P. 1
Bai Giang Hoa Sinh

Bai Giang Hoa Sinh

|Views: 1,258|Likes:
Được xuất bản bởiDạy Kèm Quy Nhơn
Chia sẽ bởi: Cử Nhân Hóa Học Nguyễn Thanh Tú (SĐT: 0905779594)
E-mail: thanhtuqn88@gmail.com
Diễn Đàn Toán - Lí - Hóa 1000B Trần Hưng Đạo Tp.Quy Nhơn
[Website] www.daykemquynhon.ucoz.com
[Facebook] www.facebook.com/daykem.quynhon
[Twitter] www.twitter.com/daykemquynhon
[Scribd] www.vi.scribd.com/daykemquynhon/document­s

Tác giả:

BS. Hoàng Hiếu Ngọc

Trường Đại học Y Dược Tp.HCM, 2011

- Khái niệm về chuyển hóa các chất
- Liên quan và điều hoà chuyển hoá
- Hóa học Acid Nucleic và Acid Nucleic
- Chuyển hóa Acid Nucleic
- Chuyển hoá Lipid
- Chuyển hoá năng lượng
- Hóa học Hemoglobin
- Chuyển hóa Hb

Tài liệu thực tập Hoá sinh.
[Nguồn]
http://www.ebook.edu.vn
Chia sẽ bởi: Cử Nhân Hóa Học Nguyễn Thanh Tú (SĐT: 0905779594)
E-mail: thanhtuqn88@gmail.com
Diễn Đàn Toán - Lí - Hóa 1000B Trần Hưng Đạo Tp.Quy Nhơn
[Website] www.daykemquynhon.ucoz.com
[Facebook] www.facebook.com/daykem.quynhon
[Twitter] www.twitter.com/daykemquynhon
[Scribd] www.vi.scribd.com/daykemquynhon/document­s

Tác giả:

BS. Hoàng Hiếu Ngọc

Trường Đại học Y Dược Tp.HCM, 2011

- Khái niệm về chuyển hóa các chất
- Liên quan và điều hoà chuyển hoá
- Hóa học Acid Nucleic và Acid Nucleic
- Chuyển hóa Acid Nucleic
- Chuyển hoá Lipid
- Chuyển hoá năng lượng
- Hóa học Hemoglobin
- Chuyển hóa Hb

Tài liệu thực tập Hoá sinh.
[Nguồn]
http://www.ebook.edu.vn

More info:

Published by: Dạy Kèm Quy Nhơn on Jul 03, 2012
Bản quyền:Attribution Non-commercial

Availability:

Read on Scribd mobile: iPhone, iPad and Android.
See more
See less

11/20/2014

CHUYỂN HÓA Hb

1. Quá trình tổng hợp hemoglobin
2. Quá trình thoái hóa hemoglobin
1.TỔNG HỢP HEMOGLOBIN
• Tổng hợp Globin
• Tổng hợp HEM
Chuyển hóa Hb
(1) TỔNG HỢP GLOBIN
Là quá trình tổng hợp protein Gen qui định
Gen mã hóa các chuỗi polypeptid α và β nằm trên
những NST Khác nhau
Các gen quyết định cấu trúc của chuổi α và δ (zeta) trên
NST thứ 16.
Các gen quyết định cấu trúc của chuỗi β trên NST 11,
tạo thành phức hợp gen phức hợp gen γβδ
Tổng hợp HEMOGLOBIN
Chuyển hóa Hb
GEN MÃ HÓA GLOBIN
Gen alpha
globin
(NST 16)
δ
α1 α2
ε
δ β
Gen bêta
globin
(NST 11)
Hb Gower I
δ2ε2
HbF α2γ2 HbA2
α2δ2
HbA α2β2

G: gl yci n

A: Al ani n
Pamela C.Champe and Ri chard A. Havey
2nd Bi ochemistry Il lustrated Revi ew
(2) TỔNG HỢP HEM
• Quá trình tổng hợp HEM bắt đầu và kết thúc đều trong ty thể
• Giai đoạn giữa xãy ra ở bào tƣơng
• Tất cả các mô đều có khả năng tạo hem trừ HC trƣởng thành
do thiếu ty thể
• Gan và tủy xƣơng tạo hem nhiều nhất
• Đa số HEM này đƣợc sử dụng làm nhóm ngoại của Hb
Chuyển hóa Hb
Tổng hợp HEMOGLOBIN
(2) TỔNG HỢP HEM
Hem đƣợc tổng hợp qua 3 giai đoạn:
1. Tạo acid δ-amino levulinic (AAL) trong ty thể
2. Tạo coproporphyrin III ở bào tƣơng
3. Tạo protoporphyrin IX và gắn Fe
2+
để tạo HEM trong ty thể
Chuyển hóa Hb
Tổng hợp HEMOGLOBIN
GIAI ĐOẠN 1: TRONG TY THỂ
Succinyl CoA Glycin
CO
2
CoA-SH
ALA synthase
(pirydoxal phosphat)
acid δ amino levulinic (ALA)
Ty thể
a. α-amino β-cetoadipic
• Coenzym pyridoxal phosphat hoạt hoá Glycin
• Enzym xúc tác: δ amino levulinic acid synthase
Porphobilinogen (PBG)
Bào tƣơng
4CO
2
acid δ amino levulinic ALA
1 phân tử ALA
H2O
ALA dehydratase
Ngưng tụ 4 phân tử
PBG và đóng vòng
Uroporphyrinogen III
Uroporphyrinogen decarboxylase
Coproporphyrinogen III
Uroporphyrinogen
synthase III
Uroporphyrinogen
cosynthase
4NH
2
GIAI ĐOẠN II: TẠI BÀO TƢƠNG
GIAI ĐOẠN III: TẠI TY THỂ
Protoporphyrinogen IX
Ty thể
2H
+
Hemoglobin
Coproporphyrinogen oxidase
Globin
Protoporphyrinogen Oxidase
Oxy hóa tạo hệ thống liên kết đôi liên hợpđặc trưng cho nhân porphyrin
Protoporphyrin IX
Hem synthase (ferrochelatase)
Coproporphyrinogen III
Fe
2+
Hem
Ức chế
* Enzym ALA dehydratase →  ALA
* Enzym coproporphyrinogen oxydase →  coproporphyrin
dùng XN ALA và coproporphyrin trong nƣớc
tiểu để phát hiện nhiễm độc chì
Nếu ngộ độc chì kéo dài
Chuyển hóa Hb
Tổng hợp HEMOGLOBIN
ĐIỀU HÒA TỔNG HỢP HEM
Succinyl CoA -------- Glycin
δ ALA
HEM
δ-Amino levulinat
synthase
( – )
Được kiểm soát bởi “enzym giới hạn tốc độ” là δ-Amino levulinat synthase(gđ I)
Điều hòa theo cơ chế Feedback (-)
Chuyển hóa Hb
Các
công
thức
Tổng
hợp
Hem
và Hb
(2) THOÁI HOÁ HEMOGLOBIN
QUÁ TRÌNH TIÊU HOÁ:
QUÁ TRÌNH THOÁI HOÁ:
• THOÁI HOÁ HEM THÀNH BILIRUBIN TỰ DO
• TẠO THÀNH BILIRUBIN LIÊN HỢP
• SỰ BiẾN ĐỔI CỦA BILIRUBIN Ở RUỘT
Chuyển hóa Hb
(1) QUÁ TRÌNH TIÊU HOÁ HEMOGLOBIN
Hemoglobin
Myoglobin
Hem
Globin
Ra ngoài theo phân
Hematin
Con đƣờng
chuyển hoá protein
Peptid + A. amin
Men tiêu hóa phân hủy
Oxyhóa
Khó hấp thu
Phân hủy
Thoái hoá hemoglobin
(2) QUÁ TRÌNH THOÁI HÓA HEMOGLOBIN
-
OOC
CH
3
CH
CH
3
P
P
M
M
HEME
N
N
N
N
Fe
Thoái hóa Hb tạo bilirubin tự do
N
H
N
H
N
H
N
H
C
N
C
N
C
N
-
OOC
COO
-
O
O
CH
3
CH
3
CH
3
CH
3
N
H
N
H
N
H
N
H
C
N
CH
2
C
N
-
OOC COO
-
O O
CH
3
CH
3
CH
3
CH
3
bilirubin tự do
biliverdin
O
2
Fe
3+
+CO
NADPH NADP
+
NADPH
NADP
+
Biliverdin reductase
Thoái hoá hemoglobin
Bilirubin tự do:
(2) QUÁ TRÌNH THOÁI HÓA HEMOGLOBIN
Tạo thành bilirubin liên hợp
Bilirubin
Bilirubin monoglucuronat 15%
Bilirubin UDP glucoronyl
transferase
UDP glucuronat UDP
Bilirubin diglucuronat 85%
H H
N
H
N
H
N
H
N
H
C
N
C
C
N
COOC
6
H
9
C
6
HO
OH
CH
2
M
M
M M
V V
CH
2
H
2
C
H
2
C
C
6
H
9
C
6
OOC
Thoái hoá hemoglobin
Biliverdin
O
2
Stercobilin
Bilirubin UDP
glucoronyl
transferase
Thận
Bilirubin tự do
= 20%
Tái hấp thu
Bilirubin liên hợp
Fe
2+
+ CO
Hem
Urobilinogen
NADPH
NADP
+
NADPH
NADP
+
UDP glucoronat
UDP
Biliverdin
reductase
Hem oxygenase
Urobilin
Nước tiểu
Phân
Ruột
Gan
Gan
Lách
Tủy xƣơng
T
ĩ
n
h

m

c
h

c

a
Sƣ biến đổi của bilirubin ở ruột
Thoái hoá hemoglobin
Rối loạn chuyển hóa Hb và Sắc tố mật
Bình thường: BiTP: < 10mg/L
BiGT(BiTD): chiếm 85%: 2 – 8mg/L
BiTT(BiLH): chiếm 15%: 0 – 2mg/L
Khi BiTP tăng > 20 – 25mg/L  xh vàng da
Bệnh lý vàng da được chia thành 3 loại:
Vàng da trước gan
Vàng da tại gan
Vàng da sau gan
VÀNG DA TRƢỚC GAN
Tăng bilirubin tự do là chính
Chủ yếu vàng da tán huyết
Bệnh về bất thường Hb (HbS, Thalassemia, Minkowskichauffard …)
Bệnh di truyền do thiếu enzym G6PD
Bệnh miễn dịch (truyền nhầm nhóm máu, bất đồng nhóm máu…
Bệnh mắc phải (sốt rét, SXH, nhiễm trùng, nhiễm độc dung môi hữu cơ
Vàng da sinh lý ở trẻ sơ sinh do hệ thống liên hiệp , các thụ thể ở
màng tế bào gan
XN máu: Bilirubin TD tăng cao, bilirubin liên hợp tăng nhẹ
hay bình thường
XN nước tiểu, phân: Urobilinogen tăng
Rối loạn chuyển hóa Hb và Sắc tố mật
Thoái hoá hemoglobin
VÀNG DA TẠI GAN: Tăng bilirubin hỗn hợp
 Bệnh di truyền do thiếu enzym UDP glucuronyl transferase:
HC Crigler-Najjar loại I, loại II là bệnh di truyền lặn trên NST thường
Bệnh Gilbert: Tan huyết + ↓ khả năng thu nhận Bi + ↓ hoạt tính UDP
glucuronyl transferase
XN: Bi TD tăng cao
 Bệnh mắc phải: viêm gan do virus, nhiễm độc gan do hóa chất
như para, cloroform…, xơ gan, k gan…
*. ↓ khả năng liên hợp ↑ BiTD đồng thời khả năng tái tạo
bilirubin từ urobilinogen giảm  ↑urobilinogen trong nước tiểu.
*. Tắc nghẽn đường mật trong gan hay ứ mật ở TB gan nên Bi TT
tăng làm xh sắc tố mật trong nước tiểu
XN máu: BiTD và BiTT đều tăng
XN nước tiểu: Urobilinogen tăng, sắc tố mật (+)
Rối loạn chuyển hóa Hb và Sắc tố mật
Thoái hoá hemoglobin
VÀNG DA SAU GAN
Tăng BiTT là chính
• Thường gặp trong tắc đường dẫn mật: sỏi, k đầu tụy, hạch
to chèn ép đường dẫn mật…
• XN: Tăng Bi TT là chính
• Nước tiểu sậm màu: muối mật (+), sắc tố mật (+)
• Phân nhạt màu
Thoái hoá hemoglobin
Rối loạn chuyển hóa Hb và Sắc tố mật
CHUY
CHUY


N HO
N HO
Á
Á
NĂNG LƯ
NĂNG LƯ


NG
NG
CHUY
CHUY


N HO
N HO
Á
Á
NĂNG LƯ
NĂNG LƯ


NG
NG
D
D
à
à
n b
n b
à
à
i:
i:
1. 1.
ð
ð


i cương
i cương
2. 2.
Ph
Ph


n
n


ng oxi ho
ng oxi ho
á
á
kh
kh


sinh h
sinh h


c
c
3. 3.
Phosphoryl ho
Phosphoryl ho
á
á
v
v
à
à
kh
kh


phosphoryl
phosphoryl
4. 4.
Chu
Chu


i hô h
i hô h


p t
p t
ế
ế
b
b
à
à
o
o
5. 5.
Chu tr
Chu tr
ì
ì
nh acid citric
nh acid citric
ð
ð


I CƯƠNG V
I CƯƠNG V


CHNL
CHNL

Năng lư
Năng lư


ng t
ng t


do
do

M
M


i liên quan gi
i liên quan gi


a bi
a bi
ế
ế
n thiên năng
n thiên năng




ng t
ng t


do v
do v
à
à
h
h


ng s
ng s


cân b
cân b


ng ph
ng ph


n
n


ng
ng
NĂNG LƯ
NĂNG LƯ


NG T
NG T


DO
DO

Enthalpy (H): n
Enthalpy (H): n


i năng
i năng
,
,
năng lư
năng lư


ng to
ng to
à
à
n
n
ph
ph


n
n

Năng lư
Năng lư


ng t
ng t


do
do
(G):
(G):
năng lư
năng lư


ng c
ng c
ó
ó
kh
kh



năng bi
năng bi
ế
ế
n th
n th
à
à
nh công c
nh công c
ó
ó
í
í
ch
ch

G<H
G<H

Entropy (S): tr
Entropy (S): tr


ng th
ng th
á
á
i n
i n


i t
i t


i c
i c


a phân t
a phân t


– – Tăng khi ñ Tăng khi ñộ ộ vô tr vô trậ ật t t tự ự tăng tăng (h (hệ ệ k kí ín) n)
– – Trong ñi Trong ñiề ều ki u kiệ ện t n tự ự nhiên entropy ch nhiên entropy chỉ ỉ c có ó th thể ể tăng tăng
(VD: nh (VD: nhú úng dung d ng dung dị ịch NaCl trong t ch NaCl trong tú úi b i bá án th n thấ ấm m
v và ào c o cố ốc nư c nướ ớc c phân t phân tử ử mu muố ối ch i chạ ạy ra kh y ra khỏ ỏi t i tú úi) i)
Tự phát
Không tự phát
Trong hệ cô lập, quá trình khuếch tán diễn ra theo
chiều hướng làm tăng ñộ hỗn loạn của hệ
NĂNG LƯ
NĂNG LƯ


NG T
NG T


DO
DO

G = H
G = H


TS
TS
• • H tăng H tăng G tăng G tăng; S ; S tăng tăng G gi G giả ảm m
• • H H – – G G = T = TS: S: thay ñ thay ñổ ổi theo nhi i theo nhiệ ệt ñ t ñộ ộ, ph , phụ ụ thu thuộ ộc S c S

∆ ∆∆ ∆
∆ ∆∆ ∆
G =
G =
∆ ∆∆ ∆
∆ ∆∆ ∆
H
H


T
T
∆ ∆∆ ∆
∆ ∆∆ ∆
S
S
• • ∆ ∆∆ ∆ ∆ ∆∆ ∆G: bi G: biế ến thiên NLTD (Kcal) n thiên NLTD (Kcal)
• • ∆ ∆∆ ∆ ∆ ∆∆ ∆H: bi H: biế ến thiên enthalpy (Kcal) n thiên enthalpy (Kcal)
• • T: nhi T: nhiệ ệt ñ t ñộ ộ tuy tuyệ ệt ñ t ñố ối i
• • ∆ ∆∆ ∆ ∆ ∆∆ ∆S: bi S: biế ến thiên entropy ( n thiên entropy (Kcal Kcal. .ñ ñộ ộ
- -1 1
) )
BI
BI


N THIÊN NLTD
N THIÊN NLTD
Ph Phả ản n ứ ứng A ng A B B
∆ ∆∆ ∆ ∆ ∆∆ ∆G=G G=G
B B
- - G G
A A
∆ ∆∆ ∆ ∆ ∆∆ ∆G < 0 G < 0
• • ph phả ản n ứ ứng ph ng phá át năng t năng
• • c có ó th thể ể x xả ảy ra t y ra tự ự ph phá át ( t (S tăng S tăng, G gi , G giả ảm) m)
• • ñôi khi c ñôi khi cầ ần năng lư n năng lượ ợng ho ng hoạ ạt ho t hoá á ñ ñể ể x xả ảy ra ph y ra phả ản n ứ ứng ng
∆ ∆∆ ∆ ∆ ∆∆ ∆G > 0 G > 0
• • ph phả ản n ứ ứng thu năng ng thu năng
• • không th không thể ể x xả ảy ra t y ra tự ự ph phá át t
∆ ∆∆ ∆ ∆ ∆∆ ∆G = 0 G = 0
• • ph phả ản n ứ ứng không thu năng c ng không thu năng cũ ũng không ph ng không phá át năng t năng
BI
BI


N THIÊN NLTD
N THIÊN NLTD
∆ ∆∆ ∆
∆ ∆∆ ∆
G =
G =
∆ ∆∆ ∆
∆ ∆∆ ∆
G
G
o o
+ RTln[B]/[A]
+ RTln[B]/[A]

∆ ∆∆ ∆
∆ ∆∆ ∆
G
G
o o
: bi
: bi
ế
ế
n thiên năng lư
n thiên năng lư


ng t
ng t


do chu
do chu


n:
n:
25
25
o o
C, pH = 0, [A]=[B]=1 mol
C, pH = 0, [A]=[B]=1 mol
∆ ∆∆ ∆
∆ ∆∆ ∆
G ph
G ph


thu
thu


c b
c b


n ch
n ch


t ,
t ,
ñi
ñi


u ki
u ki


n, t
n, t


l
l


n
n


ng ñ
ng ñ


c
c
á
á
c ch
c ch


t tham gia, s
t tham gia, s


n ph
n ph


m
m
ph
ph


n
n


ng; không ph
ng; không ph


thu
thu


c con ñư
c con ñư


ng
ng
chuy
chuy


n ho
n ho
á
á
Bi
Bi
ế
ế
n thiên NLTD chu
n thiên NLTD chu


n
n


ñi
ñi


u ki
u ki


n sinh
n sinh
h
h


c
c
∆ ∆∆ ∆
∆ ∆∆ ∆
G
G
o o


:
:
pH=7
pH=7
, 25
, 25
o o
C
C
∆ ∆∆ ∆
∆ ∆∆ ∆
G
G


=
=
∆ ∆∆ ∆
∆ ∆∆ ∆
G
G
o o


+ RTln[B]/[A]
+ RTln[B]/[A]
BI
BI


N THIÊN NLTD & K
N THIÊN NLTD & K
∆ ∆∆ ∆
∆ ∆∆ ∆
G
G


=
=
∆ ∆∆ ∆
∆ ∆∆ ∆
G
G
o o


+ RTln[B]/[A]
+ RTln[B]/[A]
Ph
Ph


n
n


ng ñ
ng ñ


t tr
t tr


ng th
ng th
á
á
i cân b
i cân b


ng:
ng:
∆ ∆∆ ∆
∆ ∆∆ ∆
G
G


=0
=0


∆ ∆∆ ∆
∆ ∆∆ ∆
G
G
o o


=
=


RTlnK
RTlnK



K
K


: h
: h


ng s
ng s


cân b
cân b


ng ph
ng ph


n
n


ng trong ñi
ng trong ñi


u
u
ki
ki


n sinh h
n sinh h


c (pH=7)
c (pH=7)

R: h
R: h


ng s
ng s


kh
kh
í
í
l
l
í
í




ng, 1,98.10
ng, 1,98.10
- -3 3

Kcal/mol
Kcal/mol
.
.
ñ
ñ



T: nhi
T: nhi


t ñ
t ñ


tuy
tuy


t ñ
t ñ


i, 298
i, 298
o o
K (25
K (25
o o
C)
C)



G
G
o o


: Kcal/mol
: Kcal/mol

K
K


=10
=10
- -∆ ∆Go Go’ ’/1,36 /1,36
BI
BI


N THIÊN NLTD & K
N THIÊN NLTD & K
K K’ ’=10 =10
- -∆ ∆Go Go’ ’/1,36 /1,36
- - K K’ ’=1: =1: ∆ ∆G G
o o
’ ’=0: không x =0: không xả ảy ra trong ñi y ra trong ñiề ều ki u kiệ ện sinh n sinh
h họ ọc c
- - K K’ ’>1: >1: ∆ ∆G G
o o
’ ’<0: ph <0: phả ản n ứ ứng ph ng phá át năng t năng
Ph Phả ản n ứ ứng oxi ho ng oxi hoá á glucose: glucose:
C C
6 6
H H
12 12
O O
6 6
+ 6O + 6O
2 2
= 6CO = 6CO
2 2
+ 6H + 6H
2 2
O O
∆ ∆G G
o o
’ ’= =- -686 Kcal/mol 686 Kcal/mol
Th Thự ực t c tế ế ñ ñể ể glucose ngo glucose ngoà ài kh i khí í tr trờ ời h i hà àng năm tr ng năm trờ ời m i mà à
v vẫ ẫn không c n không có ó hi hiệ ện tư n tượ ợng g ng gì ì x xả ảy ra y ra ∆ ∆G, G, ∆ ∆G G’ ’
không cho ý ni không cho ý niệ ệm v m về ề v vậ ận t n tố ốc ph c phả ản n ứ ứng, m ng, mà à ch chỉ ỉ cho cho
bi biế ết chi t chiề ều ph u phả ản n ứ ứng n ng nế ếu x u xả ảy ra. y ra.
OXI HO
OXI HO
Á
Á


KH
KH


SINH H
SINH H


C
C
PH
PH


N
N


NG OXI HO
NG OXI HO
Á
Á


KH
KH


Ch Chấ ất t
- -e e
- -
kh khử ử
+e +e
- -
oxy h oxy hó óa a
Ph Phả ản n ứ ứng ng
- -e e
- -
oxy h oxy hó óa a
+e +e
- -
kh khử ử
. C . Cặ ặp, h p, hệ ệ th thố ống oxy h ng oxy hó óa kh a khử ử (oxh/kh) (oxh/kh)
TD: Fe TD: Fe
+3 +3
/Fe /Fe
+2 +2
, H , H
+ +
/H, O/O /H, O/O
- -2 2
, R , R- -COOH/R COOH/R- -CHO v.v CHO v.v… …
(ferri (ferri- -/ferro /ferro- -) )
PH
PH


N
N


NG OXI HO
NG OXI HO
Á
Á


KH
KH


TH
TH


NĂNG OXI HO
NĂNG OXI HO
Á
Á


KH
KH


Phương tr
Phương tr
ì
ì
nh Nernst:
nh Nernst:
] [
] [
0
ln
kh
oxh
nF
RT
E E + =
n: s
n: s


ñi
ñi


n t
n t


ñư
ñư


c v
c v


n chuy
n chuy


n
n
F: h
F: h


ng s
ng s


Faraday = 23 Kcal/V.mol
Faraday = 23 Kcal/V.mol
Trong ñi
Trong ñi


u ki
u ki


n sinh h
n sinh h


c (pH=7, 25
c (pH=7, 25
o o
C):
C):
] [
] [
0
log 06 , 0 ' '
kh
oxh
E E + =
E E
o o
l là à E khi: E khi: ] [ ] [ kh oxh =
C Cặ ặp oxh p oxh- -kh kh E E
0 0
’ ’ (volt) (volt)
2H 2H
+ +
/H /H
2 2
FAD/FADH FAD/FADH
NAD NAD
+ +
/NADH,H /NADH,H
+ +
FAD/FADH FAD/FADH
2 2
Fumarat/succinat Fumarat/succinat
Cytb Fe Cytb Fe
+3 +3
/Cytb Fe /Cytb Fe
+2 +2
Cytc Fe Cytc Fe
+3 +3
/Cytc Fe /Cytc Fe
+2 +2
½ ½ O O
2 2
/O /O
- -2 2
- -0.42 0.42
- -0.36 0.36
- -0.32 0.32
- -0.12 0.12
+0.03 +0.03
+0.08 +0.08
+0.22 +0.22
+0.82 +0.82
N Nế ếu v u vì ì lý do n lý do nà ào ñ o ñó ó BH BH
2 2
b bị ị t tồ ồn ñ n ñọ ọng th ng thì ì ph phả ản n ứ ứng c ng có ó th thể ể ñ ñạ ạt tr t trạ ạng ng
th thá ái cân b i cân bằ ằng ho ng hoặ ặc th c thậ ậm ch m chí í theo chi theo chiề ều ngh u nghị ịch. ch.
X Xé ét 2 h t 2 hệ ệ th thố ống oxh ng oxh- -kh: kh:
A/AH A/AH
2 2
v và à B/BH B/BH
2 2
N Nế ếu E u E
A A
< E < E
B B
th thì ì: :
e e
- -
s sẽ ẽ di chuy di chuyể ển t n từ ừ h hệ ệ th thố ống A qua B (t ng A qua B (từ ừ ch chấ ất kh t khử ử AH AH
2 2
qua ch qua chấ ất t
oxy h oxy hó óa B): a B):
AH AH
2 2
+ B + B → →→ → → →→ → BH BH
2 2
+ A + A
Chi
Chi


u v
u v


n chuy
n chuy


n c
n c


a ñi
a ñi


n t
n t


e
e
-
-
ðiện tử di chuyển:
- Từ chất khử sang chất oxi hoá (trong cùng hệ thống oxh-kh)
- Hệ thống có thế năng oxi hoá khử thấp sang hệ thống có thế
năng oxi hoá – khử cao (giữa 2 hệ thống oxh-kh)
TD: x TD: xé ét 2 h t 2 hệ ệ th thố ống: ng:
NAD NAD
+ +
/NADH,H /NADH,H
+ +
v và à FAD/FADH FAD/FADH
2 2
E E
0 0
(A) = (A) = - -0.32V 0.32V; ; E E
0 0
(B) = (B) = - -0.06V 0.06V
V Vậ ậy trong ñi y trong ñiề ều ki u kiệ ện chu n chuẩ ẩn (v n (và à th thự ực t c tế ế trong ñi trong ñiề ều ki u kiệ ện n
sinh lý c sinh lý củ ủa t a tế ế b bà ào) o) e e- - ñi t ñi từ ừ NADH,H NADH,H
+ +
qua FAD. qua FAD.
NADH,H NADH,H
+ +
FADH FADH
2 2
NAD NAD
+ +
FAD FAD
2e 2e
- -
FADH FADH
2 2
FAD FAD
NAD NAD
+ +
NADH,H NADH,H
+ +
2e 2e
- -
Ho Hoặ ặc c
Liên h
Liên h


gi
gi


a
a


G
G
0 0


v
v
à
à


E
E
0 0


Trong ph Trong phả ản n ứ ứng oxh ng oxh- -kh, e kh, e
- -
v vậ ận chuy n chuyể ển v n vớ ới i ∆ ∆E > 0 do E > 0 do
ñ ñó ó ∆ ∆G < 0, nên ph G < 0, nên phả ản n ứ ứng luôn luôn k ng luôn luôn kè èm s m sự ự ph phá át t
năng năng. . Năng lư Năng lượ ợng ñ ng ñó ó m mộ ột ph t phầ ần s n sẽ ẽ ñư ñượ ợc s c sử ử d dụ ụng ng
ngay (t ngay (tạ ạo thân nhi o thân nhiệ ệt, t, công cơ h công cơ họ ọc, t c, tổ ổng h ng hợ ợp ch p chấ ất t… …), ),
ph phầ ần còn l n còn lạ ại ñư i ñượ ợc t c tí ích tr ch trữ ữ l lạ ại trong c i trong cá ác liên k c liên kế ết gi t già àu u
năng lư năng lượ ợng (~) nh ng (~) nhờ ờ c cá ác ph c phả ản n ứ ứng phosphoryl h ng phosphoryl hó óa. a.
'
0
'
0
E nF G ∆ − = ∆
OXIDOREDUCTASE
OXIDOREDUCTASE

Oxidase
Oxidase

Dehydrogenase
Dehydrogenase

Hydroperoxidase
Hydroperoxidase

Oxygenase
Oxygenase
OXIDASE
OXIDASE
D
D
ù
ù
ng oxi ñ
ng oxi ñ


g
g


n hidro, t
n hidro, t


ñ
ñ
ó
ó
t
t
á
á
ch hidro
ch hidro
ra kh
ra kh


i cơ ch
i cơ ch


t. T
t. T


o s
o s


n ph
n ph


m l
m l
à
à
H
H
2 2
0
0
ho
ho


c H
c H
2 2
O
O
2 2
.
.

Oxidase ch
Oxidase ch


a ñ
a ñ


ng: cytochrome
ng: cytochrome
oxidase
oxidase

Oxidase ch
Oxidase ch


a flavoprotein (FMN,
a flavoprotein (FMN,
FAD): L
FAD): L
-
-
amino acid oxidase, xanthine
amino acid oxidase, xanthine
oxidase, glucose oxidase (n
oxidase, glucose oxidase (n


m)
m)
DEHYDROGENASE
DEHYDROGENASE

Chuy
Chuy


n H t
n H t


cơ ch
cơ ch


t n
t n
à
à
y sang cơ ch
y sang cơ ch


t
t
kh
kh
á
á
c trong c
c trong c


p ph
p ph


n
n


ng oxi ho
ng oxi ho
á
á
kh
kh


.
.
Không c
Không c


n oxi (v
n oxi (v
í
í
d
d


: pha y
: pha y
ế
ế
m kh
m kh
í
í
c
c


a
a
ñư
ñư


ng phân).
ng phân).

Th
Th
à
à
nh ph
nh ph


n c
n c


a chu
a chu


i hô h
i hô h


p t
p t
ế
ế
b
b
à
à
o:
o:
c
c
á
á
c cytochrome (tr
c cytochrome (tr


cytochrome
cytochrome
oxidase) c
oxidase) c
ũ
ũ
ng ñư
ng ñư


c xem l
c xem l
à
à
dehydrogenase.
dehydrogenase.
DEHYDROGENASE:
DEHYDROGENASE:
Coenzyme
Coenzyme

Nicotinamide:
Nicotinamide:


NAD: c
NAD: c
á
á
c con ñư
c con ñư


ng chuy
ng chuy


n ho
n ho
á
á
oxi ho
oxi ho
á
á
:
:
ñư
ñư


ng phân, chu tr
ng phân, chu tr
ì
ì
nh acid citric, chu
nh acid citric, chu


i
i
hô h
hô h


p ti th
p ti th


.
.


NADP: c
NADP: c
á
á
c qu
c qu
á
á
tr
tr
ì
ì
nh t
nh t


ng h
ng h


p kh
p kh


: t
: t


ng
ng
h
h


p steroid v
p steroid v
à
à
acid b
acid b
é
é
o ngo
o ngo
à
à
i ti th
i ti th


.
.

Riboflavin: v
Riboflavin: v


n chuy
n chuy


n electron trong
n electron trong
ho
ho


c ñ
c ñ
ế
ế
n chu
n chu


i hô h
i hô h


p t
p t
ế
ế
b
b
à
à
o
o
HYDROPEROXIDASE
HYDROPEROXIDASE

B
B


o v
o v


cơ th
cơ th


kh
kh


i peroxide c
i peroxide c
ó
ó
h
h


i
i

2 lo
2 lo


i
i


Peroxidase: kh
Peroxidase: kh


hydrogen peroxide d
hydrogen peroxide d
ù
ù
ng
ng
nhi
nhi


u ch
u ch


t nh
t nh


n ñi
n ñi


n t
n t


kh
kh
á
á
c nhau
c nhau
(ascorbate, quinone, cytochrome c)
(ascorbate, quinone, cytochrome c)


Catalase: d
Catalase: d
ù
ù
ng hydrogen peroxide l
ng hydrogen peroxide l
à
à
m
m
ch
ch


t nh
t nh


n v
n v
à
à
cho ñi
cho ñi


n t
n t


(m
(m


t ch
t ch


t nh
t nh


n,
n,
m
m


t ch
t ch


t cho). C
t cho). C
ó
ó
vai trò ph
vai trò ph
á
á
hu
hu


H
H
2 2
O
O
2 2
t
t


o th
o th
à
à
nh t
nh t


ph
ph


n
n


ng c
ng c


a oxidase.
a oxidase.
OXIGENASE
OXIGENASE

Thư
Thư


ng tham gia ph
ng tham gia ph


n
n


ng t
ng t


ng h
ng h


p hay
p hay
tho
tho
á
á
i ho
i ho
á
á
c
c
á
á
c ch
c ch


t hơn l
t hơn l
à
à
tham gia cung c
tham gia cung c


p
p
năng lư
năng lư


ng cho t
ng cho t
ế
ế
b
b
à
à
o.
o.

X
X
ú
ú
c t
c t
á
á
c g
c g


n oxi v
n oxi v
à
à
o cơ ch
o cơ ch


t.
t.

2 nh
2 nh
ó
ó
m
m
– – Dioxygenase (oxygenase th Dioxygenase (oxygenase thự ực, oxygen c, oxygen
transferase): g transferase): gắ ắn 2 nguyên t n 2 nguyên tử ử oxi v oxi và ào cơ ch o cơ chấ ất. t.
– – Monooxigenase (oxidase ch Monooxigenase (oxidase chứ ức năng h c năng hỗ ỗn h n hợ ợp, p,
hydroxylase): ch hydroxylase): chỉ ỉ g gắ ắn 1 nguyên t n 1 nguyên tử ử oxi v oxi và ào cơ ch o cơ chấ ất t
(t (tạ ạo nh o nhó óm m – –OH), nguyên t OH), nguyên tử ử O kia t O kia tạ ạo nư o nướ ớc, v c, và à c cầ ần n
m mộ ột ch t chấ ất cho ñi t cho ñiệ ện t n tử ử. .
H Hệ ệ th thố ống cytochrome P ng cytochrome P- -450 monooxidase vi th 450 monooxidase vi thể ể: hydroxyl : hydroxyl
ho hoá á nhi nhiề ều lo u loạ ại thu i thuố ốc. c.
H Hệ ệ th thố ống cytochrome P ng cytochrome P- -450 monooxidase ti th 450 monooxidase ti thể ể: hydroxyl : hydroxyl
ho hoá á c cá ác steroid. c steroid.
SUPEROXIDE DISMUTASE
SUPEROXIDE DISMUTASE
O
2

O
2

2H
+
H
2
O
2
O
2
+
+ +
Superoxide
dimutase
- Trong phản ứng này, superoxide vừa là chất khử,
vừa là chất oxi hoá.
- Superoxide dismutase (SOD) bảo vệ cơ thể sinh vật
ái khí chống lại tác hại của superoxide.
- SOD có ở các khoang khác nhau trong tế bào: trong
bào tương chứa Cu
2+
hoặc Zn
2+
; trong ti thể chứa
Mn
2+
giống trong vi khuẩn hỗ trợ giả thuyết ti
thể là prokaryote cộng sinh với protoeukaryote.
PHOSPHORYL HO
PHOSPHORYL HO
Á
Á
KH
KH


PHOSPHORYL HO
PHOSPHORYL HO
Á
Á
R-H + HO-PO
3
H
2
→R-P + H
2
O
Phosphorylase
∆G>0 (thu Q)
TD:
Phản ứng ngược lại: phản ứng khử phosphoryl
R-P + H
2
O →R-H + H
3
PO
4
Phosphatase
ATP
G G - 6P
ADP
Hexokinase
Glucokinase
PH
PH


N
N


NG PHOSPHORYL
NG PHOSPHORYL
HO
HO
Á
Á
NĂNG LƯ
NĂNG LƯ


NG C
NG C


A LIÊN K
A LIÊN K


T
T
Năng lượng của liên kết là chênh lệch NLTD
của hợp chất chứa liên kết này và hợp chất
sau khi liên kết này bị cắt ñứt.
Phản ứng
ATP + H
2
O ADP + Pvc
ADP + H
2
O AMP + Pvc
kèm giảm NLTD 7,3 Kcal ở 25
o
C, pH=7
Liên kết ADP và Pvc, AMP và Pvc có NLTD là
7,3 Kcal.
LIÊN K
LIÊN K


T GI
T GI
À
À
U NĂNG
U NĂNG




NG
NG
Liên k
Liên k
ế
ế
t gi
t gi
à
à
u năng lư
u năng lư


ng l
ng l
à
à
liên k
liên k
ế
ế
t c
t c
ó
ó
l
l


G
G
0 0


l > 7 Kcal/mol ho
l > 7 Kcal/mol ho


c l
c l


G
G
0 0
l > 5Kcal/mol
l > 5Kcal/mol
Bi
Bi
ế
ế
t r
t r


ng:
ng:
∆ ∆∆ ∆
∆ ∆∆ ∆
G
G
0 0


=
=
-
-
nF
nF
∆ ∆∆ ∆
∆ ∆∆ ∆
E
E
0 0


, ta c
, ta c
ó
ó
:
:
∆ ∆∆ ∆
∆ ∆∆ ∆
E
E
0 0


=
=
7Kcal/2.23,06 = 0,152V
7Kcal/2.23,06 = 0,152V
V
V


y,
y,


giai ño
giai ño


n n
n n
à
à
o
o
∆ ∆∆ ∆
∆ ∆∆ ∆
E
E
0 0


> 0,152V
> 0,152V
th
th
ì
ì


ñ
ñ
ó
ó
s
s


ñ
ñ


năng lư
năng lư


ng t
ng t


o ra 1 phân t
o ra 1 phân t


ATP t
ATP t


ADP.
ADP.
LIÊN K
LIÊN K


T GI
T GI
À
À
U NĂNG
U NĂNG




NG
NG
N Nế ếu t u tí ính nh ∆ ∆E E
0 0
’ ’ khi e khi e
- -
v vậ ận chuy n chuyể ển t n từ ừ NADH,H NADH,H
+ +
t tớ ới O i O
2 2
: :
∆ ∆∆ ∆ ∆ ∆∆ ∆E E
0 0
’ ’ = + 0,81 = + 0,81- - ( (- - 0,32) 0,32)
= + 1,13volt = + 1,13volt
l l∆ ∆∆ ∆ ∆ ∆∆ ∆G G
0 0
’ ’l = nF l = nF∆ ∆∆ ∆ ∆ ∆∆ ∆E E
0 0
’ ’
= 2 x 23,06 x 1,13 = 2 x 23,06 x 1,13
= 52 Kcal = 52 Kcal
Tuy nhiên năng lư Tuy nhiên năng lượ ợng n ng nà ày không t y không tí ích tr ch trữ ữ trong m trong mộ ột t
l lầ ần m n mộ ột m t mà à theo t theo từ ừng giai ño ng giai ñoạ ạn k n kế ế ti tiế ếp nhau, p nhau, giai giai
ño ñoạ ạn n n nà ào ñ o ñủ ủ t tạ ạo liên k o liên kế ết gi t già àu năng lư u năng lượ ợng s ng sẽ ẽ t tạ ạo ngay o ngay
t tạ ại th i thờ ời ñi i ñiể ểm ñ m ñó ó. .
TD: TD:
NAD NAD → →→ → → →→ → FAD FAD → →→ → → →→ → C C
0 0
Q Q → →→ → → →→ → Cyt Cyt
b b
→ →→ → → →→ → Cyt Cyt
c c
→ →→ → → →→ → Cyt Cyt
(a+a3) (a+a3)
→ →→ → → →→ → O O
↓ ↓↓ ↓ ↓ ↓↓ ↓ ↓ ↓↓ ↓ ↓ ↓↓ ↓ ↓ ↓↓ ↓ ↓ ↓↓ ↓
ATP ATP ATP ATP ATP ATP
C CÁ ÁC CH C CHẤ ẤT T “ “GI GIÀ ÀU U” ” NĂNG LƯ NĂNG LƯỢ ỢNG NG
Lo Loạ ại liên k i liên kế ết t
1.Pyrophosphat 1.Pyrophosphat
Phosphoanhydrid Phosphoanhydrid
P P – – O ~ P O ~ P
Ch Chấ ất t
NTP NTP
ATP,GTP,UTP, ATP,GTP,UTP,… …
CTP CTP… …
NDP NDP
ADP,GDP,CDP, ADP,GDP,CDP,… …
VDP VDP… …
2. Acyl phosphat 2. Acyl phosphat
R R – – C ~ P C ~ P
ll ll
O O
a. 1,3 a. 1,3- -diphosphoglyceric diphosphoglyceric
Aminoacyl Aminoacyl- -AMP AMP
R R – – C C – – CO ~ AMP CO ~ AMP
l l
NH NH
2 2
3. Enol phosphat 3. Enol phosphat
R R - - C C - - O ~ P O ~ P
ll ll
CH CH
l l
PEP (phosphoenolpyruvat) PEP (phosphoenolpyruvat)
COOH COOH
l l
C C - - O ~ P O ~ P
ll ll
CH CH
2 2
∆ ∆∆ ∆ ∆ ∆∆ ∆G G
0 0
’ ’
(Kcal/mol) (Kcal/mol)
- 7,3
- 10,1
- 14,8
4. Amidin 4. Amidin
R R – – C C – – NH ~ P NH ~ P
ll ll
NH NH
Arginin~P Arginin~P
Creatin~P Creatin~P
(phosphagen) (phosphagen)
NH ~ P NH ~ P
l l
HN = C HN = C
l l
N N - - CH CH
2 2
- - COOH COOH
l l
CH CH
3 3
5. Thioester 5. Thioester
R R - - C ~ SC C ~ SC
0 0
A A
ll ll
O O
COOH COOH
l l
CH2 CH2
l l
CH CH
2 2
l l
C ~ SCoA C ~ SCoA
ll ll
O O
Succinyl CoA Succinyl CoA
P
- 10,3
- 7,7
ATP
VAI TRÒ C
VAI TRÒ C


A PHOSPHORYL
A PHOSPHORYL
HO
HO
Á
Á
V
V
À
À
KH
KH


PHOSPHORYL
PHOSPHORYL
1. 1. T Tí ích ch tr trữ ữ năng năng lư lượ ợng ng
ADP + ADP + Pvc Pvc → →→ → → →→ → ATP ATP
↑ ↑↑ ↑ ↑ ↑↑ ↑
Q Q ( (t từ ừ quang quang h hợ ợp p ho hoặ ặc c c cá ác c ph phả ản n ứ ứng ng oxh oxh- -kh kh) )
Ở Ở mô mô: : Creatin Creatin → → Creatin Creatin ~ P ( ~ P (LK LK guanidin guanidin phosphat phosphat) )
ATP ADP ATP ADP
2. 2. Ho Hoạ ạt t ho hoá á c cá ác c ch chấ ất t
ATP ATP
↓ ↓↓ ↓ ↓ ↓↓ ↓
G G → →→ → → →→ → G G - - 6P + ADP 6P + ADP → →→ → → →→ → CO CO
2 2
, H , H
2 2
O, Q, O, Q, ch chấ ất t kh khá ác c
AB AB → →→ → → →→ → Acyl~SCoA Acyl~SCoA + AMP + AMP → →→ → → →→ → lipid, CO lipid, CO
2 2
, H , H
2 2
O O
AA AA → →→ → → →→ → Amino Amino acyl acyl + AMP + AMP → →→ → → →→ → AA AA- -ARNt ARNt → →→ → → →→ → protein protein
VAI TRÒ C
VAI TRÒ C


A PHOSPHORYL
A PHOSPHORYL
HO
HO
Á
Á
V
V
À
À
KH
KH


PHOSPHORYL
PHOSPHORYL
3. 3. V Vậ ận chuy n chuyể ển năng lư n năng lượ ợng ng
ATP + H ATP + H
2 2
O O → → ADP + Pvc ADP + Pvc
Q Q (t (t
0 0
, công d , công dù ùng tr ng trự ực ti c tiế ếp cho ho p cho hoạ ạt t
ñ ñộ ộng cơ th ng cơ thể ể) )
∆ ∆∆ ∆ ∆ ∆∆ ∆Go < 0 Go < 0
T Tỏ ỏa Q a Q
Quang h Quang hợ ợp p
Oxh G, AB,AA Oxh G, AB,AA
CTAC CTAC
V Vậ ận chuy n chuyể ển e n e
- -
(CHHTB) (CHHTB)
∆ ∆∆ ∆ ∆ ∆∆ ∆Go > 0 Go > 0
Thu Q Thu Q
STH ñpt STH ñpt
Ho Hoạ ạt h t hó óa h a hấ ấp p
thu t thu tí ích c ch cự ực c
lu luồ ồng th ng thầ ần n
kinh ñi kinh ñiệ ện năng n năng
ATP ATP
Q Q
Q Q
ADP ADP
VAI TRÒ C
VAI TRÒ C


A PHOSPHORYL
A PHOSPHORYL
HO
HO
Á
Á
V
V
À
À
KH
KH


PHOSPHORYL
PHOSPHORYL
4. 4. Ho Hoạ ạt ho t hoá á enzyme enzyme
Glycogen phosphorylase b
(không hoạt ñộng)
Glycogen phosphorylase a
(hoạt ñộng)
4 ATP
4 ADP
5. 5. Ứ Ức ch c chế ế enzyme enzyme
Glycogen synthase I
(hoạt ñộng)
Glycogen synthase D
(không hoạt ñộng)
ATP
ADP
phosphatase
kinase
CHU
CHU


I HÔ H
I HÔ H


P T
P T


B
B
À
À
O
O
HÔ H
HÔ H


P T
P T


B
B
À
À
O
O
-
-


ð
ð


t ch
t ch
á
á
y
y


c
c
á
á
c ch
c ch


t h
t h


u cơ trong cơ
u cơ trong cơ
th
th


.
.
-
-
S
S


oxh
oxh
-
-
kh x
kh x


y ra trong t
y ra trong t
ế
ế
b
b
à
à
o.
o.
-
-
Oxi h
Oxi h
ó
ó
a sinh h
a sinh h


c.
c.
HÔ H
HÔ H


P T
P T


B
B
À
À
O:
O:
ð
ð


C ði
C ði


M
M
-
-
S
S


n ph
n ph


m cu
m cu


i c
i c
ù
ù
ng v
ng v
à
à
Q t
Q t


a ra:
a ra:
C
C
6 6
H
H
12 12
O
O
6 6
+ 6O
+ 6O
2 2


6CO
6CO
2 2
+ 6H
+ 6H
2 2
O +
O +
686
686
kcal
kcal
-
-
ði
ði


u ki
u ki


n: t
n: t
0 0
= 37
= 37
0 0
C, P = 1 atm
C, P = 1 atm
-
-
C
C
á
á
ch x
ch x


y ra:
y ra:
+ Oxy
+ Oxy
không
không
tr
tr


c ti
c ti
ế
ế
p t
p t
á
á
c d
c d


ng v
ng v


i C,
i C,
H ñ
H ñ


t
t


o
o
ra CO
ra CO
2 2
v
v
à
à
H
H
2 2
O
O
+
+
Năng lư
Năng lư


ng ñư
ng ñư


c gi
c gi


i ph
i ph
ó
ó
ng
ng
d
d


n, t
n, t


t
t


, theo
, theo
t
t


ng giai ño
ng giai ño


n.
n.
HÔ H
HÔ H


P T
P T


B
B
À
À
O: S
O: S


T
T


O
O
TH
TH
À
À
NH CO
NH CO
2
2
V
V
À
À
H
H
2
2
O
O
CO CO
2 2
ñư ñượ ợc t c tạ ạo th o thà ành t nh từ ừ ph phả ản n ứ ứng kh ng khử ử carboxyl ( carboxyl (- -
COOH) t COOH) từ ừ c cá ác acid trung gian ñư c acid trung gian ñượ ợc t c tạ ạo th o thà ành nh
R R - - COOH COOH → →→ → → →→ → R R- -H + CO H + CO
2 2
Decarboxylase Decarboxylase
S Sự ự t tạ ạo th o thà ành H nh H
2 2
O: x O: xả ảy ra y ra ở ở m mà àng trong c ng trong củ ủa ty th a ty thể ể
SH
2
→ →→ →S (Substrate)
↓ ↓↓ ↓
2H → →→ → 2H
+
↓ ↓↓ ↓
2e
-
→ →→ →H
2
O
↓ ↓↓ ↓
½O
2
→ →→ → O
-2
2H - 2e
-
→ →→ → 2H
+
→ →→ → H
2
O
½O
2
+2e
-
→ →→ →O
-2
CHU
CHU


I HÔ H
I HÔ H


P T
P T


B
B
À
À
O:
O:
C
C
Á
Á
C Y
C Y


U T
U T


THAM GIA
THAM GIA
Cơ ch Cơ chấ ất cung c t cung cấ ấp hidro (SH p hidro (SH
2 2
): ch ): chấ ất chuy t chuyể ển ho n hoá á trung gian trung gian, ,
ñ ñặ ặc bi c biệ ệt t t từ ừ chu tr chu trì ình acid citric nh acid citric
Dehydrogenase (DH) c Dehydrogenase (DH) có ó NAD NAD
+ +
Dehydrogenase c Dehydrogenase có ó FMN, FAD (flavoprotein, FP): th FMN, FAD (flavoprotein, FP): thế ế năng oh năng oh- -
kh cao hơn DH g kh cao hơn DH gắ ắn NAD n NAD
+ +
nên nh nên nhậ ận H t n H từ ừ DH g DH gắ ắn NAD n NAD
+ +
. .
CoQ (ubiquinon) CoQ (ubiquinon)
H Hệ ệ th thố ống cytochrome (v ng cytochrome (vậ ận chuy n chuyể ển e n e- -): protoporphyrin c ): protoporphyrin có ó ch chứ ứa a
Fe Fe
+2 +2
/Fe /Fe
+3 +3
(Cyt b,c,a), ho (Cyt b,c,a), hoặ ặc Cu c Cu
+1 +1
/Cu /Cu
+2 +2
(a (a
3 3
). Cyt (a+a3) = Cyt oxydase ). Cyt (a+a3) = Cyt oxydase
Oxi phân t Oxi phân tử ử (O2): t (O2): từ ừ ph phổ ổi, c i, có ó th thế ế năng oxi ho năng oxi hoá á kh khử ử chu chuẩ ẩn n
(Eo (Eo’ ’) l ) lớ ớn nh n nhấ ất t
C Cá ác enzym kh c enzym khá ác: peroxidase, superoxide dimutase, catalase c: peroxidase, superoxide dimutase, catalase
UBIQUINON
UBIQUINON

G
G


m 6
m 6
-
-
10
10
ñơn v
ñơn v


isoprene;
isoprene;


ñ
ñ


ng v
ng v


t
t
b
b


c cao l
c cao l
à
à
10, nên
10, nên
còn g
còn g


i l
i l
à
à
Q10.
Q10.

T
T


i ti th
i ti th


, t
, t
rong ñi
rong ñi


u
u
ki
ki


n
n
á
á
i kh
i kh
í
í
: d
: d


ng oxi
ng oxi
ho
ho
á
á
(
(
quinon); trong
quinon); trong

ñi
ñi


u ki
u ki


n k
n k


kh
kh
í
í
:
:
d
d


ng kh
ng kh


(quinol)
(quinol)
Sơ ñ Sơ ñồ ồ CHHTB CHHTB
SH SH
2 2
S S
∆ ∆∆ ∆ ∆ ∆∆ ∆E E
0 0
’ ’=? =?
NAD NAD
+ +
NADH,H NADH,H
+ +
1ATP ( 1ATP ( ∆ ∆∆ ∆ ∆ ∆∆ ∆E E
0 0
’ ’>0.15 Volt) >0.15 Volt)
FADH FADH
2 2
FAD FAD
( ( ∆ ∆∆ ∆ ∆ ∆∆ ∆E E
0 0
’ ’<0.15 Volt) <0.15 Volt)
Q Q
10 10
QH QH
2 2
2H 2H
+ +
2e 2e
- -
2Fe 2Fe
+2 +2
(2Cytb) 2Fe (2Cytb) 2Fe
+3 +3
1ATP 1ATP
2Fe 2Fe
+3 +3
(2Cytc) 2Fe (2Cytc) 2Fe
+2 +2
2Fe 2Fe
+2 +2
(2Cyt(a+a3) 2Fe (2Cyt(a+a3) 2Fe
+3 +3
2Cu 2Cu
+1 +1
2Cu 2Cu
+2 +2
1ATP 1ATP
1/2O 1/2O
2 2
O O
- -2 2
E
0
’ -0,32V
-0,12V
+0,08V
+0,26V
+0,29V
+0,82V
. Ch . Chỉ ỉ s số ố phosphoryl h phosphoryl hó óa (P/O): s a (P/O): số ố phân t phân tử ử phosphat vô cơ ñư phosphat vô cơ ñượ ợc c
s sử ử d dụ ụng ñ ng ñể ể phosphoryl ho phosphoryl hoá á ADP th ADP thà ành ATP khi m nh ATP khi mộ ột nguyên t t nguyên tử ử
oxy b oxy bị ị kh khử ử th thà ành O nh O
- -2 2
) )
P/O = 1,2,3 P/O = 1,2,3 (<4) (<4)
Trung b Trung bì ình b nh bằ ằng 3. ng 3.
ATP ñư ATP ñượ ợc t c tí ích tr ch trữ ữ nhi nhiề ều hay u hay í ít hơn tu t hơn tuỳ ỳ v và ào chu o chuỗ ỗi hô h i hô hấ ấp t p tế ế b bà ào o
d dà ài hay ng i hay ngắ ắn hơn n hơn tu tuỳ ỳ theo cơ ch theo cơ chấ ất cung c t cung cấ ấp hydro. p hydro.
Oxi ho Oxi hoá á succinat th succinat thà ành fumarat: nh fumarat: ñư ñượ ợc 2 ATP c 2 ATP
Succinat
Fumarat
FAD
FADH
2
CoQ 1/2O
2
2ATP
Oxi hoá alpha-cetoglutarat thành succinat cho 4 ATP (chu
trình acid citric)
. S . Sự ự ph phá á gh ghé ép (l p (là àm gi m giả ảm ch m chỉ ỉ s số ố P/O) P/O)
SH SH
2 2
½ ½O O
2 2
Thyroxin, 2,4 Thyroxin, 2,4- -dinitrophenol (DNP) v.v dinitrophenol (DNP) v.v… …
ATP (Không t ATP (Không tạ ạo ra ñư o ra ñượ ợc) c)
Năng lư Năng lượ ợng không ñư ng không ñượ ợc d c dự ự tr trữ ữ trong ATP m trong ATP mà à b bị ị gi giả ải ph i phó óng ra ng ra
dư dướ ới d i dạ ạng nhi ng nhiệ ệt năng t năng. .
Ch Chú ú ý: ý:
*Thyroxin, 2,4DNP không *Thyroxin, 2,4DNP không ả ảnh hư nh hưở ởng ñ ng ñế ến n
Creatin P Creatin Creatin P Creatin
ADP ATP ADP ATP
Mô m Mô mỡ ỡ nâu (nhi nâu (nhiề ều u ở ở tr trẻ ẻ m mớ ới sinh, i sinh, ñ ñộ ộng v ng vậ ật ng t ngủ ủ ñông ñông, m , mà àu nâu l u nâu là à
do nhi do nhiề ều ti th u ti thể ể), c ), có ó protein ph protein phá á gh ghé ép (thermogenin), v p (thermogenin), vậ ận chuy n chuyể ển n
H+ tr H+ trở ở v và ào ti th o ti thể ể không t không tổ ổng h ng hợ ợp ATP p ATP → → tăng t tăng tạ ạo nhi o nhiệ ệt t
* S * Sự ự gi giả ải ph i phó óng AB ch ng AB chị ịu u ả ảnh hư nh hưở ởng ñi ng ñiề ều hòa c u hòa củ ủa noradrenalin, a noradrenalin,
v vậ ậy s y sự ự ph phá á gh ghé ép ch p chị ịu s u sự ự ñi ñiề ều hòa c u hòa củ ủa noradrenalin. a noradrenalin.
Pyruvat Succinat Pyruvat Succinat AcylCoA AcylCoA
LCG LCG
Malonat Malonat
(FP) FP2 (FP) FP2 FP3 FP3
Isocitrat Isocitrat
Malat NAD FP1 CoQ Malat NAD FP1 CoQ
Glutamat ADP+P Glutamat ADP+P ATP ATP Amytal Amytal
Rotenon Rotenon
β ββ β β ββ βOH acylCoA OH acylCoA
CO, H CO, H
2 2
S S
Antimycine Antimycine CN CN
- -
Cytb Cytc Cyta+a3 Cytb Cytc Cyta+a3 1/2O 1/2O
2 2
ADP+P ADP+P ATP ATP ADP+P ADP+P ATP ATP
S Sả ản ph n phẩ ẩm c m củ ủa CHHTB a CHHTB
1) H 1) H
2 2
0: do 0: do 2H 2H
+ +
+ 1O + 1O
- -2 2
→ →→ → → →→ → H H
2 2
O O
1 1 nguyên t nguyên tử ử oxy nh oxy nhậ ận 2e n 2e
- -
2) H 2) H
2 2
O O
2 2
: do 2 lo : do 2 loạ ại enzym: i enzym:
a) a) Amin oxidase Amin oxidase
Flavin H Flavin H
2 2
O O
2 2
FMN FMN
Flavin H Flavin H
2 2
O O
2 2
Cơ ch Cơ chế ế: m : mộ ột t phân t phân tử ử oxy nh oxy nhậ ận 2e n 2e
- -
2O + 2e 2O + 2e
- -
→ →→ → → →→ → 2O 2O
- -1 1
→ →→ → → →→ →H H
2 2
O O
2 2
2H 2H - - 2e 2e- - → →→ → → →→ → 2H 2H
+ +
H H
2 2
+ O + O
2 2
→ →→ → → →→ → H H
2 2
O O
2 2
b) b) Superoxid dismutase Superoxid dismutase
(trong chuy (trong chuyể ển h n hó óa acid nucleic: xanthin oxidase kh a acid nucleic: xanthin oxidase khử ử H t H từ ừ xanthin) xanthin)
Hai phân t Hai phân tử ử oxy oxy (O (O
2 2
) nh ) nhậ ận 2e n 2e
- -
2H 2H - - 2e 2e
- -
→ →→ → → →→ → 2H 2H
+ +
O O
2 2
+ 1e + 1e
- -
→ →→ → → →→ → O O
2 2
0 0- -
2O 2O
2 2
+ 2e + 2e
- -
→ →→ → → →→ → 2O 2O
2 2
0 0- -
2H 2H
+ +
+ 2O + 2O
2 2
0 0- -
→ →→ → → →→ → H H
2 2
O O
2 2
+ O + O
2 2
Trong ph
Trong ph


n
n


ng trên: 2O
ng trên: 2O
2 2
0 0- -
v
v


a l
a l
à
à
ch
ch


t kh
t kh


v
v


a
a
l
l
à
à
ch
ch


t oxh.
t oxh.
Ch
Ch


t kh
t kh


:
:
O
O
2 2
0 0- -
-
-
e
e
- -


O
O
2 2
0 0
Ch
Ch


t oxy h
t oxy h
ó
ó
a:
a:
O
O
2 2
0 0- -
+ e
+ e
- -


O
O
2 2
0 0-- --
M Mộ ột s t số ố h hệ ệ th thố ống oxh ng oxh- -kh khử ử ñ ñặ ặc bi c biệ ệt t
a) a) Glutathion Glutathion
Tripeptid ( Tripeptid (γ γGlu Glu- -Cys Cys- -Gly) Gly)
G G- -SH SH
2H 2H
G G - - S SH H G G - - S S
l l
G G - - S SH H G G - - S S
b bả ảo v o vệ ệ 1 s 1 số ố enzym (ch enzym (chứ ứa nh a nhó óm m – –SH, n SH, như CoA hư CoA)) kh )) khỏ ỏi t i tá ác ñ c ñộ ộng oxh. ng oxh.
b) b) Vit C (a. L Vit C (a. L- -ascorbic) ascorbic)
CH CH
2 2
OH OH
l l
H H - - C C – – OH OH
l l
C C – – H H
l l
0 C 0 C – – OH OH
l l
C C – – OH OH
l l
C = O C = O
CH CH
2 2
OH OH
l l
H H - - C C - - OH OH
l l
C C – – H H
l l
0 C = O 0 C = O
l l
C = O C = O
l l
C = O C = O
D Dạ ạng ng
kh khử ử
D Dạ ạng ng
oxh oxh
- - 2H 2H
+ 2H + 2H
D Dạ ạng ng
kh khử ử
D Dạ ạng ng
oxh oxh
K
K


T LU
T LU


N
N
Th
Th


c ch
c ch


t, chu
t, chu


i hô h
i hô h


p t
p t
ế
ế
b
b
à
à
o l
o l
à
à
qu
qu
á
á
tr
tr
ì
ì
nh oxy h
nh oxy h
ó
ó
a kh
a kh


x
x


y ra trong ñi
y ra trong ñi


u
u
ki
ki


n sinh h
n sinh h


c,
c,
năng lư
năng lư


ng (Q
ng (Q
)
)
ñư
ñư


c
c
gi
gi


i ph
i ph
ó
ó
ng t
ng t


t
t


v
v
à
à
ñư
ñư


c t
c t
í
í
ch tr
ch tr


trong
trong
c
c
á
á
c liên k
c liên k
ế
ế
t gi
t gi
à
à
u năng lư
u năng lư


ng (~) nh
ng (~) nh


ph
ph


n
n


ng phosphoryl h
ng phosphoryl h
ó
ó
a (
a (
thu năng
thu năng




ng) ADP th
ng) ADP th
à
à
nh ATP.
nh ATP.
5. Chu tr
5. Chu tr
ì
ì
nh Krebs
nh Krebs
5.1 5.1 ð ðạ ại cương i cương
- - CT acid tricarboxylic (TCA) CT acid tricarboxylic (TCA)
- - CT acid citric CT acid citric
- - Qu Quá á tr trì ình nh “ “ñ ñố ốt ch t chá áy y” ” oxh m oxh mạ ạch 2C (Act~SCoA) gi ch 2C (Act~SCoA) giả ải ph i phó óng 2pt ng 2pt
CO CO
2 2
, 4 c , 4 cặ ặp nguyên t p nguyên tử ử H (t H (tạ ạo th o thà ành H nh H
2 2
O) v O) và à năng lư năng lượ ợng. ng.
C
2 H
2
O
C
6
CO
2
C
5
CO
2
C
4
C
4
ATP
H
2
O
C
4
2H
2H
2H
2H
C
6
1
2
2
3
4
5
6
7
8
Phân t Phân tí ích c ch cá ác giai ño c giai ñoạ ạn n
Gñ Gñ1: 1:
C C
2 2
+ C + C
4 4
→ →→ → → →→ → C C
6 6
ActCoA + O.A + H ActCoA + O.A + H
2 2
O Citrat O Citrat
HSCoA HSCoA
4 4
COOH COOH
l l
3 3
C = O C = O
l l
2 2
CH CH
2 2
l l
1 1
COOH COOH
SCoA SCoA
∫ ∫
6 6
C=O C=O
l l
5 5
CH3 CH3
H HSCoA SCoA
H H
2 2
O O
5 5
C C - -
6 6
CO COOH OH
l l
H HO O - -
3 3
C C - -
4 4
COOH COOH
l l
2 2
C C - -
1 1
COOH COOH
Citrat
synthase
Acid citric Acid citric
+
Gñ Gñ 2: 2: ð ðồ ồng phân h ng phân hó óa acid citric, t a acid citric, tạ ạo phân t o phân tử ử b bấ ất ñ t ñố ối x i xứ ứng a. ng a.
isocitric. isocitric.
2 2
C C - -
1 1
COOH COOH
l l
HO HO - -
3 3
C C - -
4 4
COOH COOH
l l
5 5
C C- -
6 6
COOH COOH
2 2
C C - -
1 1
COOH COOH
ll ll
3 3
C C - -
4 4
COOH COOH
l l
5 5
C C- -
6 6
COOH COOH
H H
2 2
O O
HO HO - -
2 2
C C - -
1 1
COOH COOH
l l
3 3
C C - -
4 4
COOH COOH
l l
5 5
C C- -
6 6
COOH COOH
H H
2 2
O O
Cis Cis- -aconitat aconitat
aconitase aconitase
Isocitrat Isocitrat
Citrat Citrat
* ðều là acid tricarboxylic
Gñ Gñ 3: Kh 3: Khử ử CO CO
2 2
- -oxh isocitrat oxh isocitrat → → α αCG CG
H H
H HO O - -
2 2
C C - -
1 1
COOH COOH
l l
3 3
C C - -
4 4
COOH COOH
l l
5 5
C C- -
6 6
COOH COOH
O = O =
2 2
C C - -
1 1
COOH COOH
ll ll
3 3
C C - -
4 4
COOH COOH
l l
5 5
C C- -
6 6
COOH COOH
Oxalosuccinat Oxalosuccinat
NADH,H NADH,H
+ +
3 3’ ’
3 3
2 2
1 1
COOH COOH
l l
2 2
C C = O = O
l l
3 3
C C
l l
5 5
C C
l l
6 6
COOH COOH
CO CO
2 2
(4) (4)
Isocitrat DH Isocitrat DH
NAD NAD
+ +
α α- -cetoglutarat cetoglutarat
Gñ Gñ 4: Kh 4: Khử ử CO CO
2 2
- -oxh oxh α αCG CG → → succinyl CoA succinyl CoA
O = O =
2 2
C C ~ ~ SCoA SCoA
l l
3 3
C C
l l
5 5
C C
l l
6 6
COOH COOH
1 1
COOH COOH
l l
2 2
C C = O = O
l l
3 3
C C
l l
5 5
C C
l l
6 6
COOH COOH
TPP (thiamin TPP (thiamin
pyrophosphat) pyrophosphat)
Acid lipoic Acid lipoic
HSCoA HSCoA
FAD FAD
NAD NAD
+ +
CO CO
2 2
Ph Phứ ức h c hợ ợp enzym p enzym α αα α α αα αCG DH. CG DH.
1) 1) deCO deCO
2 2
- -lase lase (TPP (TPP- -(B1)) (B1))
2) 2) DH DH
3) 3) oxydase oxydase
a.lipoic a.lipoic
HSCoA HSCoA
FAD FAD
NAD NAD
+ +
CHO + CO CHO + CO
2 2
l l
CH CH
2 2
l l
CH CH
2 2
l l
COOH COOH
CO CO- -COOH COOH
l l
CH CH
2 2
l l
CH CH
2 2
l l
COOH COOH
TPP TPP
HS S HS S
l l
CO CO
l l
CH CH
2 2
l l
CH CH
2 2
l l
COOH COOH
CoA CoA
l l
S S
l l
CO CO
l l
CH CH
2 2
l l
CH CH
2 2
l l
COOH COOH
TPP TPP HSCoA HSCoA
S S S S
HS SH HS SH
2FADH 2FADH 2FAD 2FAD
NAD NAD
+ +
NADH,H NADH,H
+ +
NH
2
N CH
3
CH
2
-
+
N
N
CH
3
CH
2
- CH
2
- CH
2
– O - P ~ P
l l
C = C
l
C - S
l
H
R
1
-
+
N
CH
3
R
2
l l
C = C
l
C - S
l
CH3-C-COOH
l
OH
CH
3
-C-COOH
ll
O
R
1
-
+
N
CH
3
R
2
l l
C = C
l
C - S
l
CH3-CH
l
OH
TPP
CO
2
H HS S- -CH CH
2 2
l l
CH CH
2 2
l l
HS HS - -CH CH
l l
(CH (CH
2 2
) )
4 4
l l
COOH COOH
CoenzymA CoenzymA- -S S- -C C- -CH3 CH3
ll ll
O O
CoenzymA CoenzymA- -S SH H
CH3 CH3 - - C C – – S S - - CH CH
2 2
ll ll l l
O O CH CH
2 2
l l
H HS S - -CH CH
l l
(CH (CH
2 2
) )
4 4
l l
COOH COOH
S S - - CH CH
2 2
l l
CH CH
2 2
l l
S S - - CH CH
l l
(CH (CH
2 2
) )
4 4
l l
COOH COOH
NADHH NADHH
+ +
NAD NAD
+ +
2FAD 2FAD
2FADH 2FADH
R
1
R
2
Gñ Gñ 5 5
Gi Giả ải ph i phó óng HSCoA ng HSCoA → →t tí ích tr ch trữ ữ năng lư năng lượ ợng ng tr trự ực ti c tiế ếp p v và ào GTP o GTP
O= C~SCoA O= C~SCoA
l l
CH CH
2 2
l l
CH CH
2 2
l l
COOH COOH
O = C O = C- - OH OH
l l
CH CH
2 2
l l
CH CH
2 2
l l
COOH COOH
Pvc Pvc GTP GTP
GDP GDP
ATP ATP
ADP ADP
succinylCoA thiokinase
Gñ Gñ 6: 6: Oxh succinat t Oxh succinat tạ ạo fumarat o fumarat
COOH COOH
l l
CH CH
2 2
l l
CH CH
2 2
l l
COOH COOH
COOH COOH
l l
CH CH
ll ll
CH CH
l l
COOH COOH
FAD FAD
FADH FADH
2 2
Sucinat DH Sucinat DH
Gñ Gñ 7: 7:
COOH COOH
l l
CH CH
ll ll
CH CH
l l
COOH COOH
COOH COOH
l l
HCOH HCOH
l l
CH CH
2 2
l l
COOH COOH
Fumarase Fumarase
Malat Malat
H H
2 2
O O
Gñ Gñ 8: 8: Oxh malat t Oxh malat tạ ạo OA o OA
ActCoA + 3NAD ActCoA + 3NAD
+ +
+ 1FAD + 2H + 1FAD + 2H
2 2
O + Pvc O + Pvc → →→ → → →→ → 2CO 2CO
2 2
+ HSCoA + + HSCoA +
3,4,8 6 1,7 5 3,4,8 6 1,7 5 3,4 5 3,4 5
1GTP + 3NADHH 1GTP + 3NADHH
+ +
+ 1FADH + 1FADH
2 2
5 3,4,8 5 3,4,8 6 6
COOH COOH
l l
H HCOH COH
l l
CH CH
2 2
l l
COOH COOH
COOH COOH
l l
C C = O = O
l l
CH CH
2 2
l l
COOH COOH
NAD NAD
+ +
NADH,H NADH,H
+ +
Ph Phả ản n ứ ứng t ng tổ ổng qu ng quá át t
O.A O.A
gñ gñ 1 1
ActCoA ActCoA
Năng lư Năng lượ ợng t ng tí ích tr ch trữ ữ ñư ñượ ợc. c.
3NADHH 3NADHH
+ +
→ →→ → → →→ → 9ATP 9ATP
1FADH 1FADH
2 2
→ →→ → → →→ → 2ATP 2ATP
1GTP 1GTP → →→ → → →→ → 1ATP 1ATP
12 ATP 12 ATP
Malat dehydrogenase
-Gốc acetyl trong gñ1 ñi vào
phân tử OA mới ñược tạo
-CO
2
từ 2 nhóm carboxyl của
OA ở gñ 3 và 4
V Vị ị tr trí í, vai trò c , vai trò củ ủa a K K
- - L Là à giai ño giai ñoạ ạn 3 n 3, g , giai ño iai ñoạ ạn tho n thoá ái h i hó óa cu a cuố ối c i cù ùng chung c ng chung củ ủa c a cá ác c
ch chấ ất t
- - Ý ngh Ý nghĩ ĩa năng lư a năng lượ ợng: t ng: tạ ạo năng o năng: 1 g : 1 gố ốc acetyl c acetyl 2 CO 2 CO
2 2
, 12 ATP , 12 ATP
- - Ý ngh Ý nghĩ ĩa t a tổ ổng h ng hợ ợp: ti p: tiề ền ch n chấ ất t t tổ ổng h ng hợ ợp nhi p nhiề ều ch u chấ ất kh t khá ác c
Hem Hem
Th Thể ể ceton ceton
NH
2
Asp
Glu
SucCoA
NH
2
OA
α αα α CG
Tân t
Tân t


o glucid
o glucid
Asp
Asp
HSCoA
HSCoA
glu
glu
Suc.CoA
Suc.CoA
Th
Th


ceton
ceton
T
T


ng h
ng h


p Hem
p Hem
OA
OA
ActCoA
ActCoA
α
α
CG
CG
ði
ði


u ho
u ho
à
à
chu tr
chu tr
ì
ì
nh acid
nh acid
citric
citric





ng Act
ng Act
-
-
CoA v
CoA v
à
à
OA trong ti th
OA trong ti th



Nhu c
Nhu c


u t
u t
ế
ế
b
b
à
à
o ñ
o ñ


i v
i v


i ATP
i ATP
KHÁI NIỆM VỀ CHUYỂN
HÓA CÁC CHẤT
MỤC TIÊU
1. Trình bày ñược những khái niệm về chuyển
hóa các chất và chuyển hóa trung gian, quá
trình ñồng hóa và quá trình dị hóa, quan hệ
giữa ñồng hóa và dị hóa.
2. Phân tích ñược 3 giai ñoạn và một số ñặc ñiểm
của chuyển hóa trung gian.
4. Trình bày ñược phương pháp nghiên cứu
chuyển hóa trung gian.
1. Chuyển hóa các chất và chuyển
hóa trung gian.
- Chuyển hóa các chất bao gồm tất cả các
phản ứng hóa học xảy ra trong cơ thể từ
khi thức ăn ñược ñưa vào cơ thể ñến khi
chất cặn bã ñược thải ra ngoài môi
trường.
- Các quá trình trao ñổi tiến hành ñược là
nhờ những phản ứng hóa học liên tục xảy
ra trong cơ thể, gọi là chuyển hóa trung
gian.
Người ta có thể chia các quá trình chuyển
hóa các chất làm hai loại quá trình: ñồng hóa
và dị hóa:
- Dị hóa : quá trình thoái hóa, luôn giải phóng
năng lượng
- ðồng hóa: quá trình tổng hợp, cần cung cấp
năng lượng.
2. Quá trình ñồng hóa và dị hóa
ð
ð


NG H
NG H
Ó
Ó
A
A
D
D


H
H
Ó
Ó
A
A
Sinh tổng hợp Thoái hóa
Phản ứng khử Oxy hóa
Cần cung cấp năng
lượng
Giải phóng năng lượng
Phân tán (Diverging) Hội tụ (Converging)
Phân hủy các phân tử lớn
và phức tạp thành các
phân tử nhỏ.
Các phân tử hữu cơ lớn
và phức tạp ñược hình
thành từ các phân tử nhỏ
Acetyl CoA
Pyruvate
Glucose
Glycogen Starch
Leucine
Isoleucine
Sucrose
Serine
Alanine
Phenylalanine
Fatty Acids
Triglycerides
Phospholipids
Acetoacetyl CoA
Mevalonate
Isopentenyl-
pyrophosphate
Carotenoids
Fat Soluble Vitamins
Cholesterol
Steroidal
Hormones
Bile
Salts
Fatty Acids
Triglycerides
Phospholipids
Eicosanoids
Dị hóa (converging)
Many
Few
ðồng hóa
Few Many
(diverging)
Thức ăn
Carbohydrates
Lipid
Proteins
Sản phẩm cuối
H
2
O, CO
2,
NH
3
Dị hóa (oxy hóa,
tạo năng lượng)
Các ñại phân tử
Proteins
Polysaccharides
Lipids
Nucleic acids
Phân tử tiền thân
Amino acids
Monosaccarids
Acid béo
Base nitơ
ðồng hóa (khử, thu
năng lượng)
Năng lượng hóa
học
ATP
NADPH
NADPH
NADPH
GTP
ATP
ATP
NADH
Dị hóa và ñồng hóa luôn luôn liên quan với nhau.
3.
3.
BA GIAI ðO
BA GIAI ðO


N V
N V


CHUY
CHUY


N H
N H
Ó
Ó
A TRUNG GIAN
A TRUNG GIAN
Các G, L, P thoái hóa qua 3 giai ñoạn:
- Giai ñoạn 1: phân giải các ñại phân tử thành
các ñơn vị cấu tạo tương ứng
- Giai ñoạn 2: các ñơn vị cấu tạo biến ñổi qua
nhiều chất trung gian tới acetyl CoA
- Giai ñoạn 3: Acetyl CoA ñi vào chu trình
krebs, thoái hóa tạo CO
2
, H
2
O và 12 ATP.
Quá trình tổng hợp ngược lại với sự thoái hóa.
fats polysaccharides protein
Fatty acids
glycerol
Glucose Amino acids
pyruvate
Acetyl CoA
TCA
cycle
NH
3
CO
2
e-
H
2
O
O
x
i
d
a
t
i
v
e

p
h
o
s
p
h
o
r
y
l
a
t
i
o
n
Stage Ⅰ
Stage Ⅰ
Stage Ⅰ
biomolecules
building
blocks
common
intermediates
final
products
Krebs Cycle
Krebs Cycle
Figure 24.7
4. MỘT SỐ ðẶC ðiỂM CỦA CHUYỂN HÓA TRUNG GIAN
4.1. Xảy ra nhanh chóng ở pH gần trung tính, nhiệt ñộ 37
o
C,
nhờ các enzym xúc tác các phản ứng liên tiếp gồm nhiều
chất trung gian.
4.2. Có trạng thái ổn ñịnh về chuyển hóa, sự tổng hợp cân
bằng với thoái hóa, nghĩa là số phân tử mới ñược tạo thành
bằng số phân tử cũ bị thoái hóa.
4.3. Bilan của một chất là hiệu số giữa lượng nhập và lượng
thải.
- Bilan dương: nhập > thải: cơ thể ñang phát triển
- Bilan = 0
- Bilan < 0: nhập < thải: cơ thể ñang suy giảm.
4.4. Có sự thống nhất căn bản về chuyển hóa trong thế giới
sinh vật: thoái hóa G ở người và nấm men chỉ khác ở giai
ñoạn cuối.
4.5. Các quá trình chuyển hóa glucid, lipid, protid, acid
nucleic có liên quan chặt chẽ với nhau và ñược ñiều hòa
theo nhu cầu của cơ thể.
MỘT SỐ ðẶC ðiỂM CỦA CHUYỂN HÓA TRUNG GIAN
5. PHƯƠNG PHÁP NGHIÊN CỨU CHUYỂN HÓA
TRUNG GIAN
Mục ñích: xác ñịnh q/tr hóa học xảy ra trong TB:
- chất trung gian,
- enzym,
- cơ chế ñiều hòa
Kỹ thuật:
- Siêu ly tâm
- ðiện di
- Sắc ký,
- Kính hiển vi ñiện tử, quang phổ, huỳnh
quang…
Phương pháp nghiên cứu:
5.1. Phân tích các SP chuyển hóa:
- Bệnh phẩm: Máu, Nước tiểu, các dịch cơ thể
- Tìm hiểu sự thay ñổi về chất và lượng SPCH
→Bilan của các chất
→Rối loạn về CH
→Quá trình CH toàn vẹn
vd: - Phát hiện CO
2
ở cơ thể ðV → SP cuối cùng
của CH Glucid.
- ðưa alanin và glutamat vào cơ thể bệnh nhân
bị tiểu ñường
→ Glucose niệu ↑ → Ala và Glu là tiền chất của
Glucose
5.2. Dùng cơ quan tách rời, lát cắt mô.
5.3. Hệ thống vô bào: nghiền mô, siêu ly tâm
ñể tách các thành phần tế bào.
5.4. Dùng chất ñồng vị
5.5. Khuyết tật di truyền
BS. HOANG HIÊU NGOC
1
1. TIÊU HOA VA HẤP THU LIPID
2. CHUYỂN HOA ACID BEO
3. CHUYỂN HOA TRIGLYCERID,
PHOSPHOLIPD VA CAC LIPID KHAC
4. CHUYỂN HOA CHOLESTEROL
5. CAC DANG LIPID VÂN CHUYỂN (LIPID
HOA TAN)
6. ĐĂC ĐIỂM CHUYỂN HOA LIPID Ơ MÔT
SỐ MÔ
2
Lipid dự trữ:
TG: mỡ dƣới da, cơ quan bảo vệ
cơ thể, tích trữ và cung cấp NL
Thay đổi theo chế độ ăn, hoạt động
thể lực, độ tuổi
Nhu cầu lipid trong thức ăn: 60 –
100g
Mỡ vƣợt quá 30% nguy cơ bệnh
tim mạch, chuyển hóa (ĐTĐ)
Tỉ lệ eo/hông = 0.8 lý tƣởng
3
Lipid màng:
 Phospholipid, Cholesterol, Glycolipid
 Cấu trúc màng tế bào, bào quan
 ảnh hƣởng trực tiếp đến tính đặc thù chủng loại,
tính miễn dịch của mô, cơ quan
Lipid vận chuyển:
 Kết hợp với protein (albumin) để di chuyển trong
máu
Các dạng lipid liên quan mật thiết trong
chuyển hóa
Các thành phần có thể trao đổi với nhau
nhờ sự vận chuyển của các lipid hòa tan
4
5
6
1. Thủy phân triglycerid
ĐĂC ĐIỂM:
-Lipase chỉ tac dụng đặc hiệu
trên liên kết ester ở C1 và C3
của phân tử Triglycerid
-C2 chuyển thanh C1 trƣớc
khi bị thủy phân (nhờ
isomerase)
-Thủy phân TG ở hanh tá
trang không hoan toan tạo
thanh 1 hôn hợp cac sản
phâm trung gian: TG, DG,
MG, acid beo, glycerol
R
3
COOH
R
1
COOH
CH2O – CO – R1
CHO – CO – R2
CH2O – CO – R3
lipase
CH2O – CO – R1
CHO – CO – R2
CH2OH
lipase
CH2OH
CHO – CO – R2
CH2OH
CH2O – CO – R2
CHOH
CH2OH
isomerase
R
2
COOH
Glycerol
7
 Phosphodiesterase: căt liên kết ester giữa acid
phosphoric và cholin hoặc acid phosphoric với
glycerol → diglycerid, phosphocholin, acid
phosphoric, cholin
 Phosphomonoesterase (phosphatase) tiếp tục
thủy phân các sản phâm trên
 Cholesterol esterase thủy phân sterid thanh acid
beo và cholesterol
2. Thủy phân phospholipid và sterid
8
Qua mang ruột
 Glycerol, acid beo (<10C): tinh mạch cửa → gan.
Acid beo găn albumin để lƣu thông trong máu
 Acid beo chuôi dai, MG, DG: tổng hợp lại thanh
TG tại mang ruột.
 Cac lipid mới tổng hợp tại mang ruột nhƣ TG, CE
đƣợc bao boc bởi những thanh phần ƣa nƣớc
(PL, Cholesterol, apoprotein) → chylomycron →
mạch bạch huyết → gan
9
ÔNG RUÔT TB NIÊM MAC
RUÔT
HÂP THU
PL PL
C
AB
MG
Glycerol
CE
TG
ABMN ABMN AB - Albumin
C
AB
TG
CE
MG
Glycerol
Tinh mạch cửa
CM
Gan
Máu
Bạch huyết
10
11
1. THOÁI HÓA ACID BÉO
a. Thoái hóa acid béo bão hòa có số acrbon chẵn
b. Thoái hóa acid béo bão hòa có số carbon lẻ
c. Thoái hóa acid béo không bão hòa
d. Các thể ceton
2. TỔNG HỢP ACID BEO
a. Các chất tham gia vào quá trình sinh tổng hợp
b. Quá trình tổng hợp acid béo no
c. Quá trình tổng hợp acid béo không bão hòa
d. Điều hòa sinh tổng hợp acid béo
12
CHUYỂN HOA ACID BEO
13
− Các AB phải đƣợc kích hoạt để trở thành
dạng hoạt động acyl CoA
− Quá trình hoạt hóa (găn CoA) ở bào
tƣơng
− Ơ ngƣời và động vật: các acyl CoA phải đi
vào bào tƣơng ty thể (nhờ carnitin) để
đƣợc oxy hóa.
14
Acid béo đƣợc ester hóa với HSCoA ngoài ty
thể nhờ năng lƣợng ATP tạo ra acyl CoA
15
Phản ứng tổng quát:
R-COOH + 2ATP +HSCoA → Acyl CoA + 2 ADP + PP
Acyl CoA synthetase
• EnzymAcyl CoA synthetase (thiokinase) có nhiều ở màng ty
thể và hệ lƣới nội bào.
• Có nhiều loại Acyl CoA synthetase đặc hiệu cho từng loại AB
mạch ngăn, trung bình và dài
Vận chuyển acid béo vào trong ty thể
 Các acid béo mạch ngăn (ABMN) có 4 – 10 carbon qua màng ty
thể dễ dàng
 Acid béo mạch dài (ABMD) có 12 carbon trở lên đƣợc vận
chuyển nhờ hệ thống carnitin và enzym carnitin acyl
transferae (CAT)
 Carnitin ester hóa với acid béo tạo thành acyl carnitin và giải
phóng HSCoA dƣới xúc tác của carnitin acyl transferase I (màng
ngoài ti thể)
 Gốc acyl trong acyl carnitin chuyển đến CoenzymA (trong ty
thể) dƣới tác dụng của enzym carnitin acyl transferase II để
tạo thành acyl CoA và giải phóng carnitin.
16
17
Quá trình β oxy hóa
 Luôn xảy ra ở carbon β kể từ đầu có nhóm carboxyl
 Một lần β oxy hóa sẽ căt 1 mâu 2 carbon dƣới dạng acetyl CoA.
 Acyl CoA trải qua 4 phản ứng hóa học lặp lại nhiều lần đến khi
acyl CoA căt hoàn toàn thành acetyl CoA.
18
 Số phân tử ATP đƣợc tạo thành khi oxy hóa hoàn toàn 1
phân tử acid béo có số carbon chẵn:
Số ATP = [5(n-1) + 12n] – 2 = 17n – 7
 n: số pt acetyl CoA oxy hóa đến cùng trong chu trình
acid citric cho 12n pt ATP
 (n-1) vòng β oxy hóa cho 5(n-1) ATP
 Trừ 2 pt ATP cho quá trình hoạt hóa acid béo,
19
Quá trình β oxy hóa acid palmitic 16C
•Acid palmitic có 16C, đƣợc hoạt
hóa thành palmitoy CoA.
•Trải qua 7 vòng β oxy hóa, giải
phóng 8 phân tử acetyl CoA
•Số phân từ ATP đƣợc tạo thành:
129 ATP
20
Trải qua quá trình β oxy hóa
Vòng oxy hóa cuối cùng tạo acetyl CoA
và propionyl CoA
Propionyl CoA biến đổi nhiều lần thành
succinyl CoA →chu trình acid citric
21
Quá trình carboxyl-hóa propionyl CoA
Chu
trình
acid
citric
22
Trải qua quá trình β oxy hóa
AB không bão hòa phải thành dạng trans,
dạng L
Các liên kết đôi ở những vị trí khác nhau lần
lƣợt chuyển sang vị trí ∆
2
Số ATP tạo thành thấp hơn so với oxy hóa AB
bão hòa cùng số carbon
23
Quá trình oxy hóa acid béo không bão hòa có 1 liên kết đôi
24
Quá trình oxy hóa acid béo không bão hòa có nhiều liên kết đôi
25
26
Sự hình thành các thể ceton từ acetyl CoA
- Các thể ceton đƣợc tổng hợp
từ ty thể của tế bào gan
- Đƣợc chuyển vào máu, tới
các mô, tái tạo thành acetyl
CoA, rồi vào chu trình acid
citric
- Đói kéo dài (giảm cung cấp
glucose), não dùng β-OH
butyric làm chất đốt chính.
- Gan không thể dùng vì thiếu
điều kiện tăng hoạt phản ứng
tái tạo ActCoA từ các thể ceton
27
Quá trình tạo acetyl CoA từ D-β hydroxybutyric ở các mô ngoại vi
− Các thể ceton có tính acid
cao
− Khi nồng độ ceton trong
máu cao (vƣợt khả năng
đệm của máu) → hôn mê
tăng acid máu (ketoacidosis)
- Vƣợt quá 70 mg/dl → ceton
niệu (+)
- Vƣợt quá 100 mg/dl → hơi
thở mùi ceton
28
Đai tháo đƣờng nặng:
- Glucose không vào tế bào
đƣợc
- Tăng huy động acid béo
về gan (do thiếu insulin)
- Giảm tổng hợp triglycerid
tù acid béo
- Tăng tạo thể ceton từ quá
trình β oxy hóa ở gan
- Các mô ngoài gan tăng
hoạt động nhƣng sử dụng
không hết
29
30
CHUYỂN HOA ACID BEO
31
Acetyl CoA và hệ thống vận chuyển Act
CoA từ ty thể ra bào tƣơng
Malonyl CoA
Phức hợp multi-enzym acid béo
synthetase
NAPH,H
+
(từ con đƣờng HMP, khử carboxyl oxy hóa ở bào tƣơng,
khử carboxyl oxy hóa isocitrat ngoài ty thể)
32
(1) Sơ đồ vận chuyển acetyl CoA từ ty thể ra bào tƣơng
33
(2) Malonyl CoA đƣợc tạo thành từ phản ứng sau:
Act CoA +CO
2
→ Malonyl CoA
Act CoA carboxylase
Biotin
(3) Phức hợp multienzym acid béo synthetase
1
2 3
4
5
6
Malonyl CoA ACP
tranferase
Act CoA ACP
transferase
Cis enoyl-ACP reductase
(coenzym NADPHH
+
)
Β – ceto acyl ACP synthetase (chứa nhóm SH)
Β – ceto acyl ACP reductase
(coenzym NADPHH
+
)
D β – OH acyl ACP
hydratase
34
ACP protein vận chuyển
acyl có chứa nhóm ngoại
(chứa acid pantothenic có
nhóm SH trung tâm) và
thanh phần apoprotein la 1
chuôi polypeptid gồm 77
acid amin
Apoprotein
35
Vị trí găn với gốc
acyl nhờ liên kết
thioester
36
 Acid palmitic:
 sản phâm bình thƣờng của quá trình tổng hợp acid béo ở động vật
 Tiền chất của những acid béo mạch dài khác đƣợc kéo dài trong ty
thể
 PT tổng hợp acid palmitic từ Act CoA nhƣ sau:
8 Act CoA + 7CO
2
+ 7ATP +14 NADPH,H
+
+ HSCoA → Palmityl CoA +
8HSCoA + 7CO
2
+ 7ADP + 7Pvc + 7H2O +14NADP
+
37
Sinh tổng hợp acid béo không bão hòa
 Xảy ra ở lƣới nội bào tế bào gan, mô mỡ
 Tiền chất: acid palmitic và acid stearic
Palmityl CoA + NADPH,H
+
+ O
2
→ Palmitooleyl CoA + NADP
+
+ H
2
O
Stearyl CoA + NADPH,H
+
+O
2
→ Oleyl CoA + NADP
+
+ H
2
O
o Qui luật tạo liên kết đôi
o Liên kết đôi đầu tiên ở carbon thứ 9
o Liên kết đôi kế tiếp tạo giữa liên kết đôi trƣớc và nhóm COOH (từ ∆
9

thể tạo ra ∆
6
chứ không tạo ∆
12
)
38
 Cac acid beo không bão hòa nhiều liên kết đôi trong cơ thể động
vật đều có nguồn gốc từ 4 tiền chất:
 Palmitoleic C
16

9
→ tạo nhóm C
ᵚ-7
 Oleic C
18

9
→ tạo nhóm C
ᵚ-9
 Linoleic C
18

9 - 12
→ tạo nhóm C
ᵚ-6
 Linolenic C
18

9-12-15
→ tạo nhóm C
ᵚ-3
 Acid linoleic va acid linolenic la acid beo cần thiết (vitamin F)
39
Sơ đồ tổng hợp Prostagladin
Prostagladin có những tính chất
tƣơng tự nội tiết tố.
Cac prostagladin có nguồn gốc từ
acid beo không no nhiều liên kết
đôi đƣợc tổng hợp theo sơ đồ sau:
40
 Nhịp độ thành lập triglycerid và phosphoglycerid
 Mô nào có hệ thống HMP hoạt động mạnh cũng là nơi có
sinh tổng hợp AB vì NADPH,H+ đƣợc cung cấp nhiều
 Tình trạng dinh dƣỡng ảnh hƣởng đến quá trình sinh tổng
hợp acid béo
 Ảnh hƣởng của hormon: thiếu insulin (ĐTĐ) làm giảm lƣợng
glucose vào tế bào, giảm STH acid béo nhƣng lƣợng acid
béo tự do trong máu tăng (do tăng thoái hóa triglycerid)
41
42
1. Thoái hóa triglycerid và phospolipid
• Thoái hóa triglycerid
• Thoái hóa phospholipid
2. Tổng hợp triglycerid và phospholipid
• Hoạt hóa các chất tham gia sinh tổng hợp
triglycerid, phospholipid
• Quá trình tổng hợp triglycerid và phospholipid
3. Tổng hợp sphingolipid
• Tổng hợp ceramid
• Sơ đồ tổng hợp sphingolipid từ ceramid
• Thoái hóa sphingolipid
43
CHUYỂN HOA TRIGLYCERID, PHOSPHOLIPID VA
CÁC LIPID KHÁC
44
Triglycerid
DG
β MG
Glycerol
PDA
Chu trình
acid citric
lipase
AB AB
lipase
NADP,H
+
NAD
+
ATP
ADP
45
Acid béo đƣợc tách từ triglycerid, tùy theo nhu cầu mà
tham gia tái tổng hợp trở lại triglycerid hoặc vào máu
Glycerol vào máu chuyển đến các mô khác nhƣ gan,
thận để đƣợc phosphoryl hóa nhờ enzym
glycerolkinase chuyển thành glycerol P.
Chất này chuyển thành phosphoglyceraldehyd tham gia
tổng hợp glucose hoặc oxy hóa thành Act CoA vào chu
trình acid citric
46
Dƣới tác dụng của
phospholipase A, B, C,
D, các phospholipid bị
thủy phân hoàn toàn,
giải phóng các thành
phần cấu tạo: AB,
glycerol, acid
phosphoric, base N
47
CHUYỂN HOA TRIGLYCERID, PHOSPHOLIPID VA
CÁC LIPID KHÁC
48
Sinh tổng hợp triglycerid
xảy ra mạnh mẽ ở gan va
mô mỡ
Sinh tổng hợp phospholipid
xảy ra chủ yếu ở gan rồi
vận chuyển đến cac mô
khac, tham gia cấu tạo
mang tế bao hoặc thoai hóa
cho năng lƣợng
49
Act CoA: tổng hợp AB
50
Act CoA: tổng hợp AB
51
Act CoA: tổng hợp AB
 - glycerol phosphat (-GP):
 Từ thoái hóa glucid (mỡ, gan)
 Từ glycerol (enz: glycerol kinase -GP) (gan,
thận, ruột, tuyến sữa)
Base nitơ đƣợc găn với cholin hoặc
enthanolamin
52
CHUYỂN HOA TRIGLYCERID, PHOSPHOLIPID VA
CÁC LIPID KHÁC
53
54
55
56
Cholesterol la thanh phần cấu tạo mang tế
bao động vật, tiền chất của hormon steroid
của tế bao sinh dục v.v….
Trong qua trình thoai hóa cholesterol tạo
ra acid mật, muối mật cho sự hấp thụ va
tiêu hóa lipid.
57
CHUYỂN HOA CHOLESTEROL
58
 Cholesterol đƣợc tổng hợp
chủ yếu ở gan, vỏ thƣợng
thận, lách, niêm mạc ruột,
phổi, thận.
 Gồm 3 giai đoạn chủ yếu
trong quá trình sinh tổng
hợp cholesterol
 Giai đoạn 1: Tạo acid
mevalonic
 Giai đoạn 2: Tạo squalen
 Giai đoạn 3: Tạo cholesterol
(27C)
59
60
Tạo đơn vị 5 carbon
Isopentenyl pyrophosphat
61
Trùng ngưng các phân tử
Isopentenyl pyro tạo squalen
62
63
Cholesterol di chuyển trong
mau, đặc biệt trong thanh
phần β-lipoprotein.
Ơ gan, cholesterol bị ester
hóa thành cholesterol ester
Nồng độ cholesterol toan
phần = 2g/l.
Bình thƣờng tỉ lệ CE/CT =
2/3; tỉ lệ nay giảm trong
những bệnh lý gan mật.
64
 Cholesterol la tiền chất của nhiều chất có
hoạt tính sinh hoc quan trong
 Cac acid mật, muối mật: cholesterol → acid
cholanic → acid mật
 La dẫn xuất của acid cholanic (24c)
 Tùy theo vỊ trí của cac nhóm OH ở C3, C7 và C12
sẽ có cac acid mật khac nhau
 OH ở C3, C7, C12: acid cholic
 OH ở C3, C12: acid deoxycholic
 OH ở C3, C7 : acid chenodeoxycholic
 OH ở C3 : acid lithocholic
 Cac acid mật ở dạng liên hợp với glycin hoặc
taurin tạo nên muối mật tƣơng ứng: glycocholat,
taurocholat, glycodeoxycholat, tauro-deoxycholat
65
Vitamin D
 Nội tiết tố steroid
 Hormon sinh dục nữ (18C): phenol steroid: estron, estradiol,
estriol
 Hormon sinh dục nam (19C): androgen, androsteron
 Corticoid (21C): glucocorticoid, mineralcorticoid, progesteron
66
67
 TG LIÊN TỤC ĐƢỢC THỦY PHÂN VA TAI TỔNG
HỢP
 TG ĐƢỢC THỦY PHÂN TAO GLYCEROL TỰ DO VA
ACID BÉO
 GLYCEROL TỰ DO VỀ AN ĐỂ TAI TỔNG HỢP TG
VÀ PL.
 INSULIN LAM TĂNG HẤP THU GLUCOSE TẾ BAO,
TĂNG THOAI HOA GLUCOSE TAO GLYCEROL – P,
TĂNG TỔNG HỢP TG, ỨC CHẾ HOAT ĐÔNG
LIPASE
68
 GAN LA NƠI TAO MÂT, THOAI BiẾN VA TỔNG HỢP
ACID BÉO, PHOSPHOLIPID, CE, TG.
 TỔNG HỢP AB, β - OXY HOA XẢY RA CHỦ YẾU Ơ
GAN, TAO RA ACT CoA
 PL TAO RA Ơ GAN, VÂN CHUYỂN, ĐƢA MỠ RA
KHỎI GAN
 GAN MỠ: ĂN QUA NHIỀU GLUCID, CHẤT BEO, HUY
ĐÔNG ACID BEO VỀ GAN NHIỀU, TAO KHÔNG ĐỦ
LIPOPROTEIN DO THIẾU APO B (dùng KS), THIẾU
PHOSPHOLIPID (thiếu AB, cholin,v.v…)
69
LIPOPROTEIN
 CM
 VLDL
 LDL
 HDL
70
CM VLDL LDL HDL
Tỉ trong < 0.95 0.95 – 1.006 1.019 – 1.063 1.063 – 1.210
Thành phần
Protein 2 8 22 40 – 45
Triacylglycerol 86 55 6 4
Cholesterol
ester
3 12 42 12 – 20
PL 7 18 22 25 – 30
Apoprotein A-I, A-II, B-48,
B-100, C-I, C-
II, C-III
B-100, C-I, C-
II, C-III, E
B-100 A-I, A-II, C-I,
C-II, C-III, D,
E
CM: từ mạch bạch huyết vào máu. Men lipase ở
mạch máu thủy phân TG trong CM cho mô sử
dụng, phần CM còn lại tiếp tục vào gan. chất vận
chuyển TG ngoại sinh (thức ăn)
VLDL: tổng hợp ở gan rồi vào máu. Vận chuyển TG
nội sinh (đƣợc tổng hợp trong cơ thể)
LDL: giàu cholesterol, đƣa cholesterol đến mô
ngoại vi
HDL: đƣa cholesterol ngoại vi về gan
72
Hóa sinh y hoc
Lehninger Principles of Biochemistry (4
th
edition)
Harper’s Biochemistry (24
th
edition)
Biochemistry 3
rd
edition (Mathews, Van
Holde, Ahern)
CHUYEÅN HOÙA
ACID NUCLEIC ACID NUCLEIC
MUÏC TIEÂU
1. Vieát ñöôïc sô ñoà chi tieát cuûa söï thoaùi hoùa base purin
2. Neâu ñöôïc caùc chi tieát veà beänh guùt
3. Moâ taû ñöôïc söï toång hôïp ADN hay söï nhaân ñoâi ADN 3. Moâ taû ñöôïc söï toång hôïp ADN hay söï nhaân ñoâi ADN
4. Moâ taû ñöôïc söï toång hôïp ARN hay söï chuyeån maõ
5. Phaân bieät ñöôïc söï khaùc bieät giöõa söï chuyeån maõ ôû teá
baøo nhaân sô vaø söï chuyeån maõ ôû teá baøo nhaân thöïc.
1. THOAÙI HOÙA ACID NUCLEIC
1.1. Sô ñoà toång quaùt
Acid nucleic (ADN, ARN)
H
2
O Nuclease
Nucleotid
Pvc Nucleotidase Pvc Nucleotidase
Nucleosid
Nucleosidase
Base N + Pentose
Base N + Pentose
Purin Pyrimidin
Acid uric NH
3
, CO
2
Ureâ
1.2. Thoaùi hoùa base purin
Ngöôøi
Chim Acid uric NT
Moät soá boø saùt
Saûn phaåm
thoaùi hoùa cuoái cuøng
Moät soá boø saùt khaùc
Ña soá ÑV coù vuù Alantoin
#
Ña soá ÑV coù vuù Alantoin
Nhuyeãn theå
Uricase
Bình thöôøng:
-Acid uric/maùu ≈ 3 – 6 mg%
-Acid uric /NT ≈ 500-800 mg/ 24 giôø
Beänh “guùt” (goutte, gout, thoáng phong):
• Acid uric/maùu ↑↑: >10mg% →15-20mg%
• Coù tinh theå Natri Urat ôû suïn,xöông …ñaëc bieät laø caùc khôùp → Coù tinh theå Natri Urat ôû suïn,xöông …ñaëc bieät laø caùc khôùp →
Vieâm khôùp caáp
• Soûi ñöôøng tieåu.
1.3.Thoaùi hoùa base Pyrimidin
Chuû yeáu ôû gan
2.TOÅNG HÔÏP ACID NUCLEIC
Nguyeân lieäu:
H
3
PO
4
: töø thöùc aên
Ribose: töø con ñöôøng HMP---->Ribose-5- P
Base N: cô theå toång hôïp.
2.1.Toång hôïp Purin vaø Purin Nucleotid
Purin nucleotid : AMP, IMP,GMP.
Tröïc tieáp töø base Purin
Qua 2 con ñöôøng
Taân taïo töø Ribose-5- P
Beänh guùt nguyeân phaùt:
- ↑ hoaït tính PRPP synthetase → ↑ Purin nucleotid
- ↓ HGPRT → ↑ Acid uric
Duøng pp ñoàng vò vôùi
14
C vaø
15
N →xaùc ñònh ñöôïc nguoàn goác
caùc nguyeân töû trong nhaân Purin:
Söï taïo thaønh caùc Nucleosid di vaø triphosphat:
2.2. Toång hôïp Pyrimidin vaø Pyrimidin nucleotid
2 giai ñoaïn:
Nguoàn goác caùc phaân töû treân Pyrimidin:
2.3. Toång hôïp caùc deoxyribonucleotid
khöû oxy ôû C
2’
Ribonucleotid Deoxyribonucleotid
Quaù trình khaùc nhau ôû caùc loaøi:
*E.coli:
NDP dNDP
*Lactobacillus:
NTP dNTP
*Toång hôïp caùc dNTP töø dNDP:
dNDP dNTP
ATP ADP
2.4. Toång hôïp ADN
2.4.1.Söï nhaân ñoâi baùn baûo toàn
- Moâ hình: caáu truùc xoaén ñoâi
- Watson vaø Crick: giaû thuyeát veà cô cheá baùn
baûo toàn cuûa söï toång hôïp ADN.
2.4.2.Caáu truùc chaïc ba cuûa ADN (replication
fork)
2.4.3.Quaù trình nhaân ñoâi ADN
Ít nhaát 20 enzym vaø yeáu toá Protein tham gia
heä thoáng Replicase (Replisom) hoaït
ñoäng vôùi toác ñoä raát nhanh vaø raát chính xaùc:
Tieàn chaát: 4 loaïi dNTP Tieàn chaát: 4 loaïi dNTP
“Boä maùy nhaân ñoâi “
Quaù trình nhaân ñoâi ADN, 5 giai ñoaïn:
1. Nhaän bieát ñieåm môû ñaàu vaø thaùo xoaén taùch
bieät 2 sôïi ADN meï (heä thoáng Replicase)
2 loaïi protein chính tham gia quaù trình naøy:
ADN helicase, taùch rôøi hai sôïi ADN helicase, taùch rôøi hai sôïi
Protein gaén ADN sôïi ñôn (single strand
DNA – binding protein hay SSB protein),
giöõ cho 2 sôïi ADN ñôn ôû traïng thaùi rôøi nhau
vaø oån ñònh
2. Taïo ARN moài nhôø primase
Primase keát hôïp ADN helicase taïo primosom
3.Toång hôïp hai sôïi ADN môùi nhôø ADN polymerase
(ADN Polymerase III)
-sôïi daãn,
-sôïi sau ñoaïn Okazaki -sôïi sau ñoaïn Okazaki
4. Loaïi ARN moài nhôø ADN polymerase I. Sau ñoù caùc
ñoaïn ADN môùi tieáp tuïc ñöôïc keùo daøi.
5. Noái nhöõng ñoaïn ADN môùi nhôø ADN ligase
2.4.4. Söûa chöõa ADN :
E.coli, tæ leä sai soùt 1/10
9
– 10
10
nucleotid.
Nhôø ADN polymerase I vaø III coù theå luøi laïi taùch
vaø loaïi boû nucleotid sai, gaén nucleotid ñuùng.
ARN polymerase khoâng coù taùc duïng töï söûa ARN polymerase khoâng coù taùc duïng töï söûa
chöõa.
Söï nhaân ñoâi ADN ôû tb nhaân thaät vaø tb nhaân sô
ñeàu töông töï nhö nhau.
2.5.Toång hôïp ARN (Söï chuyeån maõ)
CCCACAGCCGCCAGTTCCGCTG
CGCATTTT
ADN-sợi mã hóa
GGGTGTCGGCGGTCAAGGCGAC
GCGTAAAA
ADN-sợi
khuôn
CCCACAGCCGCCAGUUCCGCUG
CGCAUUUU
ARN m
2.5.1. ÔÛ tb nhaân sô
a. Giai ñoaïn khôûi ñaàu:
ARN polymerase:
Holoenzym: α
2
ββ’σ.
Enzym loõi (core enzyme): α
2
ββ’
Tieåu ñôn vò σ seõ tìm moät ñieåm coù gen khôûi ñoäng
Söï toång hôïp ARN khoâng caàn moät ñoaïn moài.
Ñaàu 5’ cuûa nhöõng chuoãi ARN môùi ñeàu baét ñaàu baèng
pppG hoaëc pppA.
Söï toång hôïp ARN xaûy ra theo chieàu 5’→3’, gioáng söï
toång hôïp ADN.
b. Giai ñoaïn keùo daøi: b. Giai ñoaïn keùo daøi:
ARN Polymerase khoâng coù hoaït tính nuclease. Möùc
ñoä sai soùt cuûa söï toång hôïp ARN laø 1/10
4
hoaëc 1/10
5
c. Giai ñoaïn keát thuùc
Ñieàu chænh ARN:
• ARNm ñöôïc ñieàu chænh raát ít hoaëc khoâng caàn ñieàu
chænh sau khi ARN ñöôïc toång hôïp. Moät soá ARN
ñöôïc giaûi maõ ngay trong quaù trình chuyeån maõ.
• tieàn ARNt vaø tieàn ARNr:
- bò caét ñoaïn bôûi nuclease vaø ñöôïc ñieàu chænh thaønh
nhöõng sôïi ARN môùi. nhöõng sôïi ARN môùi.
- theâm moät soá nucleotid vaøo ñaàu ARN.Ví duï, CCA
ñöôïc theâm vaøo ñaàu 3’ cuûa moät soá phaân töû ARNt naøo
chöa coù saün trình töï chuoãi naøy ôû ñaàu.
- thay ñoåi veà base vaø ribose cuûa ARNr.
moät soá base ñöôïc methyl hoùa ;
- taïo base hieám ôû ARNt
2.5.2.ÔÛ teá baøo nhaân thaät:
a. Söï chuyeån maõ vaø giaûi maõ phaân caùch nhau veà
khoâng gian vaøthôøi gian
• Xaûy ra trong nhaân.
• Taïo ra raát nhieàu ARN sau naøy seõ thaønh ARNm.
• Nhöõng baûn sao tieân phaùt caàn coù moät caùi choùp ôû ñaàu 5’
vaø moät ñuoâi polyA ôû ñaàu 3’.
• Haàu heát caùc tieàn ARNm ôû teá baøo coù nhaân thaät baäc cao
ñeàu ñöôïc qua moät quaù trình caét noái (splicing).
b. ARN ôû teá baøo coù nhaân thöïc ñöôïc toång hôïp bôûi 3 loaïi
ARN polymerase
Loaïi Vò trí Baûn sao
I Haïch nhaân ARNr 18S, 5.8S vaø28S
II Nhaân chaát tieàn ARNm vaø ARN hn
III Nhaân chaát ARNt vaø ARNr 5S
c. Nhöõng gen khôûi ñoäng ôû teá baøo nhaân thöïc coù chöùa
moät hoäp TATA vaø coù theâm nhöõng trình töï chuoãi
ngöôïc doøng
-----------5’ TATAAAA 3’---------+1--------
-25
Hoäp TATA Hoäp TATA
d. Coù nhöõng protein ñaëc hieäu ñöôïc goïi laø nhöõng
yeáu toá chuyeån maõ (transcription factors) töông
taùc vôùi nhöõng gen khôûi ñoäng ôû teá baøo coù nhaân
thöïc
e. Nhöõng chuoãi taêng cöôøng (enhancer sequences) coù theå kích
thích söï chuyeån maõ caùch ñieåm khôûi ñaàu haøng nghìn base
f. Tieàn ARNm ñöôïc gaén choùp ôû ñaàu 5’ trong quaù trình chuyeån
maõ
• Tieàn ARNm:
- choùp 7-methylguanosin ôû ñaàu 5’
- ñuoâi polyadenylat, daøi khoaûng 250 goác A, ôû ñaàu 3’. - ñuoâi polyadenylat, daøi khoaûng 250 goác A, ôû ñaàu 3’.
- khi bò maát ñuoâi polyA, noù ñöôïc chuyeån ra khoûi nhaân vaø ñöôïc
duøng laøm khuoân cho söï toång hôïp protein.
• ARNt vaø ARNr : khoâng coù choùp.
g. Nhöõng ñieåm caét noái cuûa tieàn ARNm thì ñöôïc xaùc ñònh ñaëc
hieäu bôûi nhöõng trình töï chuoãi ôû cuoái intron
• Caét loaïi chính xaùc intron khoûi tieàn ARNm.
• Trình töï chuoãi cuûa moät intron:
GU ………………………AG.
• Thalassemia:
- do moät söï caét noái sai gaây neân.
- haäu quaû: ARNm ñöôïc taïo ra seõ chöùa moät loaït nhöõng maõ maø
bình thöôøng thì khoâng thaáy hieän dieän.
- haäu quaû: ARNm ñöôïc taïo ra seõ chöùa moät loaït nhöõng maõ maø
bình thöôøng thì khoâng thaáy hieän dieän.
Ñaàu 3’ bình thöôøng cuûa intron
Bình thöôøng
5’CCTATTGGTCTATTTTCCACCCTTAGGCTGCTG 3’

β-thalassemia
5’CCTATTAGTCTATTTTCCACCCTTAGGCTGCTG 3’
POLYMERASE CHAIN REACTION
(PCR)
ÖÙng duïng trong Y hoïc
1. Chaån ñoaùn vaø nghieân cöùu caùc roái loaïn di truyeàn:
Ví duï: Thalassemia, huyeát höõu , beänh thoaùi hoùa cô
Duchenne, cystic fibrosis…….
2. Chaån ñoaùn vaø nghieân cöùu caùc taùc nhaân gaây beänh truyeàn
nhieãm
Ví duï: chaån ñoaùn lao, soát xuaát huyeát, soát reùt, nhieãm Ví duï: chaån ñoaùn lao, soát xuaát huyeát, soát reùt, nhieãm
leptospira, HBV, HCV, HIV, HPV (human papilloma
virus), cuùm H5N1…..
3. Phaùt hieän ñoät bieán cuûa vi khuaån khaùng thuoác:
- vi khuaån lao khaùng isoniazid
- SVVG B khaùng lamivudine
- moät soá vi khuaån khaùng thuoác
4. Chaån ñoaùn vaø nghieân cöùu moät soá beänh ung thö:
Phaùt hieän ñoät bieán p53 trong ung thö tröïc traøng,
ung thö phoåi, ung thö coå töû cung, ung thö vuù, ung
thö vuøng haøm maët….
5. Phaùp y, hình phaùp hoïc vaø toäi phaïm hoïc:
- nhaän daïng moät caù theå - nhaän daïng moät caù theå
- xaùc ñònh moät moái quan heä huyeát thoáng
- hoaëc tìm chöùng cöù buoäc toäi hay tha boång ñoái vôùi
moät ngöôøi bò nghi ngôø trong moät vuï aùn gieát ngöôøi
hay hieáp daâm.
ADN laáy töø moät sôïi toùc, moät veät maùu khoâ …./.
HÓA+͌& HEMOGLOBIN
BS. HOÀNG H!ɻU NG͌C
B͘ MÔN SINH HÓA - KHOA Y - Ĉɝ! H͌C Y DɈ͢C
0ͤ& TIÊU
1. PHÂN LOɝ! CROMOPROTEIN
2. MÔ Tɟ CɡU TɝO HEME VÀ GLOBIN
3. PHÂN TÍCH SͰ KɻT H͢P G!ͮA HEME VÀ
GLOBIN
4. CÁC DɝNG HEMOGLOBIN
5. VAI TRÒ CͦA HEME TRONG vɩN CHUYɿN
KHÍ (O2; CO2)
6. KHɟ NĂNG TɝO CARBON MONOXYD Hb VÀ
KHɟ NĂNG OXY HÓA Hb.
7. TÍNH CHɡT ENZYM CͦA HEMOGLOBIN
CROMOPROTEIN
-
-
PROTEIN TɝP, CÓ CHͨA CHɡT MÀU
*͒0
1. CÓ NHÂN PORPHYRIN: PORPHYRINOPROTEIN
VD: HEMOGLOBIN; MYOGLOBIN; OXYDOREDUCTASE
2. KHÔNG CÓ NHÂN PORPHYRIN: CROMOPROTEIN
VD: FLAVOPROTEIN; FERRITIN; HEMOCYAMIN
PORPHYRIN
- CɡU TɝO BɫT NGU͒N Tͪ VÒNG PYROL
- VÒNG PYROL:
N
H
N
|
H
CH
CH
HC
HC
- B͐N VÒNG PYROL LIÊN KɻT v͚! NHAU
QUA B͐N CɣU N͐! METHYLEN (-CH2=)
TɝO NÊN PORPHIN
NHÂN PORPHIN
- ĈANH S͐ THͨ TͰ VÒNG PYROL:
- S͐ LA MÃ: I, II, III, IV
- THEOCH!ɽU KIM Ĉ͒NG H͒
- ĈANH DɡU CɣU N͐! METHYLEN
-
-
-
-
Į (G!ͮA PYROL I VÀ PYROL II)
ƨ (G!ͮA PYROL II VÀ PYROL III)
DŽ (G!ͮA PYROL III VÀ PYROL IV)
į (G!ͮA PYROL IV VÀ PYROL I)
- ĈANH S͐ CÁC ĈʅNH PORPHIN:
- 1, 2, 3, 4, 5, 6, 7, 8
6 5
N
NH HN
N
1 2
3
4
8
7
3
4
8
7
II
1 2
I
IV
III
6 5
HN NH
C
HC
HC
C
C
(1)
HC
(2)
CH
C
CH(3)
CH(4)
C
CH
(5)
C
HC
(6)
(7) HC
(8) HC
II
N
III
IV
I
N
CH
C
C
CH
ɲ
ɴ
ɶ
ɷ
CÔNG 7+ͨ& &ɡ8 7ɝ2 &ͦ$ PORPHIN
- PORPHIN ĈɈ͢C GɫN THÊM CÁC G͐C HÓA
H͌C Tɝ! CÁC vʇ TRÍ 1, 2, 3, 4, 5, 6, 7, 8 Sɹ
TɝO THÀNH PORPHYRIN
4 PYROL PORPHIN
PORPHYRIN
GӔCTHӂ
N
P
A
P
A
P
A
P
A
BɟNG 1: CÁC G͐C THɻ CͦA PORPHYRIN
TÊN GӔC THӂ
METHYL
ETHYL
HYDROXYETHYL
VYNYL
GӔC ACETYL
GӔC PROPIONYL
CÔNG THӬC
-CH3
-CH2-CH3
-CH2-CH2OH
-CH=CH2
-CH2-COOH
-CH2-CH2-COOH
KÝ HIӊU
-M
-E
-EOH
-V
-A
-P
CÔNG7+ͨ& &ɡ8 7ɝ2
&ͦ$ 0͘7 6͐ PORPHYRIN
P
P
V
M
V
M
P
M
M
Protoporphyrin
P
A
P
P
A
A
A
UroporphyrinI
M
p
p
M
P
M
M
P
Coproporphyrin
E-OH
M
E-OH
M
M
P
M
P
Hematoporphyrin
TÍNH CHɡT CͦA PORPHYRIN
- BA LOɝ! PORPHYRIN ͞ NGɈ͜!:
- PROTOPORPHYRIN
- UROPORPHYRIN
- COPROPORPHYRIN
- TÍNH TAN CͦA PORPHYRIN PHͤ THU͘C
NHÓM CARBOXYL THɻ
- UROPORPHYRIN: 8 NHÓM CARBOXYL (tan t͑t nhɢt)
- PROTOPORPHYRIN: 2 NHÓM CARBOXYL
- COPROPORPHYRIN: 4 NHÓM CARBOXYL
HEMOGLOBIN
http://www.buzzle.com/articles/low-hemoglobin-levels.html
- ӇӄĐ phát ŚŝҵŶ ůҥŶ ĜҥƵ vào Ŷĉŵ 1840 ďӂŝ
Hünefeld: protein ǀҨŶ ĐŚƵLJҳŶ oxy
- 1851, Otto Funke mô ƚң ĐҤƵ trúc ĐӆĂ hemoglobin
- ҭĐ tính ŐҩŶ oxy có ƚŚҳ ĐŚƵLJҳŶ ĜҼŝ ĜӇӄĐ Felix
Hoppe ʹ Seyler mô ƚң
-1959, Max Perutz và John Kendrew ĜŽҢƚ Őŝңŝ
Nobel hóa ŚҸĐ trong ǀŝҵĐ tìm ra ĐҤƵ trúc phân ƚӊ
ĐӆĂ hemoglobin ďҪŶŐ Ŭӎ ƚŚƵҨƚ ĐŚӅƉ tia X
- Vai trò ĐӆĂ hemoglobin trong máu ÿѭӧc nhà sinh
lý ŚҸĐ Claude Bernard làm sáng ƚҹ
http://en.wikipedia.org/wiki/Hemoglobin
-
-
-
-
-
-
-
Hb: protein hình cɤu, dɉ͝ng kính # 55Ao
͟ h͓ng cɤu d͙ng vɪt bɪc cao
PORPHYRINOPROTEIN
g͓m GLOBIN VÀ HEME
Hb: 15,5 ±1g/100 ml máu tp (nam)
14,5 ±1g/100 ml máu tp (nͯ)
N͗i loài sinh vɪt có m͙t loɞi Hb khác nhau
tùy nhóm globin, do vɪy khi kɼt tinh sɺ tɞo
ra nhͯng dɞng tinh thʀ khác nhau
Heme
Globin
&ɡ87ɝ2+(02*/2%,1
- PHɣN PROTEIN THUɣN: GLOBIN
- PHɣN NHÓM NGOɝ!: HEME
Hemoglobin
Globin
2 chuӛi alpha
2 chuӛi beta
Protoporphyrin IX
Heme
Fe2+
HEME
PROTOPORPHYRINIX
- TETRAPYROL
- METHYL: 1, 3, 5, 8
- VINYL: 2, 4
- PROPIONYL: 6, 7
- NGUYÊN Tͬ SɫT GɫN v͚! 4 NGUYÊN Tͬ N
CͦA 4 VÒNG PYROL
- 2 LK C͘NG HÓA TRʇ
- 2 LK PH͐! TRÍ
PROTOPORPHYRIN IX Fe2+ HEME
1 CҪU NӔI GҲN VӞI
HISTIDINF8 CӪAGLOBIN
(HIS GҪN)
1 CҪU NӔI GҲN VӞI
HISTIDINE7 CӪAGLOBIN
(HIS XA) - CҪU NӔI NÀY Dӈ
GÃYĈӆ OXYGҴN VÀO
Fe
His gҫn
oxy
His xa
OXYHÓA
HEME HEMATIN(Fe3+)
HEMATIN (Fe3+)
Cl-
TINHTHӆ HEMIN
GLOBIN
- PHÂN Tͬ Hb CÓ 574 aa
- ͞ NGɈ͜! TRɈ͞NG THÀNH
- 2 CHU͖! ALPHA (141 aa / CHU͖!) Ÿ cɢu trúc bɪc I
- 2 CHU͖! BÊTA (146 aa / CHU͖!) Ÿ cɢu trúc bɪc I
&ɡ8TRÚC %ɩ& II &ͦ$ Hb
- CHU͖! Į: 7 XOɫN ALPHA (A - B - C - D - E
- F - G)
- CHU͖! ǃ: 8 XOɫN ALPHA(A - B - C - D - E -
F - G - H)
- ĈANH S͐ XOɫN: A - B - C .
- ĈOɝN aa KHÔNG XOɫN: AB, BC, CD, .
&ɡ8TRÚC %ɩ& III &ͦ$ Hb
- CɡU TRÚC BɩC II CU͘N XOɫN Tɝ! NHͮNG
ĈOɝN KHÔNG XOɫN
- G!͐NG CɡU TRÚC BɩC III CͦA MYOGLOBIN
- N͘T CHU͖! POLYPEPTID XOɫN VÀ CU͘N
KɻT H͢P v͚! 1 HEME TɝO 1 BÁN ĈɆN vʇ
CͦA Hb
- 4 BÁN ĈɆN vʇ CͦA Hb TɝO THÀNH CɡU
TRÚC BɩC IV CͦA Hb
Myoglobin Chuӛi beta cӫa hemoglobin
&ɡ8 TRÚC HEMOGLOBIN
- 4 BÁN ĈɆN vʇ CͦA Hb CÓ THɿ ĈɈ͢C CHIA
THÀNH 2 PHɣN G!͐NG HʃT NHAU (DIMER)
- (Įǃ)1 VÀ (Įǃ)2
- HAI CHU͖! POLYPEPTID TRONG N͖! DIMER
GɫN CHɳT v͚! NHAU BɭNG LK Kʹ NɈ͚C
( HYDROPHOBIC INTERACTION)
- HAI DIMER CÓ THɿ DI CHUYɿN SO v͚!
NHAU B͞! NHͮNG LK PHÂN CͰC (YɻU)
ĺTRɝNG THA! DEOXYHENOGLOB!N vA
OXYHEMOGLOBIN
Dҥng T
(deoxyhemoglobin)
Dҥng R
(oxyhemoglobin)
+ 4O2
- 4O2
'ɝ1*T &ͦ$ Hb
- KHÔNG GɫN OXY
- LK ION VÀ LK HYDRO XUɡT H!ʃN NH!ɽU
LÀM KÌM HÃM SͰ CHUYɿN Ĉ͘NG CͦA CÁC
CHU͖! POLYPEPTID
- DɝNG Hb CÓ ÁI LͰC THɡP v͚! OXY
'ɝ1*R &ͦ$ Hb
- Hb GɫN v͚! OXY
- CÓ SͰ ĈͨT GÃY N͘T S͐ LK ION VÀ LK
HYDRO DO SͰ GɫN OXY
- CÁC CHU͖! POLYPEPTID DI CHUYɿN TͰ DO
HɆN
- LÀ DɝNG Hb CÓ ÁI LͰC CAO v͚! OXY
CÁC DɝNG HEMOGLOBIN
- PHÔI THAI: Hb Gower I Dž2İ2
- BÀO THAI: HbF (Į2GDŽ2 và Į2ADŽ2)
- NGɈ͜! TRɈ͞NG THÀNH:
- HbA (98%): Į2ǃ2
- HbA2 : Į2į2
- HbA1c : Į2ǃ2 - GLUCOSE
GEN MÃ HÓA GLOBIN
Gen alpha globin
(NST 16)
ȗ
Į1 Į2
İ
į ȕ
Gen bêta globin
(NST 11)
Hb Gower I
ȗ2İ2
HbF Į2Ȗ2 HbA2
Į2į2
HbAĮ2ȕ2

G: glycin

A: Alanin
Pamela C.Champe and Richard A. Havey
2nd Biochemistry Illustrated Review
%ʃ1+HEMOGLOBIN
- BʃNH H͒NG CɣU HÌNH LiɽN: HbS
- 2 CHU͖! ALPHA BÌNH THɈ͜NG
- 2 CHU͖! BÊTA Ĉ͘T BiɻN
- BʃNH H͒NG CɣU HÌNH BIA: HbC (Glu6Lys)
- BʃNH THALASSEMIA
Hӗng cҫu bình thѭӡng Hӗng cҫu hình liӅm
Val His Leu Thr Pro Glu Glu
7 146
1
Val
2
His
3
Leu
4
Thr
5
Pro
6
Val
7
Glu
146
Trình tӵ acid amin trong chuӛi bêta bình thѭӡng
1 2 3 4 5 6
Trình tӵ acid amin trong chuӛi bêta trong HbS
*ɫ1 OXY &ͦ$ HEMOGLOBIN
KɻT H͢P THUɩN NGHʇCH v͚! OXY
Hb + O2 ĺ HbO2
·
·
·
-
LÀ PHҦN ӬNG GҲN OXY VÀ THUҰN
NGHӎCH
O2 GҲN VӞI Fe
2+
QUA LIÊN KӂT PHӔI TRÍ
1 NGUYÊN TӰ Fe
2
+
GҲN VӞI 1 PHÂN TӰ
OXY
Hb + 4O2 ĺ Hb(O2)4
1g Hb GɫN ĈɈ͢C 1.39 ml O2
- Tɝ! PH͔!:
- pO2 cao (100 mmHg): Hb gɬn oxy ĺHbO2
- Tɝ! MÔ:
- pO2 thɢp (40 mmHg): Hb nhɠ oxy cho mô
- Hb GɫN OXY THEO CɆ CHɻ H!ʃP Ĉ͒NG
ÁI LӴC VӞI OXY
TĂNGLÊN
Hb
O2
Hb
O2
Hb
O2
Hb
O2
Hb
O2
O2
O2
O2
O2
O2
O2
O2
O2
O2
- MYOGLOBIN: GɫN 1 PHÂN Tͬ OXY
- HEMOGLOBIN: GɫN 4 PHÂN Tͬ OXY
- NͨC Ĉ͘ BÃO HÒA OXY ͞ Cɟ MYOGLOBIN
VÀ HEMOGLOBIN THAY Ĉ͔! Tͪ 0% (KHÔNG
GɫN) ĈɻN 100% (GɫN HɻT TɡT Cɟ vʇ TRÍ)
- Ĉ͒ THʇ MINH H͌A Ĉ͘ BÃO HÒA OXY THEO
ÁP SUɡT RIÊNG PHɣN OXY (pO2) G͌! LÀ
ĈɈ͜NG CONG PHÂN LY OXY - HEMOGLOBIN
Ĉѭӡng cong phân ly oxy - hemoglobin
- MYOGLOBIN CÓ ÁI LͰC v͚! OXY CAO HɆN
HEMOGLOBIN
- P50: ÁP SUɡT OXY RIÊNG PHɣN
CɣN Ĉɿ OXY GɫN VÀO 50% vʇ TRÍ
GɫN KɻT
- P50(MYO) = 1 mmHg
- P50(HEMG) = 26,8 mmHg
- ÁI LͰC OXY CAO THÌ P50 THɡP
- CÁC YɻU T͐ ɟNH HɈ͞NG LÊN ÁI LͰC CͦA
Hb Ĉ͐! v͚! OXY
-pH
-N͓ng d͙ CO2
-2,3 diphosphoglycerat (DPG): tăng cao
trong h͓ng cɤu sɺ giɠm ái lͱc cͧa Hb v͛i
oxy, và ngɉͣc lɞi
HbO2 + 2,3-DPG ĺ Hb - 2,3-BPG +O2
KɻT H͢P v͚! CO2 TɝO CARBONYL
HEMOGLOBIN
- pO2 40 mmHg ͞ 37
O
C: 2,9 ml CO2 HÒA TAN
TRONG HUYɻT TɈɆNG
- Hb vɩN CHUYɿN CO2:
- TRͰC T!ɻP: 15 - 20%
- GIÁN T!ɻP: 70%
- vɩN CHUYɿN TRͰC T!ɻP:
R ± NH3+ + CO2 ĺ 2H+ + R - NH - COO-
· VҰN CHUYӆN GIÁN TIӂP
CO2 + H2OļH2CO3 ĺ H+ + HCO3-
· 2 ION H+ KӂT HӦP VӞI 2 ACID AMIN
HIS146 TҰN CÙNG CӪA2 CHUӚI ȕ ĺ
2H+Hb ĺĈӊM Hb GiҦM H+ TRONG MÁU
SѪĈӖVҰN CHUYӆNCO2 GIÁN TiӂP CӪA HEMOGLOBIN
KɻT H͢P v͚! CARBON MONOCYD (CO)
TɝO CARBON MONOXYD HEMOGLOBIN
-
-
-
-
CO GɫN v͚! Hb Tɝ! ĈiɿN GɫN OXY
ÁI LͰC CAO GɡP 210 LɣN OXY
CɝNH TRANH OXY Ĉɿ GɫN VÀO Hb
COHb BɽN vͮNG VÀ LÀM Hb KHÓ NHɟ OXY
HɆN
- pCO = 0.7 mmHg ĺCHӂT NGѬӠI
NG͘Ĉ͘C CARBON MONOCYD
- THÔNG KHÍ T͐T CHO BʃNH NHÂN
- NGͬ! OXY N͒NG Ĉ͘ CAO
- OXY CAO ÁP ĺPHÂN LY COHb
OXY HÓA HEMOGLOBIN TɝO
METHEMOGLOBIN
- MetHb LÀ Hb CÓ NGUYÊN Tͬ Fe2+ Bʇ OXY
HÓA THÀNH Fe3+
- MetHb NɡT KHɟ NĂNG GɫN OXY NÊN
KHÔNG vɩN CHUYɿN OXY ĈɈ͢C
NGUYÊN NHÂN GÂY MetHb
- CHɡT OXY HÓA: SODIUM NITRIT,
FERRICYANUA, NITROBENZEN,
NITROPHENOL, POLYPHENOL..
- THU͐C ĈiɽU TRʇ BʃNH: SODIUM
NITROPRUSSIAT, NITROGLYCERIN
- BÌNH THɈ͜NG: MetHB < 1% NH͜ Hʃ
TH͐NG KHͬ
- NADH dependent methemoglobin reductase (HC)
- NADP/NADPHH+
- ACID ASCORBIC
- Hʃ GLUTATHION KHͬ
- NH!ɽU CHɡT OXY HÓA, vɈ͢T KHɟ NĂNG
KHͬ CͦA H͒NG CɣU ĺMetHb TĂNG ĺ
THIӂU OXY MÔ
· MetHb > 1.5% ĺTÍM TÁI
TÍNH CHɡT ENZYM CͦA HEMOGLOBIN
- NHɈ OXYDOREDUCTASE, XÚC TÁC PHɟN
ͨNG OXY HÓA KHͬ
- NHɈ PEROXYDASE:
H2O2 + AH2ĺ2H2O+ A
- HOɝT TÍNH CATALASE YɻU:
2H2O2 ĺ2H2O+ O2
dăŝůŝҵƵƚŚĂŵŬŚңŽ͗
-,ſĂƐŝŶŚzŚҸĐ
-Lehninger Principles of Biochemistry (4ed 2004) - ISBN
0716743396
-Harper's Illustrated Biochemistry( 26th Ed, 2003)
-Whitford_Proteins-Structure and Function 2005
HÓA HӐC ACÌD NUCLEÌC
VÀ ACID NUCLEIC
BS. HOÀNG HIӂU NGӐC
BӜMÔN SINH HÓA
3/23/2011 1
3/23/2011 2
1. Acid phosphoric
2. Pentose
3. Base nitѫ (nitrogenous base)
3/23/2011 3
THÀNH PHҪN HÓA HӐC CӪA NUCLEOTÌD
VÀ ACID NUCLEIC
THÀNH PH̾N HÓA HͤC C;A NUCLEOTID VÀ ACID NUCLEIC
3/23/2011 4
1. Acid phosphoric
3/23/2011 5
2. ċѭӡng pentose
THÀNH PH̾N HÓA HͤC C;A NUCLEOTID VÀ ACID NUCLEIC
3/23/2011 6
3. Base nitѫ
THÀNH PH̾N HÓA HͤC C;A NUCLEOTID VÀ ACID NUCLEIC
Tính chҩt vұt lý ÷ hóa hӑc cӫa base purin và pyrimidine
· Tính āӗng phân: enol (lactim) và ceton (lactam)
· Tính hòa tan: Ӣ pH trung hòa, guanin ít hòa tan nhҩt
3/23/2011 7
Các base hiӃm
· TӍ lӋ thҩp
· Dүnxuҩt cӫa
base lѭӧng nhiӅu
· Dҥng methyl
hóa, acetyl hóa,
hydroxymethyl
hóa
· Vai trò āiӅu hòa
và bҧo vӋ thông
tin di truyӅn.
3/23/2011 8
· N6, N6 - dimethyladenin
· N7 - methylguanin
· 5 - methylcytosin
· 5 - hydroxy -
methylcytosin
· 5,6 - dihydrouracil
So sánh thành phҫn hóa hӑc giӳa DNA và
RNA
Thànhphҫncҩutҥo DNA RNA
Base purin ADENIN (A) ADENIN (A)
GUANIN(G) GUANIN(G)
Base pyrimidine CYTOSIN (C) CYTOSIN (C)
THYMIN (T) URACIL(U)
ċѭӡng pentose Deoxyribose Ribose
Acid phosphoric H
3
PO
4
H
3
PO
4
3/23/2011 9
NUCLEOSID VÀ NUCLEOTID
HÓA HӐC ACID NUCLEIC VÀ ACID NUCLEIC
3/23/2011 10
Nucleoside
· Sҧn phҭmthӫy phân không hoàn toàn cӫa
acid nucleic.
· DӉ bӏ thӫy phân bӣi nucleosidase
· Gӗm: base nitѫ và pentose
· E-N-glycosid(C1´ penlose và N9 cӫa base
purin/N1 cӫa pyrimidine)
· (base): purin - nucleosid/pyrimidin-
nucleosid
· (pentose): ribonucleosid/
deoxyribosenucleosid
3/23/2011 11
Liên kӃt glycoside giӳa base nitѫ và dѭӡng
pentose
3/23/2011 12
E-N-glycosid
· Base tҥo ra 2 hình dҥng xoay quanh liên kӃt ȕ - N -
glycosidāѭӧc gӑi là āӗng (syn) hoһc āӕi (anti). Dҥng
āӕi chiӃmѭu thӃ trong tӵ nhiên
3/23/2011 13
Liên kӃt glycoside giӳa base nitѫ và dѭӡng pentose
NUCLEOSID PHOSPHAT
3/23/2011 14
3/23/2011 15
NUCLEOSID PHOSPHAT
NHӲNG NUCLEOTÌD TRONG TӴ NHÌÊN
· Dӵ trӳ và vұn chuyӇn nĆng lѭӧng sinh hӑc
· Coenzym:
÷ NAD
+
: nicotinamid adenin dinucleotid
÷ NADP
+
: nicotinamid adenin dinucleotid
phosphat
÷ FAD
+
: flavin adenin dinucleotid
· YӃu tӕ truyӅn thông tin nӝi bào
3/23/2011 16
Dүn xuҩt cӫa Adenosin
· Adenosin
diphosphat (ADP)
· Adenosin
triphosphat (ATP)
÷ ATP-ADP: tích trӳ
và vұn chuyӇn nĆng
lѭӧng
÷ ATP: nguӗn NL
chính cӫa tӃ bào
3/23/2011 17
ADP + H
3
PO
4
ATP
(1)
(2)
E H
2
O
H
2
O E
· AMP vòng:
Adenosin 3´, 5´ -
monophosphat
(cAMP)
· Chҩt vұn chuyӇn
thông tin thӭ 2
3/23/2011 18
Dүn xuҩt cӫa Adenosin
3/23/2011 19
AMP vòng
ATP
AMP
vòng
Adenyl cyclase
AMP
phosphodiesterase
Dүn xuҩt cӫa guanosin
· GDP và GTP
÷ Oxy hóa acid Į - ketoglutaric thành acid
succinic
÷ GTP cҫn cho sӵ hoҥt hóa adenyl cyclase
÷ GTP: NL cҫn cho sӵ tәng hӧp protein cӫa
ribosome
÷ cGMP: tín hiӋu nӝi tӃ bào hay chҩt truyӅn tin
thӭ 2
3/23/2011 20
Các dүn xuҩt khác
· UTP, UDP: coenzym trong chuyӇn hóa
glucid, hӧp chҩt giàu NL
· CTP, CDP: hӧp chҩt giàu NL
3/23/2011 21
DNA
Acid deoxyribonucleic
3/23/2011 22
Thành phҫn cӫa DNA
1. H
3
PO
4
2. Deoxyribose
3. Base nitѫ (A, G, C, T)
ÆdAMP, dGMP, dCMP,
dTMP.
3/23/2011 23
3/23/2011 24
Liên kӃt phosphodiester
· Trөc liên kӃt chính
gӗmāѭӡng pentose
và gӕc phosphat
· Ѭa nѭӟc
· Các gӕc OH cӫa
āѭӡng āӅu hình
thành liên kӃt
hydrogen vӟi phân
tӱ nѭӟc
· Nhómphosphat
tích āiӋn âm ӣ pH 7
3/23/2011 25
Các lӵc liên kӃt giúp hình thành DNA xoҳn
dôi
· Trөc liên kӃt phosphat
· Tѭѫng tác xӃp chӗng (stacking interaction)
· Tѭѫng tác kӏ nѭӟc: trөc phosphat mang
āiӋn tích âm cao āӕi lҥi vӟi các base không
phân cӵc
· Liên kӃt hydro: duy trì khoҧng cách giӳa
hai trөc āѭӡng phosphat
· Liên kӃt ion: muӕi giúp әn āӏnh cҩu trúc
duplex cӫa DNA
3/23/2011 http://www.siumed.edu/~bbartholomew/course_material/nucleic_acids.html 26
DNA
· Gӗm 2 chuӛi
polynucleotid
xoҳn āôi theo
hѭӟng ngѭӧc
chiӅu nhau
· ċҫu 5´: thiӃu 1
nucleotidӣ vӏ trí

· ċҫu 3´ : thiӃu 1
nucleotidӣ vӏ trí

3/23/2011 27
Sӵ biӃn tính DNA
3/23/2011 http://www.siumed.edu/~bbartholomew/images/chapter5/F05-14.jpg 28
Các nguyên nhân gây biӃn tính
· NhiӋt āӝ,
· Thay āәi pH,
· các dung môi hӳu cѫ(urea, formamide)
3/23/2011 http://www.siumed.edu/~bbartholomew/course_material/nucleic_acids.html 29
Rãnh lӟn ÷ rãnh nhӓ
ovӏ trí gҳn cӫa các protein āiӅu hòa bҵng các
liên kӃt hydro āӇ kiӇmsoát biӇu hiӋn gen
3/23/2011 30
Rӝng22A
o
Rӝng12A
o
Qui luұt bә sung dôi base ÷ Sӵ cân bҵng
base
· A { G; C = T
· Purin = pyrimidine
· G + T = A + C
· Thành phҫn base
thay āәi theo loài
nhѭng không thay
āәi theo tuәi, trҥng
thái dinh dѭӥng,
m{LWUѭӡQJ.
3/23/2011 31
Nhӳng loҥi cҩu trúc xoҳn dôi cӫa DNA
· Có 6 loҥi cho āӃn nay: A, B, C, D, E, Z
÷ ChiӅu xoҳn
÷ Sӕ āôi base trong mӛi vòng xoҳn
÷ Khoҧng cách giӳa mӛi āôi base
÷ Khoҧng cách lӟn nhҩt giӳa hai sӧi
· Loҥi B gһp nhiӅu nhҩt trong āiӅu kiӋn sinh

3/23/2011 32
3/23/2011 33
Các dҥng cҩu trúc cӫa DNA
· Xoҳn āѫn (virus)
· Xoҳn āôi (phә biӃn nhҩt)
· Xoҳn āѫn vòng (DNA ti thӇ và virus)
· Xoҳn āôi vòng
3/23/2011 34
Vai trò cӫa nhӳng cҩu trúc DNA dһc biӋt
· DNA cӫa tӃ bào sӕng luôn có nhӳng trình
tӵ āһc hiӋu āӇ giúp nhұn biӃt protein gҳn
kӃt.
· Trình tӵ āó có thӇ là dҥng palindrome,
polypyrimidine, polypurin o tҥo ra
nhӳng xoҳn ba hoһc H - DNA
· Vùng có liên quan āӃn āiӅu hòa biӇu hiӋn
gen
3/23/2011 35
Vai trò cӫa DNA
· Mang thông tin di truyӅn
· Làm khuôn cho sӵ chuyӇn mã và tái bҧn
3/23/2011 36
RNA
Acid ribonucleic
3/23/2011 37
Các loҥi RNA
1. mRNA
÷ 5% RNA
÷ 900 - 12000 nucleotid
÷ ċҫu 5´ :7 - methylguanosin triphosphat (nƆ)
÷ ċҫu 3´: IoIy A
2. tRNA
÷ 10 - 15%RNA
÷ Có base hiӃm
÷ Ít nhҩt có 20 loҥi tRNA
3/23/2011 38
tRNA
· Nhánh tiӃp nhұn
· Nhánh āӕi mã
· Nhánh D (DHU)
· Nhánh T \ C
3/23/2011
39
Nhánh tiӃp nhұn tRNA
· 7 cһp base
· Nhóm kӃt thúc: CCA
(5´ - 3´)
· Nhóm COOH cӫa
acid amin gҳn vào
nhóm 3´ - OH cӫa
adenosin tҥo liên kӃt
ester
3/23/2011 40
Nhánh dӕi mã cӫa tRNA
· 5 āôi base
· 3 nucleotid āӕi mã
· Nhұn mã ba tѭѫng ӭng trên mRNA khuôn
3/23/2011 41
Các dҥng RNA
3/23/2011 42
Vai trò sinh hӑc cӫa RNA
· Tham gia vào quá trình sinh tәng hӧp
protein
· mRNA: khuôn cho sӵ tәng hӧp
· rRNA: cҩu trúc, hình thành ribosome, nѫi
xҧy ra sinh tәng hӧp protein
· tRNA: vұn chuyӇn acid amin āӃn
ribosome āӇ tәng hӧp protein
· miRNA: tham gia vào quá trình cҳt mRNA
và āiӅu hòa gen
3/23/2011 43
Thӫy phân acid nucleic bҵng nuclease
· Nuclease: enzym cҳt āӭt liên kӃt
phosphodiester
1. Theo vӏ trí hoҥt āӝng: exonuclease -
endonuclease
2. Theo liên kӃt bӏ tҩn công: 3´ (cҳt liên kӃt 3´
phosphoester), 5´ (cҳt liên kӃt 5´
phosphoester
3. Theo cѫ chҩt: Dnase, RNAse
3/23/2011 44
LIÊN QUAN VÀ
ðIỀU HOÀ CHUYỂN HOÁ
Mục tiêu
• Trình bày ñược sự liên quan giữa chuyển hoá
các chất G, L, P, AN.
• Giải thích ñược sự ñiều hoà chuyển hoá ở mức
tế bào.
ðại cương:
• Các chất ñều có con ñường chuyển hoá riêng.
• Con ñường chuyển hoá của các chất có những
ñiểm chung, liên quan chặt chẽ tạo nên mạng
lưới chuyển hoá chung rất phức tạp của cơ thể
Sự liên quan
giữa các con
ñường chuyển
hoá các chất
www.genome.ad.jp/kegg/pathway/map/map01100.html
ðại cương
• Quá trình chuyển hoá các chất ñược kiểm soát
chặt chẽ nhờ cơ chế ñiều hoà ở mức cơ thể
hoặc tế bào.
• Sự ñiều hoà chuyển hoá các chất theo nhu cầu
của cơ thể.
1. LIÊN QUAN CHUYỂN HÓA
PROTID
ACID AMIN
Ala
Leu, Ile
ACID NUCLEIC
NUCLEOTID
NUCLEEZID
RIBOSE5P
GPT
GLUCID LIPID
GLUCOSE GLYCEROL ACID BÉO
G6P HMP
↓ NADPHH + β oxh
PGA
HDP ↓
PYRUVAT

ACETYL CoA 2H
½O2
Asp
HEM
Glu
GOT
CT
Urê
OXALO ACETAT
TCA
FUMARAT
SUCCINAT
CO2 α CETO
GLUTARAT
CITRAT
2H
2H
2H
2H
CO2

HẤP
⇒ATP
TẾ
BÀO
H2O
Liên quan giữa chuyển hóa các chất glucid, lipid, protid và acid nucleic
Liên quan chuyển hoá
• Thống nhất chuyển hoá
• Biến ñổi qua lại giữa glucid, lipid, protid
• Liên hợp phản ứng, quá trình
• Quan hệ chuyển hoá giữa các bào quan
• Quan hệ chuyển hoá giữa các mô
1.1. Sự thống nhất chuyển hóa
Thể hiện ở:
• Chu trình ACID CITRIC
AcetylCoA →CO2, H2O + Q
• HÔ HẤP TẾ BÀO: “ðỐT CHÁY” G, L, P theo
những cơ chế chung, hệ thống enzym chung →
tạo H2O, ATP
• HOẠT HÓA, TÍCH TRỮ VÀ SỬ DỤNG NĂNG
LƯỢNG: nhờ quá trình phosphoryl hóa, hệ
thống ADP-ATP.
Các giai ñoạn
của quá trình
thoái hoá
1.2. Sự biến ñổi qua lại giữa G, L, P: thông qua các chất ngã ba ñường
• Chất ngã ba ñường : sản phẩm thoái hóa chung
: tiền chất chung
GLUCID LIPID
Chất ngã 3 ñường
PROTID
TD: PYRUVAT, ACETYLCoA, OAA, GLYCEROL
COOH COOH COOH COOH
l l l l
H2N- CH C=O GPT
l l
CH3 + CH2
l
CH2
l
COOH
Ala α CETO GLUTARAT
C=O H2N- CH
l l
CH3 + CH2
l
CH2
l
COOH
PYRUVAT Glu
Pyruvat → tân tạo glucid
→ acetyl CoA → AB
Alanin αceto glutarat Aspartat
ALAT GPT GOT ASAT
Pyruvat L Glutamat Oxalo acetat
CH2OH CH2OH NAD+ NADHH+ CH2OH
ATP
ADP
l
CHOH
l
CH2OH
Glycerol
kinase
l l
CHOH C=O
Dehydrogenase
l l
CH2O- P CH2O- P
PDA
PGA → tân tạo glucid
pyruvat → Ala
Tuy nhiên các chất không thể thay thế nhau hoàn
toàn ñược vì:
- Glucid là nguồn năng lượng chủ yếu của cơ thể
- Lipid: các AB cần thiết cơ thể không tổng hợp ñược
- Protid: các AA cần thiết cơ thể không tổng hợp ñược
chế ñộ dinh dưỡng hợp lý, ñủ chất với tỷ lệ nhất
ñịnh.
TỶ LỆ KHẨU PHẦN THỨC ĂN THÍCH HỢP
Năm Tổng Q %
P L G
1972 2300 12 13 75
Kcal
1997 2700 10-12 15 - 20 65 - 75
Kcal
1.3. Sự liên hợp giữa các phản ứng và quá trình
Sự liên quan chuyển hoá còn là sự liên hợp giữa các phản ứng
và quá trình.
Phản ứng liên hợp: sự kết hợp 2 phản ứng: phản ứng thoái hoá giải
phóng năng lượng và phản ứng tổng hợp thu năng lượng.
Sự liên hợp giữa các phản ứng và quá trình
• Quá trình chuyển hoá này liên quan ñến quá trình chuyển hoá kia qua
các sản phẩm chuyển hoá
+ HMP →NADPHH+ →tổng hợp AB
Ribose 5 P→tổng hợp AN
+ HDP →Oxalo acetat + Acetyl CoA ←βoxh
CTAC
+ CTAC →Succinyl CoA → →HEM + glycin
+ CTAC + CT urê
Citrulin Aspartat
Oxalo acetat
Arginosuccinat malat
Arginin Fumarat
1.4. Quan hệ chuyển hóa giữa các bào quan
BÀO DỊCH
NHÂN
• TỔNG HỢP
ADN
ARN
NAD+
RIBOSOM
ATP
Tổng hợp protein
• ðường phân
• HMP
• Tổng hợp AB
ATP
TY THỂ
• CHHTB
• βOxh AB
• CTAC
• Tạo thể ceton
PO
TY THỂ VÀ BÀO DỊCH
• Tân tạo G
• CT urê
• Tạo Hem
THỂ TY : nơi chuyển hóa năng lượng (ATP)
NHÂN
: tổng hợp ADN, ARN, NAD+
RIBOSOM : STH Protein
1.5. Quan hệ chuyển hóa giữa các mô
Mỗi mô có ñặc ñiểm và chức năng chuyển hóa riêng, ngoài những quá trình
chuyển hóa chung mà mô nào cũng có (chuyển hóa năng lượng, STH Protein)
GAN : chức năng glycogen và nơi xảy ra βoxh Acid béo
Glycogen AcetylCoA CTAC
Glucose Thể ceton
MÁU Glucose Thể ceton
MÔ KHÁC (cơ) Glucose
Glycogen
G6P
AcetylCoA
OA
K
Hầu như GAN ñóng vai trò trung tâm trong mối liên quan chuyển hoá giữa các mô.
Gan Máu Cơ
AcylCoA
AB AcylCoA
G G
ActCoA ActCoA
Thể ceton Thể ceton Thể ceton
CTAC
CTAC
Täøng håüp glucose tæì lactat.
Chu trçnh acid lactic (Cori)
Cơ sử dụng glycogen như một
nguồn năng lượng, tạo lactate thông
qua con ñường ñường phân. Lactate
ñược chuyển tới gan và chuyển
thành glucose thông qua quá trình
tân tạo ñường.
Glucose này ñược phóng thích vào
máu trở về cơ ñể bổ sung dự trữ
glycogen của cơ. Toàn bộ con
ñường này (glucose →
lactate →glucose) tạo thành chu
trình Cori.
Chu trình Glucose-alanine
Alanin ñóng vai trò như một chất
mang ammonia và bộ khung carbon
của pyruvate từ cơ ñến gan.
Ammonia ñược bài tiết và pyruvat
ñược dùng ñể tạo glucose, glucose
lại quay trở lại cơ
NÃO:
Nguồn năng lượng chủ yếu là con ñường HDP từ glucose
→ não cần ñược cung cấp thường xuyên glucose và oxy.
Khi ñói, các thể ceton thay thế glucose
MÔ MỠ là nơi dự trữ TG, nơi xảy ra quá trình tổng hợp và phân giải TG.
Glucose Glycerol P
TG VLDL (TG) AB AcylCoA
TG
AB
AB-albumin AB
Glycerol Glycerol
Gan Mỡ
2. KHÁI NIỆM VỀ ðIỀU HÒA CHUYỂN HÓA
Cơ thể có khả năng tự ñiều hòa
- Mức toàn cơ thể: Hormon, thần kinh
- Mức tế bào: ðH chuyển hóa
Cơ chế:
- Ảnh hưởng ñến hoạt tính của ENZYM
- Ảnh hưởng ñến STH ENZYM
2.1 Cơ chế làm thay ñổi hoạt tính ENZYM (lượng enzym không ñổi)
Hoạt tính enzym thay ñổi do:
- Nồng ñộ cơ chất hoặc coenzym (vit)
- Cơ chế ñiều hòa dị lập thể
TT. Dị lập thể
TTHð
Cơ chất Chất tác dụng
Enzym dị lập thể
a) Cơ chế DLT dương: sự hoạt hóa DLTchất tác dụng: chất hoạt hóa, làm
TTHð dễ tiếp nhận cơ chất và hoạt ñộ enzym tăng lên (activator)
ATP ADP UTP
G G6P
+
b) Cơ chế DLT âm: sự ức chế DLT
PP
UDPG + Glycogen
glycogen synthase (GS)
UDP Glycogen-G
Chất tác dụng: chất ức chế (inhibitor) TTHð khó tiếp nhận cơ chất
E1 E2 E3
A →B → C → D… →Z
-
Ức chế ngược
E1: enzym DLT
Z : sản phẩm của 1 quá trình ñồng thời là chất ức chế DLT
TD: E. coli
-
L-ThreoninTD→ → →L.Isoleucin
(TD: threonin dehydratase)
• Cơ chế phân tử cho mỗi mô hình ñiều hòa hoàn toàn
khác nhau, nhưng thường theo một trong hai kiểu chính:
- ðiều hòa âm tính: protein ức chế gắn vào vùng ñiều
hòa của DNA (gọi là operator) ngăn cản quá trình phiên
mã.
- ðiều hòa dương tính: protein hoạt hoá gắn vào DNA
làm tăng quá trình phiên mã.
• OPERON (ñơn vị phiên mã) là cơ sở thiết yếu cho sự
ñiều hòa biểu hiện gen ở TB Prokaryote.
2.2 Cơ chế ảnh hưởng STH ENZYM (lượng enzym thay ñổi)
- Operon bao gồm các gen cấu trúc, vùng khởi ñộng
(promoter), operator và gen ñiều hòa.
- Các gen cấu trúc mã hóa cho 1 hoặc vài chuỗi
polypeptid
- Promoter kiểm soát sự phiên mã của các gen cấu trúc
- Operator là vùng mà protein ức chế sẽ gắn vào.
Operator nằm giữa Promotor và các gen cấu trúc.
- Gen ñiều hòa mã hóa cho protein ức chế
- mARN của Prokaryote là Polycistron, mã hóa ra nhiều
chuỗi polypeptide
Other requlatory
sequence
Operator
Promoter Structural gene
Cấu trúc của Operon:
ðiều hòa âm tính
Có 2 loại Operon: operon ñiều hòa cảm
ứng và ức chế
Operon ức chế
• Các gen cấu trúc ban ñầu
ñược phiên mã.
• Xảy ra ở quá trình ñồng hóa.
• Sản phẩm phản ứng sẽ ức
chế phiên mã các gen tổng
hợp chúng.
• Hệ Tryptophan operon
Operon cảm ứng
• Các gen cấu trúc ban ñầu
không ñược phiên mã.
• Xảy ra ở quá trình dị hóa.
• Cơ chất ñược sử dụng
trong phản ứng dị hóa sẽ
kích thích phiên mã các gen
cấu trúc.
• Hệ lactose operon của E.Coli
A Y Z
O
P
I
permease
operator
promoter
transacetylase
Cấu trúc của lac operon
I. Lactose operon
Vùng ñiều hòa Ba gen cấu trúc
Gen ñiều hòa
Vị trí gắn CAP
Βeta Galactosidase
Cơ chế hoạt ñộng Lactose operon ở E.coli:
- Vi khuẩn E.coli mẫn cảm với ñường lactose
- Trong môi trường có ñường lactose, E.coli tiết
ra enzym β galactosidase, có 2 chức năng:
+ Phân giải lactose thành Glucose và
galactose.
+ Chuyển liên kết 1-4 glucoside của glucose
và galactose trong lactose thành liên kết 1-6,
hình thành ñường allolactose
Allolactose là chất cảm ứng của lac operon.
A Y Z
O
P
I
mRNA
RNA pol
Tình huống 1
- Khi môi trường không có lactose, gen ñiều hòa I tổng hợp
protein ức chế gắn vào Operator nên ARN polymerase
không ñọc ñược operator và các gen cấu trúc không ñược
phiên mã.
Không phiên mã
A Y Z
O
P
I
repressor
mRNA
lactose allolactose
RNA pol
galactosidase
Tình huống 2
Khi môi trường có lactose, một vài phân tử lactose biến ñổi thành
allolactose nhờ β galactosidase. Allolactose gắn vào protein ức chế, làm
thay ñổi cấu hình của chất ức chế và protein (-) không gắn vào operator,
như vậy ARN polymerase có thể ñọc operator ñể phiên mã ba gen cấu
trúc trên operon, tạo β galactosidase và permease tham gia phân giải
lactose.
Phiên mã
A B C D E
O P
R
regulatory
regions
structural
gene
Trp
Trp mRNA
Trp operon
Protein (-) kh
chức năng
II. Tryptophan operon
-Tryptophane trong tế bào ñược tổng hợp bởi sự tham gia
của 5 loại enzyme xúc tác. Các gen mã hóa cho 5 enzym
này nằm trên một operon.
- Gen ñiều hòa cho hệ thống luôn sản sinh protein ức chế
không có chức năng.
- Nếu tế bào ñược nuôi trong môi trường có tryptophan thì
tryptophane trở thành một chất ñồng ức chế, gắn vào
protein (-) tạo phức hợp gắn vào operator trp, ngăn cản
quá trình phiên mã tạo các enzyme ñể tổng hợp
tryptophane.
- Khi trong tế bào thiếu tryptophane thì protein ức chế trở
nên bất hoạt, quá trình phiên mã diễn ra, các enzyme xúc
tác quá trình tổng hợp tryptophan ñược tổng hợp.
b. Cơ chế kìm hãm tổng hợp enzym (ñối với enzym của 1 quá trình tổng hợp)
TD: Nuôi Salmonella typhi trong môi trường có histidin thì sự tổng hợp các enzym xúc tác
tổng hợp histidin ngừng
R
P O S1 S2 S3 S4 ….. S9
…..

ARNm

R’ (Aporepressor)
Không hoạt ñộng
R’
E1 E 2
PRPP
ARNm
E9
E3 E 4
His
-
Phức hợp R-CR: R’
CR
Chất ñồng kìm hãm
(Corepressor): His
Hoạt ñộng
PRPP: Phosphoribosylpyrophosphate
- 1 - Created by taivuong
thuc tap hoa sinh.doc





Giôùi thieä u sô löôïc:
1. Löu yù phaàn nguyeân taéc chaéc thi neân caàn phaûi hoïc thuoäc
2. Cuõng khoâng keùm phaàn quan troïng laø bieän luaän taêng trong hôïp naøo vaø giaûm trong tröôøng hôïp naøo
3. Phaàn maø caùc baïn neân chuù yù nhaát laø phaàn keát luaän luùc cho ra keát quaû laø phaûi döïa vaøo bieän luaän
trong khoûang giôùi haïn bình thöôøng vaø keát luaän ngay
4. Trong coâng thöùc bieán ñoåi ñôn vò neáu trong baøi khoâng coù maø caùc baïn laáy ôû ngoøai vaøo thì phaûi chuù
thích roõ raøng ngaén ngoïn.





























Thöïc Taäp
Hoùa Sinh
Phaàn Ñònh Löôïng Phaàn Ñònh Tính
Cholesterol toø an phaà n trong
huyeá t thanh

Tính hoøa tan
Ureâ
Acid Uric trong nöôùc tieåu
Protein toøan phaàn trong
huyeát thanh baèng p
2
Biuret
Tìm Ceton trong nöôùc tieåu
Xaùc ñònh hoaït ñoä Amylase
trong nöôùc tieåu

Ñònh tính Protein trong
nöôùc tieåu baèng p
2
ñoâng keát

Ñònh tính Protein trong
nöôùc tieåu baèng p
2
Heller

Hoïat ñoäng cuûa Catalase
Aûnh höôûng cuûa to ñeán hoaït
ñoäng cuûa Urease
Tìm saéc toá maät trong nöôùc
tieåu
Moät soá thí nghieäm phaûn
öùng
P.ÖÙng Pehling.ÖÙng duïng
tìm Gluco trong nöôùc tieåu

P.Ö Ninhydrin

Phaûn öùng Seliwanoff

Bilibrubin trong huyeát
thanh
Phaûn öùng mayer
Tìm maùu trong nöôùc tieåu
Phaûn öùng Hay
Tìm muoái maät trong n.Tieåu
- 2 - Created by taivuong
thuc tap hoa sinh.doc




I. Cholesterol toøan phaàn trong huyeá t thanh: chöông Lipid
1. Nguyeân taéc










2. Keát Quaû: löu yù ñôn vò ño
a) Ñöôïc xaùc ñònh bôûi coâng thöùc

Cholesterol (mg/dl) = x 200



3. Bieän Luaän:
a) Cholesterol toaøn phaàn trong huyeát thanh ôû khoûang giôùi haïn
− Bình thöôøng : < 200 mg/dl
− Coù nguy cô vöøa ñoái vôùi beänh maïch vaønh : 200 – 250 mg/dl
− Nguy cô cao ñoái vôùi beänh maïch vaønh: 250 – 300 mg/dl
Keát luaän: khi thöïc taäp xong coù keát quaû döïa vaøo giôùi haïn treân vaø keát luaän roài sao ñoù dieán giaûi theâ m
b) Ngoøai ra khi nhaän ñònh voøn phaûi keát hôïp vôùi caùc thoâng soá lipid vaø lipoprotein khaùckhi gaëp
caùc yeáu toá thuaän lôïi nhö löùa tuoåi giôùi tính tieàn söû beänh... Ví duï:
− Neáu cholesterol toøan phaàn < 200 mg/dl nhöng
HCL – C < 35 mg/dl
Apo B (v.c thaønh maïch ra) > 130 mg/dl
Apo A1 < 120 mg/dl
Triglycerid > 200 mg/dl
Thì vaãn coù nguy cô

2

Cholesterol ester + H O Cholesterol + Acid Beùo

Cholesterol ester + O Cholestene – 3 – one + H O

H O + 4 – amino – phenazone + Phenol Quinoneimine + H O
CHE
2 2
CHO
2
2 2
POD
2
OÁng chuaån
OÁng thöû
- 3 - Created by taivuong
thuc tap hoa sinh.doc

II. Glucose trong maùu: Chöông Glucid
1. Nguyeân taéc:

Glucose khöû dung dòch thuoác thöû ñoàng sulfat thaønh ñoàng I oxid (Cu O).Tuû a
maøu ñoû Cu O deã bò oxy hoù a, khoâng ño tröïc tieáp ñöôï c seõ taù c duïng vôùi
arsenomolybdat,khöû chaá t naøy thaønh molyben oxid maøu xanh,ño ñöôïc baèng
quang saé c keá,phaûn öùng thöï c hieän trong moâi tröôø ng kieàm noùng

2. Keát quaû :löu yù ñôn vò

Noàng ñoä glucose trong huyeát töông:



C (g/l) =


3. Bieän luaän:
a) Glucose trong maùu khoûang 0,7 – 1,1 g/l
• Nöôùc tieåu coù ñöôøng khoâng phaùt hieän ñöôïc khi glucose trong maùu taêng
vöôït khoûi ngöôõng thaän (khoûang 1,7 – 1,8 g/l) thì coù glucose nieäu.
Keát luaän: khi thöïc taäp xong coù keát quaû döïa vaøo giôùi haïn treân vaø keát luaän roài sao ñoù dieán giaûi theâ m
b) Thay ñoåi coù hai tröôøng hôïp
• Thay ñoåi sinh lyù :
Taêng: sau khi aên ,sau khi taäp theå duïc
Giaûm : khi ñoùi,coù thai, ñang cho con buù.sau luyeän taäp keùo daøi
Nhaát thôøi: thôøi kyø coù thai,strees
• Thay ñoåi beänh lyù:
Taêng: luùc ñoùi chuû yeáu beänh ñaùi thaùo ñöôøng tuïy,nheï hôn trong caùc roái loaïn noäi
tieát: cöôøng naêng tuyeán thaän,tuyeán giaùp,tuyeán yeân,toån thöông noäi soï,……
Giaûm:
• Khi tieâm quaù lieàu insulin,cöôøng naên tuyeán tuïy,u tuïy
• Thieåu naêng tuyeán thöôïng thaän,tuyeán giaùp,tuyeán yeân…

2
2
D
Do
- 4 - Created by taivuong
thuc tap hoa sinh.doc
III. ÑÒNH LÖÔÏNG PROTEIN TOAØN PHAÀN TRONG HUYEÁT THANH BAÈNG PHÖÔNG PHAÙP
BIURET (Chöông Protid 1)
1. Nguyeân taéc:
Trong moâ i tröôøng kieàm,biuret coù nhoùm CO – NH, gioáng nhö 1 lieân keát peptid seõ
keát hôïp vôù i Cu
2+
ñeå cho phöù c chaá t coù maø u tím hoàng.
Töông töï nhö tröôøng hôïp Protein duøng ñeå nhaän bieá t Protein

2. Keát quaû: löu yù ñôn vò:
Ñöôïc tính theo coâng thöùc sau:


Protein TP (g/l) = x 6,25 x 1 / 0,1




3. Bieän luaän:
a) Protein toaøn phaàn trong huyeát thanh khoûang 65 – 85 g/l
Keát luaän: khi thöïc taäp xong coù keát quaû döïa vaøo giôùi haïn treân vaø keát luaän roài sao ñoù dieán giaûi theâ m
b) Thay ñoåi beänh lyù:
Taêng:
• Hoäi chöùng maát nöôùc (noân,tieâu chaûy)
• Soát keùo daøi
• Beänh u tuûy
• Beänh Addsion (thieåu naêng voû thöôïng thaän)
Giaûm:
• Suy dinh döôõng
• Xô gan,vieâm gan
• Thaän hö nhieãm môõ
• Maát maùu
• Taêng nhu caàu protein: thai ngheùn,ñang cho con buù



D
Do
- 5 - Created by taivuong
thuc tap hoa sinh.doc

IV. Ñònh löôïng UREÂ Chöông Protid 2)
1. Nguyeân taéc:
Trong moâi tröôøng acid vaø noùng,ureâ phaûn öùng vôù i diacetyl monoxim (DAM) cho
moät hôïp chaát maøu hoàng.Theâm thíoemicarbazid (TSC) vaøo thuoác thöû (DAM) seõ
laøm taêng cöôøng ñoä maø u cuûa hôïp chaát.

2. Keát quaû: löu yù ñôn vò:
Ñöôïc tính theo coâng thöùc sau:


UREÂ (g/l) = x 0,3




3. Bieän luaän:
a) Ure laø saûn phaåm thoùai hoùa quan troïng nhaát cuûa protein bình thöôøng protein maùu vaøo
khoûang 0,2 - 0,4 g/l
Keát luaän: khi thöïc taäp xong coù keát quaû döïa vaøo giôùi haïn treân vaø keát luaän roài sao ñoù dieán giaûi theâ m
b) Thay ñoåi coù hai tröôøng hôïp
• Thay ñoåi sinh lyù:
Thay ñoåi chuùt ít theo cheá ñoä aên vaø theo tuoåi
• Thay ñoåi beänh lyù:
Taêng:
+ Nguyeân nhaân taïi thaän: caáp tính ( Vieâm caàu thaän caáp,vieâm oáng thaän,soát
vaøng da chaûy maùu do xoaén khuaån Liptospira gaây neân hoäi chöùng Gan thaän
caáp…),Maïn tính ( vieâm thaän maïn tính hay suy thaän)
+ Nguyeân nhaân ngoaøi thaän:
• Giaûm löu löôïng maùu ñeán thaän: suy tim öù huyeát,soác giaûm theå tích,…
• ÖÙ nöùôc tieåu do chöùng ngaøy tieát nieäu: Soûi nieäu quaûn,u tieàn lieät tuyeán,…
• Taêng Ureâ noäi sinh do huûy hoaïi maïnh teá baøo: boûng roäng,chaán
thöông,phaåu thuaät lôùn,…
Giaûm:
+ Coù thai,truyeàn nöôùc nhieàu quaù,toån thöông gan naëng,cheá ñoä aên thieáu protid laâu ngaøy
D
Do
- 6 - Created by taivuong
thuc tap hoa sinh.doc
V. Ñònh löôïng ACID URIC trong nöôùc tieåu: Chöông Enzym
1. Nguyeân taéc:
Trong moâ i tröôøng kieàm acid uric khöû acid phosphotungstic cho maø u xanh,ñoä
ñaäm cuûa maø u tæ leä vôù i noàng ñoä acid uric.
2. Keát quaû: löu yù ñôn vò:
Ñöôïc tính theo coâng thöùc sau:

Acid uric (mg/l) = x 500
(1)
Bình thöôøng moãi ngaøy löôïng nöôùc tieåu trung bình laø 1,5 lít / 24 h Ta môùi chuyeån sang soá löôïng
mg/l trong 24 giôø nhö sau:
Acid uric mg/l trong 24 = (500 x 1000 ) / 1500 = 333,333 mg/l
Acid uric mg/l trong 24 = (800 x 1000 ) / 1500 = 533,333 mg/l
3. Bieän luaän:
• Bình thöôøng Acid uric trong nöôùc tieåu vaøo khoûang 333,333 - 533,333 mg/l
Keát luaän: khi thöïc taäp xong coù keát quaû döïa vaøo giôùi haïn treân vaø keát luaän roài sao ñoù dieán giaûi theâ m
• Thay ñoåi beänh lyù:
Taêng: thoáng phong (guot) trong maùu thöôøng taêng roõ reät nhöng trong nöôùc tieåu coù
theå coù giai ñoanj giaûm,tröôøng hôïp suy thaän.
Giaûm: trong beänh veà thaän nhö vieâm thaän maïn,suy thaän

VI. Ñònh löôïng Bilibrubin trong huyeát thanh (phöông phaùp Malloy vaø Evelyn):
1. Nguyeân taéc:
Bilirubin phaûn öùng vôù i acid sulgganilic diazote hoùa taïo neân azobilirubin coù maøu
hoàng (phaûn öùng Ehrlich).
2. Keát quaû:
Döïa vaøo baûng bieåu trong phoøng thí nghieäm
3.Bieän luaän:
Trò soá bình thöôøng: toøan phaàn 5 – 10 mg/l;tröïc tieáp: nhoû hôn hoaëc baèng 2mg/l ( thöôøng khoâng
quaù 15% cuûa toøan phaàn); giaùn tieáp nhoû hôn hoaëc baèng 8mg/l ( thöôøng khoâng quaù 85% cuûa
toøan phaàn)
keát luaän döïa treân keát quaû cuûa thí nghieäm vöøa laøm xong
Taêng trong caùc tröôøng hôïp sau: vaøng da tröôùc gan: vaøng da sinh ly ôû treû sô sinh,truyeàn nhaèm
nhoùm maùu,thieáu men G6PD,soát reùt,… chuû yeáu taêng bilirubin giaùn tieáp vaø cuõng coù theå coù
trong caùc tröôøng hôïp taïi gan vaø sau gan: vieâm gan sieâu vi,ung thö tuïy taïng,ung thö gan,taéc
ñöôøng maät,… taêng bilirubin tröïc tieáp laø chính

D
Do
- 7 - Created by taivuong
thuc tap hoa sinh.doc



I. Tính Hoø a Tan: Chöông Lipid
1) Nguyeân taéc:
Dung moâi phaân cöïc tan trong dung moâi phaân cöïc vaø ngöôïc laïi dung moâi khoâng phaân cöïc tan
trong dung moâi khoâng phan cöïc.
2) Keát quaû:
Daàu khoâng tan trong nöôùc nhöng tan trong aceton.
3) Giaûi thích:
Döïa treân nguyeân taéc treân
Daàu coù coâng thöùc KHOÂNG phaân cöïc neân tan trong dung dòc khoâng phaân cöïc




II. Tìm theå Ceton trong nöôùc tieå u: Chöông Lipid
1. Nguyeân taéc:
Natri nitroprussiat taùc duïng vôùi caùc theå ceton cho phöùc chaát maøu tím,phaûn öùng xaûy ra trong moâi
tröôøng kieàm
2. Keát quaû:
Thaáy voøng tím ôû maët phaân caùch hai lôùp dung dòch
3. Bieän luaän:
Bình thöôøng khoâng coù theå ceton trong nöôùc tieå u coù trong caùc tröôøng hôïp beänh ñaùi thaùo ñöôøng
naëng,nhòn ñoùi laâu ngaøy
III. Xaùc ñònh hoaï t ñoä Amylase trong nöôùc tieå u (phöông phaù p Wohlgemuth) (Chöông Glucid)
1. Nguyeân taéc:
Duøng phöông phaùp pha loõang daàn nöôùc tæeu ñeå tìm löôïng enzym toái thieåu phaân huûy heát 2 ml
dung dòch hoà tinh boät 1 %o ôû nhieät ñoä 37
o
C trong 30 phuùt
Kieåm soùat ñoä phaân huûy cuûa hoà tinh boät baèn iod.Tính hoaït ñoä cuûa amylase theo ñôn vò
Wohlgemuth.
Qui öôùc: 1 Ñôn vò Wohlgemut laø löôïng amylase / 1ml nöôùc tieåu coù khaû naêng thuûy phaân 1 ml
dung dòch hoà tinh boät 1 %o ôû nhieät ñoä 37
o
C trong 30 phuùt
2. Keát quaû:
OÁng coù maøu xanh döông ñaàu tieân hieän ra ta laøm ñieåm moùc,vaø ñoïc keát quaû laø oáng nghieäm ngay tröôùc
ñoù,bôûi vì ñoù laø oáng coù löôïng amylase toái thieåu.. keát quaû x 2 = hoaït ñoä amylase theo Wohlgemuth.
C C R
R C C O
O C C R
1
3
2
- 8 - Created by taivuong
thuc tap hoa sinh.doc
3. Bieän luaän
a) Bình thöôøng hoaït ñoä amylase trong nöôùc tieåu töø 16 – 32 ñôn vò Wohlgemuth. Nhöng coù theå thay
ñoåi töø 8 – 64 Wohlgemuth.
Keát luaän: khi thöïc taäp xong coù keát quaû döïa vaøo giôùi haïn treân vaø keát luaän roài sao ñoù dieán giaûi theâ m
b) Thay ñoåi beänh lyù:
+ Taêng :taêng roõ trong vieâm tuïy caáp,taêng vöøa phaûi trong tröôøng hôïp vieâ m tuyeán mang taï i,quai
bò,hay nhöõng toån thöông thöù phaùt cuûa tuïy do nhöõng beänh cuûa caùc boä phaän chung quanh tuïy.
+ Giaûm: coù yù nghóa ít
IV. Ñònh tính protein trong nöôù c tieåu baèng phöông phaùp ñoâng keá t (Chöông Protid 1)
1. Nguyeân taéc
Protein hoøa tan trong nöôùc hình thanh dung dòch keo,trong ñoù caùc tieåu phaâ n protein tích ñieä n
cuøng daáu vaø mang lôùp aùo nöôùc (hydrat).Nhôø tích ñieän cuøng daáu neân caùc tieåu phaân protein ñaåy
nhau vaø nhôø coù lôùp aùo nöôùc neân chuùng ngaên caùch nhan,vì vaäy dung dòch keo protein beàn vöõng
Neáu laøm maát hai yeáu toá treân thì caùc tieåu phaân töû protein do chuyeån ñoäng seõ gaëp nhau dính vaøo
nhau thaønh nhöõng haït to vaø keát tuûa.
Coù theå laøm maát ñieän tích cuûa protein baèng caùch:
Theâm chaát ñieän giaû i nhö NaCl,……
Hoaëc ñöa PH cuûa moâi tröôøng chöùa protein veà PH ñaúng ñieän cuûa Protein Caùc tieåu phaân töû
protein khi ñaõ maát ñieän tích chæ coù lôùp aùo nöôùc deã bò keát tuûa,neáu laøm maát lôùp aùo nöôùc thì
protein seõ keát tuûa
Coù theå laøm maát lôùp aùo nöôùc baèng caùch:
Theâm chaát khöû nöôùc vaøo moâi tröôøng chöùa protein ( alcol,aceton…)
Hoaëc laøm bieáng tính protein baèng caùch ñun soâi,theâm acid hay kieàm maïnh hoaëc muoái kim
loaïi naëng
2. Keát quaû:
Protein keát tuûa
V. Ñònh tính protein trong nöôù c tieåu baèng phöông phaùpHeller (Chöông Protid 2)
1. Nguyeân taéc
Caùc acid voâ cô maïnh nhö HNO3, HCl,… vaø caùc acid höõu cô nhö acid Trichloracetic (TCA,
CCl3COOH) acid sulfosalicylic laøm bieán tính vaø tuûa ñaïi ña soá protein
2. Keát quaû
Protein seõ keát tuûa traéng nhö ñaùm maây môø ôû maët phaân caùch giöõa hai lôùp chaát loûng
3. Bieän luaän:
Bình thöôøng khoâng coù protein trong nöôùc tieåu
Keát luaän: khi thöïc taäp xong coù keát quaû döïa vaøo giôùi haïn treân vaø keát luaän roài sao ñoù dieán giaûi theâ m
Protein nieä u xuaát hieän thöôøng xuyeân trong: Thai ñoäc saûn giaät
+ Caùc beänh veà thaän:Vieâm thaän,thaän hö nhieãm môõ,suy thaän,vieâm caàu thaän caáp vaø maïn
+ Caùc beänh tuaàn hoøan: suy tim,taêng huyeát aùp
+ Beänh nhieãm khuaån: thöông haøn,vieâm phoåi
Tuy nhieân Protein trong nöôùc tieåu khoâng giuùp ta chuaån ñoùan ñöôïc tình traïng beänh
- 9 - Created by taivuong
thuc tap hoa sinh.doc
VI. Hoaït ñoäng cuûa CATALASE: (Chöông Enzym)
1. Nguyeân taéc :
Catalase xuùc taùc cho phaûn öùng phaân huûy hydroperoxyd (H2O2) thaønh H2O vaø oxy phaân töû

+ O
Catalase coù trong taát caû caùc toå chöùc ñoäng vaät vaø trong hoàng caàu, coù taùc duïng che chôû teá baøo choáng
tính ñoäc cuûa ñöôïc taïo thaønh töø caùc quaù trình oxy hoùa khöû trong cô theå.
2. Keát quaû :
Coù phaûn öùng ñoát chaûy taïo ra hieän töôïng que nhang coøn ñang ñoû boûng phöøng chaùy
3. Bieän luaän:
Döïa vaøo nguyeân taéc treân.
VII. AÛnh Höôûng cuûa Nhieät ñoä ñeán hoaït ñoäng cuûa Urease :(Chöông Enzym)
1. Nguyeân taéc:
Döôùi taùc duïng cuûa ureasse,ureâ bò thuûy phaân taïo thaønh N H vaø CO . Saûn phaåm thuûy phaân naøy
laøm pH moâi tröôøng trôû thaønh kieàm.Phaùt hieän saû n thaønh baèng phenolphtalein
(Baûn chaát cuûa enzym laø protein khi bò nhieä t ñoä taù c ñoäng seõ laøm bieán tính protein daãn ñeán protein bò
baát hoaït khoûang nhieät ñoä taùc ñoäng laø 60 – 80
o
C.Maët khaùc enzym coù nhieäm vuï xuùc taùc phaûn öùng taïo
neân phaûn öùng nhanh hay chaäm chöù khoâng coù taùc ñeå caên baèng phaûn öùng do ñoù khi ñeå thôøi gian sau
khi bò taùc ñoäng cuûa nhieät ñoä thì enzym vaãn seõ tieäp tuïc hoaït ñoäng trôû laïi)
2. Keát quaû:
OÁng nghieäm ñeå nhieät ñoä phoøng thí nghieä m 37
o
C sau quaù trình laøm thí nghieäm seõ coù maøu
hoàng ñaäm,
ÔÛ nhieät ñoä 60
o
C seõ coù maøu nhaït hôn ôû nhieät ñoä phoøng thí nghieä m
ÔÛ Nhieät ñoä soâi seõ khoâng coù hieän töôïng maøu hoàng.
3. Bieän luaän:
Do coù maët cuûa enzym amylase ure bò thuûy phaân taïo rao moâi tröôøng kieàm daãn ñeán phenolphtalein
duøng ñeå nhaän bieát dung dòch kieàm baèng caùch coù xuaát hieän maøu hoàng trong dung dòch
VIII. Tìm saéc toá maät trong nöôùc tieåu (kyõ thuaät Fouchet)
1. Nguyeân taéc:
Duøng BaCl ñeå keát tuûa lilirubin döôùi daïng muoái khoâng tan bari bilirubinat:
BaCl + Bilirubin bari bilirubinat Oxy hoùa muoái naøy baèng FeCl bieán bilirubin thaønh
biliverdin coù maøu xanh ve
2. Keát quaû:
Quan saùt coù maøu xanh ve
3. Bieän luaän: bình thöôøng khoâng coù bilirubin trong nöôùc tieåu neáu coù chæ laø bilirubin tröïc tieáp
H O
2 2
Catalase
2H O
2
2
H O
2 2
3
2
2
2
3
2
- 10 - Created by taivuong
thuc tap hoa sinh.doc



I. Phaûn öùng Fehiling:
1) Nguyeân taéc:
Trong moâi tröôøng kieàm maïnh MS ôû daïng Enediol khoâng beàn seõ deã daøng khöû caùc ion kim loaïi
naëng nhö Cu
2+
, Ag
+
,Hg
2+
, Caùc noái ñoâi bò caét ñöùt taïo thaønh nhöõng hoãn hôïp ñöôøng acid.Ñaëc bieät laø
phaûn öùng khöû vôùi Cu
2+


Ñöôïc toùm taéc nhö sau:

MS + base enediol (chaát khöû) Cu
2+
Cu
+
+ Ñöôøng acid

CuOH Cu O ↓ ↓↓ ↓

2) Keát quaû:
Thaáy voøng tím ôû maët phaân caùch hai lôùp dung dòch
3) Bieän luaän:
Döïa vaøo Nguyeân taéc treân Nhöng löu yù lactose laø MS ñoâi vaø baùn baõo hoøa
ÖÙng Duïng Tìm Glucose trong nöôùc tieåu:
1. Nguyeân taéc:
Glucose coù nhoùm Aldehyd seõ khöû Cu
2+
thaønh Cu
+
taïo oxid ñoàng nhaát keát tuûa maø ñoû gaïch
2. Keát quaû:
Co ùkeát tuûa maøu ñoû gaïch laø coù maët glucose trong nöôùc tieåu vaø ngöôïc laïi
3. Bieän luaän
Döïa vaøo nguyeân taéc treân.
II.Phaûn öùng Seliwanoff ( ñaëchieä u cho ceton) Chöông Glucid
1. Nguyeân taéc:
Aldose cuõng coù theå taïo thaønh hydroxymethylfurfur khi ñun noùng vôùi acid,nhöng phaûn öùng xaûy ra
raát chaäm neân phaûn öùng seliwanoff coù tính ñaëc hieäu cho ceton







Cu
2+
(phöùc hôïp Cu
2+
trong thuoác

Thöû Fehling hay Benedict
2
Tuûa Ñoû gaïch
HCl ñaäm ñaëc
-3 H O
2
OHH C
2
CHO
OHH C
2
H
H
H
OH
OH
OH
CH OH
2
Phöùc hôïp maøu ñoû
hydroxymethylfurfur
Resorcinol
OH
OH
fructose
- 11 - Created by taivuong
thuc tap hoa sinh.doc
2. Keát quaû:
Dung dòch coù furtose cho maøu ñoû (hay vaøng cam)
Dung dòch coù glucose khoâng cho maøu coù dung dòch trong suoát
3. Bieän luaän
Döïa vaøo nguyeân taéc treân
III.Phaûn öùng Nynhydrin (Chöông Acid Amin vaø Protein)
1.Nguyeân taéc:
Dung dòch Protein,peptid hoaëc acid amin khi ñun noùng vôùi nynhydrin 0,2% seõ cho maøu xanh tím
Nynhydrin laø chaáy oxy hoùa neâ n coù theå taïo phaûn öùng khöû cacboxy oxy hoùa cuûa acid amin vôùi nöôùc
ñeå cuoái cuøng cho ra CO ,NH vaø moät aldehyd. Nynhydrin khi bò khöû laïi taùc duïng vôùi NH vöøa
ñöôïc phoùng thích vaø keát hôïp vôùi 1 phaân töû Nynhydrin thöù hai,taïo thaønh saûn phaåm ngöng keát maøu
xanh tím.
2.Keát quaû:
Dung dòch sau phaûn öùng coù maøu xanh tím
3. Bieän Luaän:
Döïa vaøo nguyeân taéc treân.
IV.Tìm muoái maä t trong nöôù c tieåu (Phaûn öùng Hay)
1 Nguyeân taéc:
Caùc muoái kieàm cuûa acid maät laøm giaûm roõ reät söùc caêng beà maët cuûa nöôùc tieåu.Duøng löu huøynh thaêng
hoa ñeå phaùt hieän hieän töôïng naøy.
2 Keát quaû:
Löu huøynh khoâng rôi xuoáng laø keát quaû aâm tính
3 Bieän luaän:
V. Tìm maù u trong nöôùc tieåu (Phaûn ÖÙng Mayer)
1 Nguyeân taéc:
Hemoglobin (ngay caû khi bò bieán tính) coù taùc duïng nhö peroxidase giaûi phoùng oxy hoaït ñoäng töø
Hydroperoxid (nöôùc oxy giaø).Oxy naøy coù khaû naêng oxy hoùa moät soá thuoác thöû ñeå cho nhöõng maøu ñaëc
bieät (ví duï: Pyramidin,phenolphtalein bò khöû,pyridin)
2 Keát quaû:
Xuaát hieän maøu ñoû trong hai phuùt
3 Bieän luaän:
Bình thöôøng trong nöôùc tieåu khoâng coù hoàng caàu,trong moät soá tröôøng hôïp beänh lyù,coù theå tieåu ra Hb :
thieáu G6PD,truyeàn nhaàm nhoùm maùu … coù theå tieåu ra maùu nhö: saïn ñöôøng tieåu,lao ñöôøng tieåu,ung
thö boïng ñaùi,ung thö thaän,…
2 3 3
1
Câu hỏi Thi
Dự ñịnh hỏi Thi

I. Nguyên tắc:
- Viết tên hóa chất
- Thuốc thử gồm: ….
- ðiều kiện phản ứng

II. Giá trị:
Bình thường

III. Ý nghĩa - Ứng dụng phản ứng:
- Mục ñích ñể xem ta hiểu bài không

IV. Lưu ý:
- ðịnh lượng ñường sau lấy máu lúc ñói
- Vai trò các thuốc thử
- Vai trò Methanol phản ứng là gì?
- …



Câu hỏi

1. Viết 10 thông số nước tiểu, cho biết chỉ số bình thường
2. Phân biệt: Huyết thanh – Huyết tương
3. Sắc tố mật có trong nước tiểu trong trường hợp nào?
3. Làm thế nào phân biệt tiểu ra máu và tiểu huyết sắc tố?
4. Vai trò của methanol trong phản ứng Ehrlich ?
5. Tại sao gọi Bil LH là trực tiếp, Bil TD là gián tiếp?

6. Cách bảo quản dung dịch Diazo sao cho bền (dùng ñể do Bil TP)
7. Dùng Serum phải làm XN liền, sao Huyết tương không cần làm liền cũng ñược?
8. Tiểu ñạm, tiểu lipid ntn? Phân biệt ra sao?

8. Biện luận: Ceton/ NT, ñường/NT ?
9. Lấy máu XN ñường: dặn dò gì? Vì sao?

Mời các bạn tìm thêm câu hỏi và giải ñáp thêm nhé










2
1. Tổng phân tích nước tiểu:

Ghi nhớ
vui
10 thông số Chỉ số
bình thường
Bệnh lý Ghi
nhớ
vui
10 thông số Chỉ số
bình
thường
Bệnh lý
Sẽ Tỷ trọng (SG) 1.012 – 1.020 Út Urobilinogen
(URO)
1 – 4 mg/
4h

Phải PH 5.8 - 6.2 Vàng Bilirubin
(BIL)
(-)
Cầu Bạch cầu
(WBC)
Negative (-) Hồng Hồng cầu
(ERY)
(-)
ðạm Ketonic (KET) (-) Hemoglobin
(Hb)
(-)
ðường Protein (PRO) (-) 10
Nối Glucose
(GLU)
(-) Số
Kết Nitrit (NIT) (-) Phải
Xem














2. Huyết thanh – Huyết tương:


Lấy máu, chống ñông → vào ống
ly tâm → máu phân thành 2 phần
rõ rệt:

◘ Phần trên trong: màu vàng
nhạt (55 - 65% thế tích) ñó là
Huyết tương

◘ Phần dưới ñặc màu ñỏ thẫm
(40 - 45%): tb máu
Tách ly tâm huyết tương và tế bào máu bằng phương pháp

VD 1: 10 thông số NT : Thai 25 tuần VD 2:
GLU : Negative
BIL : Negative
KET : Negative
SG : 1.015
BLO : Small
pH : 7.0
PRO : Trace
URO 0.2 E.U. /dL
NIT: Negative
LEU : large Liệu em ñây là NT tiểu hay Nð thai
nghén. Mời bình luận ?

SG 1.015
pH 7
*LEU 500
NIT neg
PRO neg
GLU norm
KET neg
UBG norm
BIL neg
* ERY 250

3
Máu gồm hai thành phần: thể hữu hình (huyết cầu) và huyết tương.
- Hữu hình của máu: HC, BC, TC (43 - 45% tổng số máu), chỉ số này ñược gọi là hematocrit (HCT).
Hồng cầu là thành phần chiếm chủ yếu trong thể hữu hình.

- Huyết tương chiếm 55 - 57% tổng số máu.

Chứa: nước, protein, chất ñiện giải, chất hữu cơ và vô cơ, hocmon, vitamin, chất trung gian hoá học, các sản
phẩm chuyển hoá ...

Huyết tương chứa toàn bộ các chất cần thiết cho cơ thể và toàn bộ các chất cần ñược thải ra ngoài.

Huyết tương bị lấy mất fibrinogen thì ñược gọi là huyết thanh.
Tóm lại :















3. Sắc tố mật có trong NT trong trường hợp nào?
MẬT: Ngoài chứa Bil ra còn chứa (acid mật, sắc tố mật, … ) : nhũ tương hóa chất béo

Không xuống
ứ lại
Ruột
(Tại ñây: Lipid không ñược hấp thu tốt)
NT
Uro ↓ Phân có mỡ


Sterco ↓
(Phân bạc màu: phân cò)

- Về lâu dài: thiếu Vitamin A, D, E, K
- Bệnh lý: K ñầu tụy, VD tại gan, VD sau gan, …

Sắc tố mật: gọi chung cả quy trình (từ HC → Bil → Gan → ruột → … : tại gan, sau gan)
Có sắc tố mật/ NT = Có Bil LH/ NT




Lấy máu → cho chất chống ñông → máu không ñông
Quay ly tâm



Lấy máu → không chất chống ñông → máu không ñông
Quay ly tâm

Nhận xét:
- Có chất chống ñông là Huyết tương
- Huyết thanh: Huyết tương ñã loại bỏ chất chống ñông

4
4. Phân biệt: tiểu máu (HC) - Tiểu Huyết sắc tố (Hb) ?
Tiểu HC và tiểu Hb ? quay ly tâm soi KHV: có HC: tiểu HC
Không có: tiểu Hb
Bệnh lý: Tiểu máu: bệnh lý tại ñường tiết niệu
Tiểu Hb: giống bệnh lý VD trước gan: SR, truyền nhầm nhóm máu, .. .

5. Vai trò của Methanol trong phản ứng?
Bil TD: không tan trong nước nhưng tan trong dung môi
Methanol: Hòa tan Bil tự do

6. Tại sao gọi là Bil trực tiếp – Bil gián tiếp?
ðặt tên: Bil TD = Bil gián tiếp (có ý nghĩa ntn ? )
Bil LH = Bil trực tiếp

Bil TD : không tan trong nước
Bil LT : tan trong nước
Thuốc thử Diazo có pha nước: chỉ LH phản ứng

Do ñó: muốn ño Bil TD: dùng methanol ñể ño

KL: Trực tiếp: tác dụng với H
2
O
Gián tiếp: phải qua dung môi methanol

7. Cách bảo quản dung dịch Diazo sao cho bền (dùng ñể do Bil TP)
Diazo thường kém bền: do ñó thường phải bảo quản bằng 2 dd riêng biệt. Khi pha lại chỉ bền ở với thời
gian: 30 phút

8. Tại sao không dùng Huyết tương mà lại dùng Huyết thanh trong ñịnh lượng Ure?

- Nếu dùng Huyết tương (có chất chống ñông: ion F
-
) sẽ ức chế quá trình ñường phân xảy ra khi ñể Huyết
tương khoảng ½ giờ sau [ñường] sẽ giảm

- Nếu dùng Serum (huyết thanh): ½ giờ sau: [ðường] vẫn bình thường

9. Nước tiểu ñục: Lipid (tiểu dưỡng trấp) – Protein (tiểu ñạm).
Nhỏ dm hữu cơ vào T rong: Lipid
Muốn phân biệt Lắc ñều
(aceton, ether, ...) ðục: Protein

10. Lấy máu XN ñường: dặn dò gì? Vì sao?
- Dặn dò: nhịn ñói
Vì ñường hấp thu rất nhanh: làm cơ thể chưa kịp ñiều hòa





5
LIPID
1.Khảo sát tính hòa tan:
Nguyên tắc:
Lipid là gì?
- Là HCHC
- Không ñồng nhất về CTCT
- Không tan trong nước, nhưng tan trong dung môi hữu cơ.
Ứng dụng:
Pha chế hóa chất: các chất có bản chất lipid pha trong dung môi hữu cơ
Bảo quản trái cây: muốn ñể lâu không nên rửa lớp sáp bên ngoài (lớp Sáp: bản chất Lipid)
vì nó ngăn sự bốc hơi nước.
Thuốc: có bản chất dầu: không nên tiêm Tm vì sẽ bị viêm tắc
Chẩn ñoán: nước tiểu ñục thì nguyên nhân có thể là Lipid (tiểu dưỡng trấp) hoặc Protein.

Nhỏ dm hữu cơ vào T rong: Lipid
Muốn phân biệt Lắc ñều
(aceton, ether, ...) ðục: Protein

2. ðịnh lượng cholesterol TP/ Huyết tương:
Nguyên tắc:
Nước tiểu = Cholesterol tự do + Cholesterol Este hóa

3 phản ứng:

CHE
C
E
+ H
2
O C + AB (1)

CHO
C + O
2
Cholesten – 3 one + H
2
O
2
(2)


Chưa thấy tạo màu : phát hiện bằng cách dùng pứ (3)
POD

H
2
O
2
+ (4 amino penazol + Phenol) Quinoneimine + 4 H
2
O
(ðỏ hồng )

Cường ñộ ðỏ hồng: phụ thuộc [H
2
O
2
]
- Ghi chú: POD (Peroxidase), CHE (Cholesterol Esterase), CHO (Cholesterol Oxidase)

Ứng dụng:
- ðánh giá nguy cơ mắc bệnh xơ vữa ñm của BN
- Cholesterol TP tăng: bệnh tim mạch, ñái tháo ñường, ...
- Cholesterol TP giảm: rối loạn chuyển hóa lipid, ...

3. Tìm các thể Ceton trong nước tiểu:
Nguyên tắc:

OH
-

Ceton + Natri nitroprussiat Phức màu tím

6
Ý nghĩa:
- ðánh giá mức ñộ nặng hay nhẹ của bệnh Tiểu ñường.


PROTID

4. Phản ứng Ninhydrin: nhận biết aa
Nguyên tắc:

- DD Protein Ninhydrin 0,2%
Peptid t
0
dd: màu xanh tím
Acid amin

- Ninhdydrin: chất chống oxh sp cuối cùng Aldehid
+ NH
3

Acid amin, H
2
O CO
2




(Phức hợp màu tím)







Ninhydrin bị khử + NH
3
+ Ninhydrin thứ 2 : tạo sản phẩm ngưng kết màu xanh tím

(Chi tiết: tham khảo Sách thực tập Hóa sinh Trang 28 )

Phức hợp tím + NH
3
Phức hợp màu xanh

Ứng dụng :
- Dùng ñể nhận biết aa : dd sau phản ứng màu xanh tím
- Nhận biết Prolin : dd sau phản ứng : màu vàng

5. ðịnh lượng Protein toàn phần trong huyết thanh bằng PP Biuret
Nguyên tắc :

-Trong môi trường kiềm, biuret (có nhóm CO – NH, giống như 1 lk peptid) sẽ kết hợp với Cu
2+
ñể cho
phức tím hồng
7


Phức tím hồng (trong môi trường kiềm) Protein

- Protein : 2 lk peptid trở lên : cũng cho phức tím hồng
Cường ñộ màu tím hồng phụ thuộc nồng ñộ Protein (Huyết thanh)

6. Phản ứng tủa Protein bởi nhiệt với môi trường:
Môi trường acid nhẹ:
Nguyên tắc:
- 2 yếu tố giúp hòa tan Protein
Lớp áo nước bao xung quanh (Hydrat hóa) (1)
Tích ñiện cùng dấu (2)

- Các tiểu phân Protein, ñối với
(1) chúng ngăn cách nhau dd keo Protein

(2) chúng ñẩy nhau vững bền

Làm mất (1) hoặc (2) hoặc cả (1), (2) Giảm tính tan Protein (Protein sẽ tủa)
(Tùy theo Protein)
Môi trường acid mạnh:
Acid vô cơ mạnh: HNO
3
, H
2
SO
4
, HCL
Acid Hữu cơ: TCA, CCL
3
COOH Làm biến tính Protein Tủa Protein
Acid sulfosalicylic

Kết luận:
Protein trong nước tiểu không giúp ñược chẩn ñoán tình trạng bệnh nặng hay nhẹ

Ứng dụng:
- ðịnh lượng Protein trong nước tiểu

GLUCID
7. Phản ứng Fehling:
Nguyên tắc:
MS + Base → enediol (chất khử)

Cu
2+
(trong thuốc thử Fehling, Benedict)


Cu
2
O CuOH Cu
+
+ ñường acid
Tủa ñỏ (Màu vàng)
gạch
8
Ứng dụng của phản ứng Fehling:
- Dùng ñể xác ñịnh tính khử của ðường
- Dùng ñể ñịnh tính và ñịnh lượng ñường trong huyết thanh và trong nước tiểu

8. Phản ứng tìm Glucose trong nước tiểu:
Nguyên tắc:
Glucose có nhóm aldehyd: sẽ khử Cu
2+
thành Cu
+
tạo oxid ñồng nhất tủa màu ñỏ gạch
Ứng dụng tìm ñường/ NT:
- Dùng ñể theo dõi trong ñiều trị
- Xem có rối loạn hệ thống ñiều tiết glucose hay không

9. ðịnh lượng ðường trong máu:
Nguyên tắc:
Khử
Glucose máu dd CuSO
4
Cu
+
(Cu
2
O : ñỏ gạch)


(thuốc thử) (dễ bị oxh, không ño trực tiếp)
(pứ thực hiện trong môi trường kiềm nóng) +
Arsenmolypdat
(bị khử)


ðo ñược Molypden oxid
bằng quang sắc kế (màu xanh)

Ý nghĩa :
- Kiểm tra xem có rối loạn
Có rối loạn chuyển hóa Glucid,
Rối loạn hệ thống ñiều hòa ñường huyết ở gan
Rối loạn hệ thống nội tiết

- Là Xét nghiệm ñể theo dõi trong ñiều trị bệnh ðái tháo ñường


ðỊNH LƯỢNG URE – ACID URIC

10. ðịnh lượng ure:
Nguyên tắc:
Trong môi trường acid và nóng, ure phản ứng với diacetyl monoxim (DAM) cho một hợp chất màu hồng.
Thêm thiosemicarbazid vào thuốc thử DAM sẽ làm tăng cường ñộ màu của hợp chất.

Ure + H
+
hợp chất + TSC Tăng cường ñộ
DAM t
0
màu hồng màu hồng lên


Ý nghĩa:
- Là XN ñể theo dõi các bệnh lý về gan và thận

11. ðịnh lượng acid uric trong nước tiểu:
Nguyên tắc:
9
Khử: acid phosphotungstic
Acid uric màu xanh
(ñộ ñậm của màu tỉ lệ với nồng ñộ acid uric)

Ứng dụng:
- Là XN ñể theo dõi bệnh thống phong

CATALASE – UREASE – AMYLASE


12. Khảo sát hoạt ñộng của Catalase:
Nguyên tắc:
- Hydroperoxid (H
2
O
2
): Nồng ñộ cao → gây ñộc cho tế bào

H
2
O
2
vào cơ thể H
2
O + ½ O
2

(sp ñộc) Catalase (Không ñộc)

Do ñó: Catalase có tác dụng che chở: chống tính ñộc của H
2
O
2.

Chúng ñược tạo thành từ các quá trình Oxy hóa – Khử trong cơ thể
Có ở: tất cả các tổ chức ñộng vật, và trong hồng cầu

Ý nghĩa - Ứng dụng:
- Catalase: enz nội bào có nhiều trong tế bào
- Khi chấn thương, bong tróc, Enz Catalase thoát ra
Bỏng, nhiễm trùng tiểu,… ngoài nhiều
- Dùng Oxy già (có H
2
O
2):
rửa vết thương → làm tb không bị hủy hoại
Mặt khác: tiêu diệt VK yếm khí trú ngụ trong ñó.
- Biết ñược sự viêm nhiễm nhiều hay ít

13. Khảo sát hoạt ñộ amylase trong nước tiểu:
- Amylase có vai trò thủy phân tinh bột (ñường ña thành ñường ñơn)
- Amylase máu : có PTL nhỏ thoát ra ñược màng lọc cầu thận → Tiểu ra amylase rất dễ dàng
→ Nồng ñộ amylase / máu , amylase /NT ñều có

- Amylase ñược tiết ra từ các tuyến: Tuyến nước bọt, tuyến mang tai, tuyến tụy
- Hoạt ñộ amylase/ NT: bình thường: 16 – 32 ñơn vị Wohlgemuth
(Có thể dao ñộng: 8 – 64 ñv Wohlgemuth): tùy theo từng người
Ứng dụng:
- Giúp chẩn ñoán và giám sát bệnh viêm tụy cấp và mãn tính hoặc các rối loạn khác có liên quan ñến tụy

14 . Ảnh hưởng nhiệt ñộ lên hoạt ñộng urease:
Nguyên tắc:
Bị thủy phân
Ure NH
3
: kiềm Phenoltalein Dd có Hồng ñỏ
Urease CO
2 (Phụ thuộc Urease thủy phân
nhiều hay ít)
KL: - Sự hoàn nguyên chỉ xảy ra ở nhiệt ñộ thấp
- Protein dễ bị biến tính ở nhiệt ñộ cao làm enzym urease mất hoạt tính
Thấy ñược bản chất Protein của ureas

10








You're Reading a Free Preview

Tải về
scribd
/*********** DO NOT ALTER ANYTHING BELOW THIS LINE ! ************/ var s_code=s.t();if(s_code)document.write(s_code)//-->