương pháp ELISA 2. 2.2 Các phương pháp Elisa : 2. Một sử dụng rất phổ biến trong các khảo nghiệm miễn dịch liên kết enzyme ( ELISA).

.Chuyển KN đã biết lên bề mặt cứng ( được gọi chung là các đĩa).Thêm dung dịch protein không tương tác (non-interacting protein) như albumin huyết thanh bê (bovine serum albumin) hay casein vào tất cả các mẫu (kể cả mẫu chuẩn). Cấu trúc kháng nguyên:  E.ﻹ‬globulin được sinh ra bởi tế lympo tham gia phản ứng miễn dịch đặc hiệu với kháng nguyên Elisa đã được sử dụng rộng rãi dưới dạng các bộ hóa chất (kit). axit nucleic. Kỹ thuật này có độ nhạy phát hiện khoảng 106CFU/ml(một số báo cáo cho rằng giới hạn này có thể đạt được 104).coli có 3 cấu trúc kháng nguyên với tên gọi là O ( kháng nguyên thân). KN sẽ được cố định trên bề mặt.Thêm KT thứ cấp (secondary antibody).Rửa bề mặt đĩa sau đó chuyển kháng thể (biết trước) vào tất cả các giếng của đĩa. KT thứ cấp sẽ kết hợp với bất kỳ một KT còn dư (bước này có thể được bỏ qua nếu kháng thể dùng để phát hiện KN đã gắn với enzyme). một số lipit và poli saccarit. Nồng độ của các mẫu kháng nguyên này dùng để thiết lập đường chuẩn cho việc tính nồng độ của kháng nguyên trong các mẫu chưa biết. Kháng nguyên bao gốm protein lạ. K (Kháng nguyên bề mặt) và H (kháng nguyên lông). Elisa có thể sử dụng phát hiện và định lượng vi sinh trong thực phẩm trong thời gian vài giờ sau khi tăng sinh.2. Kháng nguyên ( Antigen ) là những chất có khả năng huy động hệ miễn dịch tiết ra kháng thể đặc hiệu với chúng gây ra phản ứng miễn dịch đặc hiệu. . 2. [Type text] Page 29 . kháng nguyên này sẽ được giữ lại trên bề mặt giếng. Khi bổ sung một cơ chất đặc hiệu enzyme vào giếng. Các kháng nguyên này sẽ được phát hiện bằng cách sử dụng kháng thể thứ cấp có gắn với enzyme như horseradish peroxidase hay alkaline phosphate. Nếu có sự hiện diện của kháng nguyên mục tiêu trong mẫu.Chuyển các mẫu KN chưa biết vào các giếng khác.2. .1.[Type text] [Type text] [Type text] Sử dụng kháng thể đơn dòng phủ bên ngoài những đĩa giếng (microplate). Kháng thể ( Antibody ) là protein ‫ .2. có thể phát hiện sự hiện diện và định lượng kháng nguyên. . Bằng cách theo dõi sự đổi màu.2 Các phương pháp Elisa : 2. Bước này được gọi là "blockin" do protein huyết thanh có tác dụng ngăn cản sự hấp phụ của các protein khác lên bề mặt của đĩa. KT sẽ kết hợp với các KN đã được cố định mà không kết hợp với protein của huyết thanh. KN chưa biết được hòa tan trong cùng một loại dung dịch đệm giống các mẫu KN chuẩn. enzyme sẽ xúc tác phản ứng thủy phân cơ chất để tạo ra các phản ứng có màu hay phát sáng. ELISA gián tiếp (indirect ELISA) gồm các bước chính: .

2. Hình 2. Enzyme sẽ làm biến đổi cơ chất làm sản sinh tín hiệu huỳnh quang hay tín hiệu điện hóa học (enzyme có tác dụng như yếu tố khuyếch đại). (3) kháng thể dùng để phát hiện được thêm vào và kết hợp với KN. KT thứ cấp sẽ gắn với [Type text] Page 30 . . (9) Đo cường độ ánh sáng. (8) Thêm cơ chất. tín hiệu huỳng quang.2 Sandwich ELISA: Phương pháp được sử dụng để phát hiện KN trong mẫu nghiên cứu và bao gồm các bước cơ bản sau (quy trình có thể được thay đổi trong nhiều trường hợp): (1) Chuẩn bị bề mặt (microtiter) có gắn KT (2) Khóa tất cả những vị trí gắn kết không đặc hiệu trên bề mặt.Rửa đĩa.[Type text] [Type text] [Type text] . qua đó xác định sự có mặt và hàm lượng KT.Thêm cơ chất. Sandwich ELISA hạn chế được nhược điểm này.2. (3) Phủ mẫu chứa kháng KN cần xác định (4) Rửa đĩa.. kháng KN không được gắn kết sẽ bị rửa trôi (5) Thêm các KT đặc hiệu cho KN cần chẩn đoán (6) Thêm KT thứ cấp đã được gắn với enzym (KT thứ cấp đặc hiệu cho KT sơ cấp ở bước 5) (7) Rửa đĩa. phần không gắn kết sẽ bị rửa trôi.10: Các bước tiến hành trong Sanwich ELISA Các bước trong Sandwich ELISA.. (4) Thêm KT thứ cấp liên kết với enzyme.2. phát quang hay tín hiệu hóa điện. tín hiệu điện hóa. (1) Phủ đĩa bằng KT (2) Thêm mẫu cần xác định KN. Nhược điểm cơ bản: Bước cố định KN không có tính đặc hiệu nên bất kỳ protein nào cũng gắn với bề mặt đĩa vì vậy KN (có nồng độ thấp) phải cạnh tranh với các protein khác trong huyết thanh khi gắn kết với bề mặt của điwax. KN (nếu có) sẽ gắn với KT. các kháng thể gắn enzyme còn dư sẽ được loại bỏ. Enzym sẽ biến đổi cơ chất tạo màu.

ủ ở nhiệt độ phòng trong 2 giờ hoặc lắc ở 37oC sau 1 giờ. Đổ bỏ dung dịch có trong microplate.3. 2. Phủ đĩa bằng 200µl dung dịch sữa tách bơ 5% mỗi giếng. Rồi [Type text] Page 31 .[Type text] [Type text] [Type text] KT dùng để phát hiện.Kháng nguyên chuẩn. PBS.Máy đọc phản ứng.3. Lượng enzym còn dư sẽ giải phóng tín hiệu hỳnh quang hay tín hiệu màu.Bước 2.conjugate (chất gắn kết) có gắn enzym peroxidase. (4) Thêm KT thứ cấp (KT của KT ở bước 1). lượng KT gắn thành công với KN trong đĩa càng thấp do "cạnh tranh". 2. Phản ứng Elisa gián tiếp: a. KT không được gắn kết sẽ bị rửa trôi.2. . ELISA cạnh tranh: (1) "Ủ" KT không được đánh dấu với KN. và đập khô. (5) Thêm cơ chất. . Lượng KN càng lớn. Sữa tách bơ(casein). Thời gian ủ kháng nguyên thường là qua đêm ở nhiệt độ 4oC hoặc 37oC trong 2h.1. hàm lượng KN gốc càng cao. b. Trình tự phản ứng: . thường là TMBZ (3. (5) Thêm cơ chất. Một số trường hợp. Phát hiện E. Đổ bỏ dung dịch có trong microplate. tín hiệu sản sinh càng yếu.Bước 1.05% rửa đĩa 3 lần.Microplate . (2) Đưa hỗn hợp này vào các giếng của vi phiếm có chứa KN. bub ∆ = trate (chất tạo màu phản ứng. Phủ kháng nguyên 100µl kháng nguyên pha loãng ở nồng độ thích hợp được gắn trưc tiếp vào đĩa microplate.3. 0. enzym được gắn với KN chứ không phải KT.2. Rồi dùng dung dịch PBS( Phosphate Buffer Saline) có chứa Tween 20.3’ 5. Enzym sẽ làm biến đổi cơ chất và phát tín hiệu có thể phát hiện và đo được.coli O157:H7 bằng phương pháp Elisa: 2. (3) Rửa đĩa.5’ tetramethybenzodine)). KT thứ cấp gắn với enzym.PBS-Tween. huyết thanh thỏ. Trong phương pháp này. Nguyên liệu: .

Cơ chất tạo màu : 100µl TMB vào mỗi giếng. 2.coli O157:H7 có hai loại kháng ngyên có ý nghĩa trong chuẩn đoán là 0 kháng nguyên O157 và H7. để nhiệt độ phòng 15 phút.000 lần. Rồi dùng dung dịch PBS( Phosphate Buffer Saline) cò chứa Tween 20. phản ứng sẽ chuyển sang màu xanh lục nếu là dương tính.05% rửa đĩa 3 lần.Nhanh chóng và thuận tiện .[Type text] [Type text] [Type text] dùng dung dịch PBS( Phosphate Buffer Saline) cò chứa Tween 20.05% rửa đĩa 5 lần.Kháng thể đơn dòng có thể chi phí nhiều hơn so với các kháng thể đa dòng. . . và đập khô. Kháng thể đặc hiệu loài : 100µl conjugate pha loãng bằng PBS với độ pha loãng là 10. 2.Bước 5.4 Ứng dụng của kháng thể đơn dòng trong xác định E. . o Kháng thể đơn dòng đặc hiệu MAB 46E9-9 nhận biết đặc hiệu kháng nguyên lông H7 của loài E. Dừng phản ứng bằng dung dịch H2SO4 1M. và đập khô. [Type text] Page 32 .05% rửa đĩa 3 lần. nhỏ mỗi giếng và ủ ở 37oC trong 30 phút.Bước 4. .Bước 3. . lúc này phàn ứng có màu vàng. lắc sau 30 phút.Kháng nguyên của nồng độ rất thấp hoặc không biết có thể được phát hiện kể từ khi bắt giữ kháng thể chỉ lấy kháng nguyên cụ thể . 0. . . Đổ bỏ dung dịch có trong microplate. Kháng thể ủ trong đĩa ở nhiệt độ 37 oC. và đập khô.coli O157:H7 o E.Chỉ có các kháng thể đơn dòng có thể được sử dụng như cặp phù hợp.coli . Vì vậy.coli O157:H7.5 Ưu điểm của phương pháp Elisa Ưu điểm: . 0. Đọc đĩa trên máy đọc đĩa ELISA ở bước sóng 450 nm. Rồi dùng dung dịch PBS( Phosphate Buffer Saline) cò chứa Tween 20. đươc đo nồng độ protein và giữa ở nhiệt độ -20 C. Gắn kháng thể : 100µl huyết thanh pha loãng ở nồng độ thích hợp bằng dung dịch PBS-sữa tách bơ 5%. 0. .Thời gian xét nghiệm lâu. Nhược điểm: .Bước 6. kháng thể đơn dòng đặc hiệu với các epitop của hai loại kháng nguyên này thường sử dụng để xác định vi khuẩn trong các hệ thống chuẩn đoán huyết thanh.Kháng nguyên thu hoạch như trên. o Kháng thể MAB 13C4 nhận biết theo hướng nhận biết kháng nguyên độc tố Stx1 của E. Đổ bỏ dung dịch có trong microplate.

coli O157:H7. Phức hợp hạt nano silica + kháng thể đặc hiệu có thể được tạo ra bởi nhiều cơ chế khác nhau. gắn kết không hóa trị của hạt nano silica được bọc streptavidin với các kháng thể được biotin hóa biotinylated.[Type text] [Type text] [Type text] - Enzyme / chất nền phản ứng trong microwells phải được đọc càng sớm càng tốt 3. xác định số lượng vi khuẩn (VK) đích bằng đường chuẩn giữa cường độ phát quang của VK gắn hạt nano và số lượng VK trong dung dịch chuẩn. Có nhiều cách phát hiện vi khuẩn đích như: quan sát và đếm trực tiếp các tế bào vi khuẩn phát quang dưới kính hiển vi huỳnh quang. các nhà khoa học đã chế tạo thành công công thức phức hợp kháng thể đặc hiệu vi khuẩn đích + hạt nano silica băng cách găn trực tiếp các phân tử kháng thể lên bề mặt hạt silica thông qua liên kết amine-carbonxylic với sự có mặt của chất xúc tác EDAC (1-Ethyl-3-(3-dimethylaminopropyl carbodiimide hydrochloride) [Type text] Page 33 . Mỗi kiểu gắn kết có những ưu điểm và hạn chế riêng. Tuy nhiên. gắn kết các peptide được gắn histidine hoặc các kháng thể lên các chấm lượng tử được Ni-NIA hóa. người ta đã và đang ứng dụng các loại vật liệu nano phát quang như hạt silica chứa tâm màu hay chấm lượng tử QD chứa các nhóm chức năng sinh học trên bề mặt như một chất đánh dấu huỳnh quang để phát hiện nhanh và chính xác số lượng vi khuẩn gây bệnh thực phẩm bằng kỹ thuật miễn dịch huỳnh quang. Người ta đã sử dụng nhiều phương pháp khác nhau để phát hiện chúng như: đếm tế bào dưới kính hiển vi.coli bằng phức hợp kháng thể + hạt nano silica phát quang Trong số các loại vi khuẩn gây ngộ độc thực phẩm. đầu dò enzym. tiến hành kiểm tra các tính chất sinh hóa và ngưng kết đặc hiệu để khẳng định là E. Khâu cốt lõi của kỹ thuật sử dụng hạt nano silica chứa tâm màu là việc chế tạo ra được phức hợp giữa kháng thể đặc hiệu vi khuẩn đích với hạt silica phát quang bền vững. miễn dịch học bằng enzym. Phương pháp phát hiện E. Cường độ phát huỳnh quang là hàm số f của số lượng tế bào vi khuẩn đích trong mẫu. Nhưng nhìn chung. ELISA. xác định khuẩn lạc nghi ngờ E. Ở Việt Nam. gắn kết trực tiếp thông qua các nhóm carbon-hydrate bị oxy hóa trên phần Fc của kháng thể. đếm khuẩn lạc trên đĩa thạch. Phát hiện E. tiến hành kỹ thuật miễn dịch huỳnh quang để phát hiện và xác định số lượng vi khuẩn đích. Để khắc phục nhược điểm nêu trên.coli O157:H7 được xem là rất nguy hiểm với liều gây độc thấp (10-100 tế bào).coli O157:H7 trên đĩa thạch SMAC sau khi ủ ấm ở 37oC trong 24 giờ. E. hiện nay có 5 cách để tạo ra phức hợp này là: gắn kết trực tiếp thông qua liên kết amine–carboxylic. Sau khi tạo được phức hợp kháng thể đặc hiệu + hạt nano silica. kít chuẩn PCR. càng nhiều cầu nối trung gian giữa kháng thể và hạt nano chứa tâm màu phát quang càng làm cho phức hợp bền vững hơn và kháng thể không mất hoạt tính lâu hơn. tất cả các phương pháp nêu trên đều không thể phát hiện chính xác số lượng vi khuẩn ở nồng độ thấp. sử dụng SMCC làm xúc tác tạo cặp sulfhydryl-amine. Từ những khuẩn lạc nghi ngờ.coli O157:H7 trong thực phẩm mang tính pháp lý ở Việt Nam là sử dụng kỹ thuật làm giầu.

nhiệt độ ủ ở 300C. 2.9mg. coli O157:H7 được bao bọc bởi phức hợp kháng thể + hạt silica Hình ảnh SEM (kính hiển vi quét) và kính hiển vi đồng tiêu của tế bào E.QDs [Type text] Page 34 . (b) VK gắn với phức hợp kháng thể . coli O157:H7 trong vòng 20 phút.[Type text] [Type text] [Type text] trong các điều kiện sau: EDAC/1 phản ứng là 0. thời gian phát hiện nhanh hơn các phương pháp thông thường nhiều lần. Qua đó có thể khẳng định các hạt nano silica hợp sinh với kháng thể vẫn giữ nguyên tính chất phát quang hiệu quả và các phân tử kháng thể khi gắn với hạt nano silica vẫn giữ được hoạt tính và có khả năng nhận biết và liên kết với vi khuẩn đích Ảnh huỳnh quang: (a) phức hợp hạt nano silica – kháng thể. coli O157:H7 được bao bọc bởi phức hợp kháng thể + hạt silica Ảnh 2: SEM E. Phức hợp kháng thể và hạt silica được tạo thành này có khả năng nhận biết và liên kết đặc hiệu với vi khuẩn đích E. (c) VK gắn với phức hợp kháng thể .Silica. Ảnh 1: TEM E. 1. Giới hạn phát hiện của kỹ thuật này đối vối vi khuẩn đích là 102 CFU/ml. tỉ lệ vi khuẩn đích gắn phức hợp và phát quang đạt > 60% và sau 3 ngày vẫn phức hợp vẫn giữ nguyên hoạt tính. thơi gian phản ứng hợp sinh 3 giờ có lắc ngang . tỉ lệ kháng thể với hạt silica là 40/1.coli O157:H7 được đánh dấu bởi phức hợp kháng thể + hạt nano silica đã chứng minh rằng phức hợp này có thể bao bọc đều hoàn toàn và như nhau lên bề mặt tế bào vi khuẩn.

Viền màu đỏ bao bọc xung quanh tế bào vi khuẩn là phức hợp hạt silica + kháng thể đặc hiệu [Type text] Page 35 . coli O157:H7.coli O157:H7 để phát hiện nhanh.số lượng E. Đây là cơ sở để xây dựng đường chuẩn: cường độ phổ . coli O157:H7: chụp bằng kính hiển vi đồng tiêu Nikon C1plus – Ti-E. nhậy số lượng vi khuẩn này ở mật độ thấp Ảnh huỳnh quang phức hợp Silica – E.[Type text] [Type text] [Type text] Phổ huỳnh quang của phức hợp hạt silica – kháng thể gắn kết với vi khuẩn E.

ngộ độc thực phẩm đã trở thành mối quan tâm của toàn xã hội. Trong thực tế cuộc sống. [Type text] Page 36 . Một trong những loại ngộc độc thực phẩm gây ra bởi vi sinh vật thường gặp là ngộ độc thực phẩm do vi khuẩn E. theo dõi khảo sát đảm bảo vệ sinh an toàn thực phẩm để hạn chế sự ô nhiễm và tác hại của vi khuẩn trong quá trình thu hoạch các sản phẩm nông nghiệp. Ngộ độc thực phẩm thường xảy ra do nguyên liệu dùng chế biến hay thực phẩm bị nhiễm vi khuẩn và độc tố của vi khuẩn. Có nhiều nguyên nhân gây ra các vụ ngộ độc thực phẩm nhưng phần lớn các trường hợp có nguồn gốc từ vi sinh vật.[Type text] [Type text] [Type text] KẾT LUẬN Hiện nay.coli. chăn nuôi. Do đó các phương pháp phát hiện vi khuẩn E. đánh bắt hải sản đến quá trình ‘bảo quản chế biến và nấu nướng tới tay người tiêu dùng thường rất phức tạp và gặp nhiều khó khăn.coli có vai trò quan trọng trong nhiệm vụ đảm bảo vệ sinh an toàn thực phẩm nhằm làm giảm tỷ lệ ngộ độc do vi khuẩn gây nên.

Thử nghiệm này được dùng để phân biệt E. c.pneumotropica (+) với P. THỬ NGHIỆM SINH HÓA 1. Phản ứng trung gian chính của phản ứng oxi hóa tryptophan là indolpyruvic acid IPA. Heamophilus heamoglobinophilus (+) và H.coli (+) với Klebsiella (-). Chủng dùng làm đối chứng (+) cho thử nghiệm này là Proteus rettgeri. Thử nghiệm sinh indol a. Sinh khối chủng thuần được cấy vào ống môi trường lỏng thuộc một trong các loại nêu trên.haemolytica (-) và P. hoặc các môi trường kết hợp như MIU (Motility Indol Urea). Bacillus alvei (+) với các Bacillus khác (thường là -). b.influenzae (-) với các loài Haemophilus khác (thường là -). Viêc phát hiện indol được thực hiện bằng phản ứng của phân tử này với các thuốc thử chứa p-Dimethylaminobenzaldehyde (p-DMABA). để yên vài phút. Nhân pyrrol của indol chứa nhóm CH2 sẽ kết hợp với nhân benzene của p-DMABA tạo nên một phức chất dạng quione màu đỏ. Nhỏ 5 giọt thuốc thử vào ống dịch nuôi cấy. (-) là Serratia marcescens. theo dõi sự tạo màu đỏ trong lớp dung môi hữu cơ. Pasteurella multocida (+) và P. ủ ở nhiệt độ 370C trong 24-48 giờ.urea (-). hai loại thuốc thử có thể sử dụng cho thử nghiệm này là thuốc thử Kovacs và thuốc thử Erlich. SIM (Sulfide Indol Motility)… khi cần kiểm tra cùng lúc nhiều đặc tính sinh hóa cần thiết. Phân tử này sau đó bị biến đổi theo hướng loại nhóm amin (deamination) thành indol hay theo hướng loại nhom1carboxyl (decarboxylation) thành skatol.[Type text] [Type text] [Type text] PHỤ LỤC I. Phương pháp tiến hành Môi trường sử dụng cho thử nghiệm này có thể là nước tryptone. Đọc kết quả [Type text] Page 37 . Trước khi bổ sung thuốc thử có thể bổ sung 1ml ether hoặc xylene vào ống nghiệm. Proteus mirabilis (-) với các loài Proteus khác (+). Trytophanase xúc tác phản ứng loại nhóm amin để tạo thành indol. Nguyên tắc Trytophan là một acid amin có thể bị oxi hóa bởi một số vi sinh vật có hệ enzyme trytopanse tạo nên các sản phẩm chúa gốc indol. lắc đều để chiết tách indol lên lớp dung môi hữu cơ.

Tương tự. là tiền chất methyl hóa của indol. glucose được lên men kỵ khí sinh ra các acid hữu cơ làm giảm pH của môi trường. Để đáp ứng nhu cầu năng lượng cho tăng trưởng. Ngược lại. môi trường KIA chứa hai loại đường là 1% lactose và 0.1% glucose. TSI a. Khả năng sử dụng cà hai nguồn đường là glucose và lactose hay chỉ sử dụng glucose để thu lấy năng lượng cần cho tăng trường là tùy thuộc vào di truyền của chủng vi sinh vật và có thể được theo dõi trên ống thạch chứa môi trường KIA. sử dụng các glucose và lactose. . đôi khi có sự xuất hiện của màu cam do skatol. lactose) và khả năng sinh H2S của chủng vi sinh vật Về nguồn carbon.[Type text] [Type text] [Type text] Thử nghiệm là (+) khi có sự xuất hiện của lớp màu đỏ trên bề mặt môi trường. là (-) khi có lớp màu vàng của thuốc thử trên bề mặt môi trường. có ba trường hợp có thể xảy ra đối với sự tăng trưởng của chủng vi sinh vật thử nghiệm: chỉ sử dụng glucose. [Type text] Page 38 . ở phần sâu trong môi trường mới có điều kiện oxi không đầy đủ. Khi chủng cấy lên môi trường này. 2. tạo ra. nếu trong môi trường có chất chỉ thị là đỏ phenol thì trên mặt thạch nghiêng sẽ có màu đỏ và phần sâu có màu vàng.Nếu vi sinh vật không sử dụng được cả hai nguồn carbon này. . sau 18-24 giờ nuôi toàn bộ môi trường đều trở nên có pH acid vì sự biến dưỡng đồng thời cá glucose và lactose ở bề mặt môi trường giúp vi sinh vật đủ năng lượng để tăng trưởng mà không cần phải sử dụng đến pepton. môi trường TSI có thành phần như môi trường KIA nhưng có them 1% sucrose (saccharose). vi sinh vật tiến hành dị hóa pepton trong môi trường qua đó giải phóng NH3 làm phần bể mặt của môi trường mới có pH kiềm. không sử dụng cà hai loại đường này. . Thử nghiệm KIA. Nguyên tắc Môi trường KIA (Ligler Iron agar) và môi trường TSI (Triple Sugar iron Agar) được sử dụng để kết hợp thử nghiệm đồng thời khả năng sử dụng các nguồn carbon khác nhau (glucose. sau 18-24 giờ nuôi cấy môi trường bề mặt của ống thạch nghiêng trở nên có pH kiềm và phần sâu trong ống có pH acid. thì pepton được sử dụng để biến dưỡng thu năng lượng và vật chất cấn cho sự tăng trưởng của vi sinh vật.Nếu vi sinh vật có thể sử dụng cả glucose và lactose. Điều này có thể được giải thích là lượng glucose trong phần bề mặt của môi trường được vi sinh vật oxi hóa hoàn toàn thành H2O và CO2 để thu năng lượng.Nếu vi sinh vật chỉ lên men glucose. Khả năng này của vi sinh vật có thể được xác định thong qua sự đổi màu của chỉ thị pH trong môi trường ở trên bề mặt và bên trong môi trường trong ống thạch nghiêng.

Ghi nhận màu. do pepton chỉ được biến dưỡng trong điều kiện hiếu khí nên hiện tượng kiềm hóa môi trường chỉ diển ra trên phần của bề mặt môi trường và chỉ phần này trở nên có màu đỏ. 3. các hiện tượng lien quan đến sử dụng nguồn carbon cũng xảy ra tương tự. Trong các trường hợp nêu trên. Chỉ thị đỏ methyl red giúp phân biệt nồng độ ion H + hiện diện trong môi trường sau khi vi sinh vật lên men glucose.Thử nghiệm sinh H2S: thử nghiệm là (+) nếu xuất hiện tủa màu nâu đen bên trong môi trường. Thử nghiệm khả năng sinh H2S có thể thực hiện đồng thời trên hai môi trường này do thành phần môi trường có chứa sodium thiosulphate.Thử nghiệm khả năng sử dụng đường: xem mục nguyên tắc.4 màu cam trong vùng pH [Type text] Page 39 . là (-) nếu không xuất hiện tủa nâu đen. . Trong khi đó. c. Đọc kết quả . b. Nguyên tắc Thử nghiệm MR nhằm phân biện vi sinh vật dựa trên sự khác biệt về khả năng tạo ra và duy thì các sản phẩm biến dưỡng có tính acid bền trong môi trường trong quá trình lên men glucose. Thử nghiệm MR (Methyl Red) a. hấp khử trùng và chuyển vào các ống thạch nghiêng sao cho đỉnh thạch nghiêng cách nắp ống nghiệm khoảng 2. màu ở mặt thạch nghiêng. Phương pháp tiến hành Môi trường KIA hay TSI được pha chế. Trường hợp sử dụng môi trường TSI. Sau khi cấy giống. Chỉ thị này có màu thay đổi khác nhau tùy dãy pH hay nồng đô ion H+: đỏ khi ph thấp hơn 4. sau đó ria trên bề mặt thạch nghiêng. sự sinh khí ở phần sâu. sự tạo thành màu nâu bởi FeS.5cm. nếu sự lên men được tạo ra các sản phẩm khí thì khí sẽ tích tụ bên trong thành bọt khí hay sẽ làm vỡ thạch. dung que cấy thẳng cấy sinh khối từ khuẩn lạc của chủng thuần vào phần sâu của ống thạch nghiêng nhưng tránh chạm đáy ống.5cm và phần sâu có chiều cao khoảng 2. các ống thạch nghiêng được ủ ở 370C từ 18-24 giờ.[Type text] [Type text] [Type text] Tuy nhiên. phần môi trường sâu trong ống nghiệm sẽ không có hiện tược đổi màu. Vi sinh vật khử sulfate có thể khử hợp chất này để giải phóng H2S tạo ra sẽ được phát hiện dựa vào phản ứng tạo kết tủa màu đen FeS giữa H2S và ion Fe2+ của chỉ thị ferric ammonium citrate hiện diện trong môi trường.

Họ Enterbacteriaceae có đặc tính [Type text] Page 40 . đọc kết quả ngay. sau đó pyruvic acid tiếp tục được chuyển hóa theo các con đường sinh hóa khác nhau tạo ra các sản phẩm lên men cuối cùng khác nhau. bảo quản ở 40C) vào trong ống nghiệm dịch nuôi cấy. Đọc kết quả Thử nghiệm MR là (+) khi môi trường có màu đỏ sau khi bổ sung thuốc thử. Phương pháp tiến hành Thử nghiệm được tiến hành trong các ống môi trường lỏng Glucose Phosphate (MR-VP broth). là (-) khi có màu vàng. ủ ở 370C trong khoảng 2-5 ngày. Them vài giọt thuốc thử methyl red (0.[Type text] [Type text] [Type text] 5. Dung que cấy vòng cấy một lượng nhỏ sinh khối từ khuẩn lạc chủng thuần trên môi trường KIA. trường hợp các vi sinh vật cho phản ứng MR(-) sẽ tiếp tục chuyển hóa các sản phẩm có tính acid đã được tạo ra thành các sản phẩm trung tính làm cho pH trong môi trường chuyển dần về phía trung tính. Nguyên tắc Ở vi sinh vật. (+) với các loài Bacillus Gram âm khác không thuộc đường ruột (-). Yersinia spp. các vi sinh vật có phản ứng MR (+) có đặc tính là tích lũy acid trong môi trường ngày càng nhiều hơn và độ pH trong môi trường ngày càng giảm. Tuy nhiên các vi sinh vật này đều tạo acid trong môi trường ngay khi chúng bắt đầu tăng trưởng. biến dưỡng năng lượng bằng phương thức lên men từ glucose qua con đường đường phân sẽ tạo ra chất trung gian chủ yếu là pyruvic acid. ngược lại. c. Enterbacter aerogenes (-) với Enterbacter cloacae (+).02% trong hỗn hợp cần nước có tỷ lệ 3:2. Đối với các vi sinh vật đường ruột. Trường hợp màu cam.0 – 5. thời gian nuôi cấy để thử nghiệm phản ứng MR thường được xác định trpong khoảng 18-24 giờ. Thử nghiệm này giúp phân biệt E. 4. xác định Listeria monocytogenes (+). Chủng dùng làm đối chứng (+) cho thử nghiệm này là Proteus rettgeri. màu vàng khi pH trên 6. Để khôi phục dự trữ NAD+ trong tế bào phục vụ cho con đường đường phân. Hàm lượng ion H + này phụ thuộc vào tỷ lệ CO2 và H2và con đường chuyển hóa đường của từng loài vi sinh vật. b. ở các loài vi sinh vật. Thử nghiệm VP (Voges-Prokauer) a. (-) là Serratia marcescens. Thử nghiệm MR phụ thuộc rất nhiều vào thời gian nuôi cấy và thường được tiến hành trong thời gian khoảng 3-5 ngày ở 370C. cần tiếp tục ủ ống môi trường có giống trong 4 ngày và thục hiện lại thử nghiệm. khi héo dài thời gian nuôi cấy.8.0.coli (+) với Klepsiella (-).

ethanol. Diacetyl kết hợp với nhân guanidine có trong pepton kết tụ thành phức diacetyl-guanidine có màu đỏ. dung dịch B là 0. 2. AMC) từ 2. đến lượt mình acetion bị oxi hóa thành diacetyl. Sau thời gian ủ. bổ sung thuốc thử trực tiếp vào ống môi trường. có 3 loại thuốc thử VP là: . Phân tử 2.3-butanediol có thể chuyển hóa qua lại thành aceton: trong điều kiện có oxi và môi trường có tính kiềm.[Type text] [Type text] [Type text] chung là lên men sinh hỗn hợp acid như acid formic. Nhu vậy. dung dịch B là 40% KOH hoặc NaOH. có pH 6. Chủng dùng làm đối chứng (+) cho thử nghiệm này là Serratia marcescens. Trong thuốc thử Koblentz và O’Meara có chứa creatime có tác dụng bổ sung nguồn nhân guanidine. trường hợp nghi ngờ nên tiến hành ủ các ống môi trường song song ở hai điều kiện nhiệt độ. họ này có thể được chia thành hai nhóm là nhóm không sinh 2.3butanediol (ví dụ như E. Sự oxi hóa acetion thành diacetyl được tăng cường nhờ xúc tác của α-napthol.(. acetoin có thể bị khử thành 2.3% creatine 40% KOH hoặc NaOH.coli) và nhóm sinh 2. 2. khi có oxi và pH kiềm. Do vậy.Thuốc thử Barrit: gồm dung dịch A là 5% α-napthol trong cồn tuyệt đối. b. acetoin còn bị oxi hóa thành diacetyl. Enterobacter).3-butanediol bị chuyển hóa thành acetion. ngược lại. . để xác định Listeria monocytogenes (+).3-bute\anediol dehydrogenase. (-) là Proteus rettgeri. Ngoài ra.3-butanediol bị oxi hóa thành aceton nhờ xúc tác của enzyme 2.Thuốc thử O’Meara: dung dịch 0. Phương pháp tiến hành Môi trường được sử dụng cho thử nghiệm VP là môi trường lỏng Clark-Lubs (môi trường MR-VP). Ủ yên các ống môi trường này ở 370C trong 20-48 giờ hoặc đến 10 ngày khi cần thiết. . H2 và CO2.Thuốc thử Koblentz: gồm dung dịch A là 5% α-napthol trong cồ 95%. phân biệt một số loài của Klebsiella. acid acetic. Thử nghiệm VP được dung để phân biệt Klebsiella pneumonia (+) và Enterbacter (+) với E. chất này tham gia vào phản ứng tạo màu trong thử nghiệm VP. acid succinic. Như vậy.coli (-).3-butanediol (ví dụ như Klebsiella.3-butanediol thành diacetyl. Dùng que cấy vòng cấy vào các ống môi trường MRVP một ít sinh khối ( trường hợp dùng thuốc thử Koblenntz như dưới đây thì cấy nhiều sinh khối) từ khuẩn lạc của chủng thuần đã ủ 18-24 giờ trên môi trường KIA hoặc TSI. một số loài như Enterobacter hafniae có kết quả thử nghiệm VP không ổn định ở 370C nhưng cho (+) ở 25-300C.3% creatine 40% KOH hoặc NaOH. [Type text] Page 41 . thử nghiệm VP có thể giúp phân biệt các loài trong Enterbacteriaceae dựa trên sự oxi hóa acetion (acetylmethylcarbinol.3-butanediol do hoạt tính của enzyme diacetyl reductase.

Đọc kết quả sau 20 phút hoặc chậm nhất 4 giờ.[Type text] [Type text] [Type text] Khi sử dụng các loại thuốc thử có 2 thành phần. sản phẩm tạo ra chủ yếu là acetoin và lactate.coli (VP-) và Enterobacter cloacae (VP+).coli (-) trong thử nghiệm IMViC. Phương pháp tiến hành Môi trường sử dụng cho thử nghiệm khả năng biến dưỡng citrate là môi trường rắn Simmons Citrate Agar (CSA) hay môi trường Christensens Citrate Sulfide Agar (CCSA). Như vậy sự biến dưỡng citrate bởi vi sinh vật sẽ tạo ra CO2 làm kiềm hóa môi trường. trước tiên nhỏ 6 giọt dung dịch A. bổ sung 1ml thuốc thử vào ống môi trường. Đọc kết quả Thử nghiệm VP là (+) khi có màu đỏ trên bề mặt môi trường. lượng acetate cà formate tạo thành sẽ tăng trong khi lactate và CO 2 giảm. đối với thuốc thử 1 thanh2n phần. sự biến dưỡng citrate thường thong qua sự kết hợp với acetylCoA thành oxaloacetate để vào chu trình tricarboxylic acid (chu trình Krebs). Ở pH trung tính sản phẩm chủ yếu là COP2 và acetate. Trước khi sử dụng nên kiểm tra thuốc thử bằng các chủng đố chứng như E. Ở pH acid. hoặc để phân biệt Edwardsiella (-) với Salmonella (+). là (-) khi bề mặt môi trường không đổi màu. Như vậy trong môi trường thử nghiệm khả năng sử dụng citrate làm nguồn carbon duy nhất có chứa đạm ở dạng muối ammonium. sau đó nhỏ 2 giọt dung dịch B. b. [Type text] Page 42 . Mặt khác mọi vi sinh vật có khả năng sử dụng citrate làm nguồn carbon duy nhất đều có khả năng dùng muối ammonium làm nguồn đạm duy nhất. c. Enterbacter (+) với E. lắc nhẹ ống 1 phút để oxi hóa acetone. khả năng tăng trưởng của chủng sẽ thể hiện qua khả năng biến dưỡng nguồn carbon citrate và nguồn đạm ammonium làm tăng giá trị pH của môi trường. khi pH tăng. Chủng dùng làm đối chứng (+) cho thử nghiệm này là Proteus rettgeri. Sự phân giải của muối ammonium dùng làm nguồn đạm trong môi trường sẽ sinh NH3 làm kiềm hóa môi trường. Thử nghiệm này được dùng để phân biết nhóm Klebsiella. môi trường chuyển sang kiềm. Nguyên tắc Một số vi sinh vật có khả năng sử dụng citrate làm nguồn carbon duy nhất để thu lấy năng lượng và vật chất. Thử nghiệm khả năng biến dưỡng citrate a. Sự gia tăng giá trị pH này được chỉ thỉ bằng sự đổi màu của chỉ thị pH trong môi trường. 5. (-) là Staphylococcus epidermidis. Sản phẩm biến dưỡng citrate thay đổi tùy pH của môi tường.

[Type text] [Type text] [Type text] Môi trường CSA chứa sodium citrate hoặc potassium citrate làm nguồn carbon duy nhất. Chỉ thị này có màu vàng ở pH dưới 6.Trường hợp môi trường CSA.2 ở 250C. thử nghiệm là (+) khi môi trường chuyển sang màu đỏ. trộn đều 3 dung dịch đạt thể tích cuối là 1 lít. Rót vào mỗi ống nghiệm có chứa ống Durham 10ml môi trường BGBL. Ở pH acid (dưới 6. chỉ thị bromothymol blue.5 g Page 43 . Chủng vi sinh vật được cấy và ủ trong điều kiện tương tự như trường hợp môi trường CSA.9. .Trường hợp môi trường CCSA. pH 6. pH 6. Hấp ở 1100C trong 15 phút. chỉ thị màu là phenol red.0133 g 1 lít Hòa tan peptone và lactose vào trong 500ml nước cất. Brilliant Green Bile Lactose Broth (canh BGBL) Peptone Lactose Mật bò Brilliant green Nước cất 10 g 10 g 20 g 0. Chủng thuần trên môi trường KIA hoặc môi trường thích hợp khác được cấy ria trên bề mặt môi trường CSA rắn trong ống thạch nghiêng. 2.4. MỘT SỐ MÔI TRƯỜNG VÀ THUỐC THỬ THÔNG DỤNG 1.3 [Type text] 20 g 1.8). ống thạch được ủ ở 35 0C trong 24-48 giờ hoặc kéo dài đến 4 ngày khi cần thiết. Đọc kết quả . mật bò vào trong khoảng 200ml và brilliant green trong khoảng 100ml nước cất.4) trở thành màu đỏ. chinh pH môi trường khoảng 7. (-) khi không có khuẩn lạc và môi trường giữ nguyên màu xanh lục.2 ± 0. (-) khi môi trường không đổi màu.6. pH 7. Môi trường CCSA chứa nguồn đạm là cystein. Môi trường chưa sử dụng có màu thay đổi từ màu kem đến nâu.7.0 màu xanh lục ở pH trung tính và màu xanh dương ở ph lớn hơn 7. màu chỉ thị trở thành vàng và ở pH kiềm (trên 8. thử nghiệm la (+) khi xuất hiện khuẩn lạc và môi trường chuyển sang màu xanh dương. EC Broth ( Canh EC) Trypticase or tryptose Muối mật No. II. c.

5 g 5 g 1 lít Rót môi trường vào ống nghiệm có chứa ống Durham.0 ml 3. 3.0.0 g 8.0 ml Điều chỉnh pH tới 7.9 ± 0.0 g 2. chia ra bình. 4.0 g 5.0 g 20. pH 6.225 g Page 44 .0 g 1000. Tiệt khuẩn 15 phút ở 1210C 5.2. Canh thang dinh dưỡng Beef extract Peptone Nước cất Điều chỉnh pH tới 7.0 g 0. Tiệt khuẩn 5 phút ở 1210C.0 g 0.2. Canh thang KCN Proteose peptone Sodium chloride Potassium dihydrogen phosphate [Type text] 3.0 g 5.[Type text] [Type text] [Type text] Lactose K2HPO4 KH2PO4 NaCl Nước cất 5 g 4 g 1. cứ mỗi bình 30ml. Canh thang EE Peptone Glucose Disodium hydrogen phosphate Potassium dihydrogen phosphate Ox bile Brilliant green Nước cất 10.015 g 1000.0 g 5. Hấp ở 1210C trong 15 phút.

Bằng cách vô khuẩn và thận trọng. 8. tryptone hoặc trypticase Lactose Dipotassium monohydrogen phosphate Potasssium dihydrogen phosphate Sodium chloride Sodium lauryl sulphate Nước cất 20.6. Canh thang L-ST Tryptose. 7. mỗi ống 10 ml với ống Durham lộn ngược.0 g 0.01 g 1000. Canh thang MacConkey Peptone Lactose Ox gall Bromocresol purple Nước cất 20.0 ml Điều chỉnh pH tới 7.0 g 1. mỗi ống 1 ml. đóng nút bằng nút bần thấm perafin và bảo quản ở 5-60C.[Type text] [Type text] [Type text] Nước cất 1000. để nguội và cho vào tủ lạnh 580C.0 g 10. Tiệt khuẩn 15 phút ở 1210C.75 g 2.75 g 5. 6.0 g 5. mỗi bình 225 ml.5% lạnh (5-80C) lắc nhẹ nhàng và phân ra ống nghiệm .0 ml Page 45 .0 g 5. phân vào bình tam giác.0 g 5.0 ml Điều chỉnh pH tới 6.1 g 1000. Phân ra ác ống nghiệm. Tiệt khuẩn 10 phút ở 1210C. Canh thang Nitrate Meat extract Peptone Potassium nitrate Nước cất [Type text] 3.0 g 1000. cho thêm 15 ml cyanid 0.0 g 0.0 ml Điều chỉnh pH tới 7. Diệt khuẩn 15 phút ở 1210C.8.3.0 g 2.

10. 11.0 ml Điều chỉnh pH tới 7.0 10. phân ra ống nghiệm. Môi trường lên men carbohydrate Meat extract Peptone Sodium chlotide Chỉ thị Nước cất 3. Môi trường Indol Tryptone Sodium chloride DL-trytophan Nước cất 10. [Type text] Page 46 . phân ra các ống nghiệm có ống Durham .8 ± 0.1 g 1 lít Hấp ở 1210C trong 15 phút.0. pH môi trường là 6.0 5.75 g 0.0 g g g g 1000. Tiệt khuẩn 15 phút ở 1210C.0 phân ra các ống nghiệm đường kính 16mm.0 g 1000.1-7.0 g 1.75 g 2.0 10.[Type text] [Type text] [Type text] Điều chỉnh pH tới 7.0 g 5. Lauryl Sulphate Broth LSB (canh Lauryl Sulphate) Trytose Lactose Sodium chloride K2HPO4 KH2PO4 Lauryl sulphate Nước cất 20 g 5 g 5 g 2. 9. Tiệt khuẩn 15 phút ở 1210C.2. Tiệt khuẩn 15 phút ở 1210C.0 ml Điều chỉnh pH 7. mỗi ống 5 ml.2.

12. Tiệt khuẩn 20 phút ở 1150C. Thạch L-EMB a.2 g 0. 14. pH cuối 6.Peptone Lactose Dipotassium hydrogen phosphate Agar Nước cất [Type text] 10. lactose.08 g 15 g 1 lít Đun nhẹ và thỉnh thoảng lắc.0 g 10.0 g 1000. trừ disaccharide phải tiệt khuẩn bằng lọc hoặc ở 1210C trong 10 phút và cho vào môi trường cơ bản đã tiệt khuẩn trước. 13.0 g 2. hấp ở 1210C trong 15 phút. Phân phối vào 1/3 ống nghiệm có nắp 1 x 100 hoặc 16 x 150mm.2. sucrose … đậm độ dùng cuối cùng là 1%. Simmon Citrate Agar Sodium citrate NaCl K2HPO4 NH4H2PO4 MgSO4 Bromothylmol blue Agar Nước cất 2 g 5 g 1 g 1 g 0.0 ml Điều chỉnh pH tới 6. Đường cho vào môi trường cơ bản phải diệt khuẩn trước .[Type text] [Type text] [Type text] Glucose. Đặt nghiêng ống nghiệm.0 g 5.9 và lọc.8 ± 0. Đun sôi 1 – 2 phút cho đến khi hòa tan.0 g 5.0 g 15. Môi trường VP Peptone Glucose Dipotassium hydrogen phosphate Nước cất 7.0 g 1000.0 ml Page 47 .

0 g 10.5 g 5.0 g 20.0 g 1.Tiệt khuẩn 15 phút ở 1210C. 16.Eosin Y Methylen blue 0. Thạch MacConkey Peptone Lactose Bile salts Sodium chloride Agar Neutral red Crystal violet Nước cất 20.0 g 0.3 ml dung dịch methylen blue 0. pentahydrate Trisodium citrate dihydrate Sodium cholate Ox-gall Sodium chloride (NaCl) Ferric citrate Bromothymol blue 10.0 g 0.0 g 1. Tiệt khuẩn 15 phút ở 1210C.0 ml Điều chỉnh pH tới 7.0 g 5.1-7.03 g 0.15% 15.0 g 3. Chia ra từng bình 100ml.2.0 g 10. và cứ 100ml cho thêm 2ml dung dịch eosin Y 2% và 4.0065 g Pha dung dịch a. điều chỉnh pH tới 7.[Type text] [Type text] [Type text] b.1.001 g 1000. Thạch TCBS Peptone Yeast extract Sucrose Sodium thiosulphate.0 g 5.04 g [Type text] Page 48 .0 g 10.4 g 0. Đun chảy trước khi dùng. Rót ra đĩa petri.0 g 15.0 g 10.

Đun nhỏ lửa và khuấy liên tục để cho tan thạch.0 ml Điều chỉnh pH tới 7. 17.0 g 1000. Nguội tới 500C và rót ra đĩa Petri.0 g Page 49 a. Không tiệt khuẩn bằng hấp ướt.0 g 1.0 g 10. Thạch urê 1.3 g 0. để nghiêng phần thạch ở đáy ống cao 2.0 ml 8. Đĩa môi trường để ở 40C dùng trong 24h (ISO 1990). Tiệt khuẩn 10 phút ở 1210C.0 g 0. phân ra các ống nghiệm. mỗi ống 10 ml.0 g 3.5 cm.04 g 15.0 g 10.[Type text] [Type text] [Type text] Thymol blue Agar Nước cất pH 0.0 g 1.0 g 1000.6 ± 0.4.0 g 5. Peptone Glucose Soium chloride [Type text] .0 g 5. 18.2 Hòa tất cả các thành phần trên trong nước cất.024 g 12. Thạch TSI Meat extract Yeast extract Peptone Sodium chloride Lactose Sucrose Glucose Ferri citrate Sodium thiosulphate Phenol red Agar Nước cất 3.3 g 0.0 g 20.

Hấp khử trừng 15 phút ở 1210C. 20. Cho 50 ml b) vào 950 ml a) ở điều kiện vô khuẩn. mỗi ống 10 ml và để nghiêng. điều chỉnh pH tới 6.2.03 g 0.0 ml Tiệt khuẩn bằng lọc.5 g 10 g 0. pH cuối 7.0 g 1000. phân ra các ống nghiệm.0 g 0.3 ± 0. Trypticase (Tryptic) Soy Agar (TSA) Trypticase peptone Phytone peptone NaCl Agar Nước cất 15 g 5 g 5 g 15 g 1 lít Đun nóng để hòa tan agar. Ưa muối. 19. Để sử dụng cho các chủng Vibrio spp.012 g 15. công them NaCl vào để nồng độ cuối đạt 2 – 3%.0 g 1000.0 ml 400.002 g 15 g Page 50 .[Type text] [Type text] [Type text] Potassium hydrogen phosphate Phenol red Agar Nước cất Tiệt khuẩn trong 2 phút ở 1210C b. Violet Red Bile Agar (VRBA) Cao nấm men Peptone hoặc gelysate NaCl Muối mật Lactose Neutral red Crystal violet Agar [Type text] 3 g 7 g 5 g 1. Urea Nước cất vừa đủ 2. phân phối vào các erlen.8.

điều chỉnh về pH 7. 21. Thuốc thử kovacs p. bổ sung và khuấy từng phần nhỏ HCl cho đến khi đủ lượng. thuốc thử được chứa trong chai màu tối tránh ánh sang ở 40C.Dimethylaminobenzalhehyde (p-DMABA) Isoamyl alcohol HCl đậm đặc 10 g 150 ml 50 ml Hòa tan p-DMABA trong dung môi. Thuốc thử methyl red Methyl red Ethanol 95% Nước cất (đủ) 0.4 ± 0. Sử dụng làm trong môi trường đổ đĩa.10 g 300 ml 500 ml Hòa tan đỏ methyl vào 300ml ethanol.2. có thể thay thế isoamyl alcohol bằng amyl alcohol hoặc butanol.[Type text] [Type text] [Type text] Nước cất 1 lít Hòa tan các thành phần trong nước. không hấp khử trùng. 22. Them nước cất vào cho đủ thể tích 500ml [Type text] Page 51 . Đun sôi trong 2 phút.

4. [Type text] Page 52 . NXB Giáo dục.Keen. Youngsheng He. chủ biên PGS. TS Lê Văn Phủng. Journal of water and health 04. coli. phân heo tiêu chảy và thịt bò.. Bộ y tế. Quantitative detection of E. 5. James.250. E. Simultaneous Identification of Strains of Escherichia coli Serotype O157:H7 and Their Shiga – Like toxin Type by Mismatch Amplification Mutation Assay – Multiplex PCR.. thực phẩm và mỹ phẩm. A. 33: 248 .Vi sinh vật thực phẩm. Clin. Vi khuẩn y học. L. Trần Linh Thước. Jimmy Kwang (1996) “Monoclonal Antibodies for Dectiction of the H7 Antigen of Escherichia Coli”. coli O157 and other shiga toxin producing E. Cebula T. 1995.coli in water samples using a culture method combined with real-time PCR. 3. 9p 3325-3332. .2006.. Khóa luận tốt nghiệp. E. Leo Heijnen and Gertjan Medema . and Feng P. Vol-62 No. 7. E. 6.[Type text] [Type text] [Type text] TÀI LIỆU THAM KHẢO 1.04.Westama. NXB Giáo dục Việt nam. Applied and enviromental microbiology. J.Travis Littledike. 2. Ralph B. tập Kỹ thuật kiểm tra và chỉ tiêu dánh giá chất lượng an toàn thực phẩm.Các phương pháp phân tích vi sinh vật trong nước. NXB Y học. Payne W. Microbiol. đề tài: Sử dụng kỹ thuật multilplex PCR để phát hiện các gen độc lực của vk Escherichia coli phân lập từ phân bò.

[Type text] [Type text] [Type text] [Type text] Page 53 .

Sign up to vote on this title
UsefulNot useful