South African Journal of Botany 72 (2006) 460 466 www.elsevier.

com/locate/sajb

Regeneration and transformation of an elite inbred line of maize (Zea mays L.), with a gene from Bacillus thuringiensis
M. Rafiq c , T. Fatima a , T. Husnain a,, K. Bashir b , M.A. Khan a , S. Riazuddin a
b

National Centre of Excellence in Molecular Biology, 87-W, Canal Bank Road, University of The Punjab, Lahore, Pakistan Laboratory of Plant Biotechnology, 1-1-1 Yayoi, Graduate School of Agricultural and Life Sciences, University of Tokyo, Japan c Institute of Biotechnology and Genetic Engineering, University of Sindh, Jamshoro, Pakistan Received 23 June 2005; accepted 14 December 2005

Abstract Tissue culture conditions for regeneration of fertile plants from immature embryos were optimized using four local inbred lines of Zea mays. Immature embryos were cultured on five different media. The highest regeneration efficiency of 86.40% was observed for BR-6 at N6 modified media (supplemented with 1.0 mg L 1 2,4-D, 25 mM L-Proline, and 100 mg L 1 Casein Hydrolysate) while B-46, EX-285 and EX-295 gave a regeneration percentage of 57%, 77%, and 63%, respectively. A total number of 1646 immature embryos were bombarded by a gene gun using tungsten micro projectiles coated with a multi-gene plasmid pCMAC, containing gusA (reporter gene), hpt (hygromycin phosphotransferase), and cry1Ac genes driven by maize ubiquitin promoter. Regenerates were selected on a medium containing 40 g/L hygromycin and then screened with GUS assay. Thirty-five transgenic lines were obtained with a transformation frequency of 2.21%. The integration and expression of cry1Ac was confirmed with PCR, Southern Blot analysis, ELISA, and Western Blot analysis. The studies confirmed that cry1Ac gene has been stably transformed into the local inbred line (BR-6) and caused 80100% mortality to armyworm (Spodoptera frugiperda) in insect feeding bioassay. 2006 SAAB. Published by Elsevier B.V. All rights reserved.
Keywords: Immature embryo; cry1Ac; Zea mays; Regeneration; Biolistic transformation

1. Introduction Maize (Zea mays) is the third most important cereal crop in the world. Approximately 59% of world maize production is lost every year due to pests and diseases (Oerke et al., 1994). Lepidopteran insects are among the most destructive insects of the world (Khan et al., 1991) and cause serious losses to crops. At present the only approach used to control these losses is heavy use of pesticides, which are expensive, non-specific, cause environmental problems and human health concerns, and a large number of insect pests show resistance against different pesticides.

Abbreviations: Bt, Bacillus thuringiensis; gusA, beta-glucuronidase; Xgluc, 5-bromo-4-chloro-3-indolyl-beta-D-glucuronide. Corresponding author. E-mail address: tayyab@cemb.edu.pk (T. Husnain).

Bacillus thuringiensis (Bt) is a Gram positive, spore forming soil microbe (Hoftey and Whitely, 1989), which has a lethal effect on lepidopteran insect larvae and is generally safe for human consumption (NRC, 2000). More than 100 genes encoding delta endotoxins from a wide range of Bt isolates have been isolated and sequenced (Mazier et al., 1997). With the advent of genetic transformation techniques based on recombinant DNA technology, it is possible to clone and insert genes into the plant genome that confirms resistance to insects (Bennett, 1994). Two commercialized Bt crops, cotton and maize covered approximately 15% of 130 million acres of genetically modified crops throughout the world in 2002 (James, 2002). In recent years, various approaches for transformation and regeneration of fertile maize plants have been developed. In addition to a protocol for PEG-mediated protoplast transformation (Golovkin et al., 1993) most of these approaches have been based on biolistic transformation of suspension cells (Fromm et al., 1990)

0254-6299/$ - see front matter 2006 SAAB. Published by Elsevier B.V. All rights reserved. doi:10.1016/j.sajb.2005.12.010

M. Rafiq et al. / South African Journal of Botany 72 (2006) 460466

nos pro

461
nos ter

hpt

nos ter

Ubi pro

cry1Ac

nos ter

CaMV35S pro

gusA

HindIII

HindIII

Fig. 1. Plasmid vector pCMAC.

or long-term type-I callus cultures (Walters et al., 1992). The scutellar tissue of an immature embryo is a suitable target for DNA delivery by particle bombardment to obtain stable transgenic maize plants (Brettschneider et al., 1997). Transgenic plants transformed with cry genes showed the expression of Cry proteins and insecticidal activity against European corn borer (Ostrinia nubilalis) in maize plants (Koziel et al., 1993; Williams et al., 1997) developed transgenic corn hybrids, which sustained significantly less leaf feeding damage by the fall armyworm (Spodoptera frugiperda) and Southwestern corn borer (Diatrea grandiosella). The high levels of resistance to fall armyworm and near immunity to Southwestern maize borer of transgenic maize hybrid provided the highest levels of resistance documented for both pests. In Pakistan several reports are available on transformation of tobacco (Khan et al., 2003), chickpea (Husnain et al., 1994; Husnain et al., 1997), cotton (Majeed et al., 2000) and rice (Husnain et al., 1995; Husnain et al., 1998; Maqbool et al., 1998) but maize is still difficult to transform. The basic deficiency was a reproducible and efficient system for the generation of fertile plants through callus culture as it is an essential requirement for biolistic transformation system. Regeneration of corn has been reported via organogenesis of callus derived from leaves (Chang, 1983), mesophyll (Harms et al., 1976), immature embryos (Green and Phillips, 1975) and shoot tip (Zhong et al., 1992). These methods did not produce plants efficiently. Zhong et al. (1992) reported highly regenerative explant source in developing several in vitro procedures that permit one to obtain high frequency differentiation of adventitious shoots and somatic embryos in corn shoot tips excised from seedlings grown in vitro. Kamo and Hodges (1987) reported the isolation of maize protoplast that divided rapidly and produced calli that differentiated into somatic embryos. These somatic embryos were induced to form roots and small leaf like structures. Callus formation and its regeneration into whole plant by using immature embryos of maize was also reported (Green and Phillips, 1975) and immature embryos produced embryogenic callus under certain conditions (Green and Rhodes, 1982); but there is insufficient information to assess the efficiency and value of this embryogenic callus in the regeneration. On the basis of these information, immature embryos seem to be the most suitable candidate for establishing a reproducible and efficient regeneration system for the genetic transformation of maize. Keeping these points in view, the present endeavor was undertaken at the National Centre of Excellence in Molecular Biology, Lahore to evaluate the regeneration response of four inbred lines on five media to select the best line for genetic transformation experiments and then transformation with cry1Ac gene was done to create insect resistant maize plants.

2. Materials and methods 2.1. Plant material and embryo isolation Inbred lines BR-6, B-46, EX-285 and EX-295 were obtained from the Department of Plant Breeding and Genetics, University of Agriculture Faisalabad, Pakistan. These lines were sown in the field in four replications at 10 days interval to ensure the continuous supply of immature embryos. All plants were hand pollinated to ensure the homozygosity of the material and ears were harvested 10 days post pollination. Each ear was dehusked, surface sterilized for 20 min in 500 ml of 50% (v/v) sodium hypochloride (with 0.1% Tween 20) and then rinsed 3 times (5 min each) with sterile distilled water. The tops of the kernels were excised with sterile scalpel blade and zygotic embryos were isolated with a fine tip spatula. Immature embryos with undamaged scutellar tissues were placed on different media with the embryo axis in contact with the medium and incubated in the dark at 25 2 C. 2.2. Tissue culture The five different media used for callus induction were MS (Murashige and Skoog, 1962) with 1.0 mg L 1 2,4-D, LS (Linsmaier and Skoog, 1965) with 1.0 mg L 1 2,4-D, B5

Fig. 2. Different stages of transformation of maize: (A) immature embryo on osmoticum medium; (B and C) regeneration on hygromycin; (D) regeneration into whole plant.

462

M. Rafiq et al. / South African Journal of Botany 72 (2006) 460466

Table 1 Callus formation and regeneration of inbred lines on different media Genotype MS C.F. BR-6 B-46 EX-285 EX-295 69 7 82 8 64 7 78 6 Reg 68 9 NK 70 11 48 4 B5 C.F. 45 8 55 10 39 6 30 5 Reg 26 3 NK 18 3 36 7 N6 C.F. 82 7 70 9 93 4 81 4 Reg 72 4 48 7 59 8 51 7 N6 modified C.F. 91 4 97 2 96 2 79 5 Reg 86 4 57 10 77 8 63 8 LS C.F. 91 4 97 2 96 2 79 5 Reg 75 4 42 7 74 6 49 5

Values are expressed in percentage of three replications. Values followed by represent the standard deviation.

(Gamborg et al., 1966) with 1.0 mg L 1 2,4-D, N6 (Chu et al., 1975) with 1.0 mg L 1 2,4-D and N6 modified medium with 1.0 mg L 1 2,4-D, 25 mM L-Proline, and 100 mg L 1 Casein Hydrolysate. Callus formation efficiency was recorded after three weeks of incubation. For regeneration studies, the induced calli were transferred on to RM-I (N6 salts and vitamins, with 6% sucrose, 1.0 mg L 1 NAA and 0.4% gellam gum) for 15 days in the dark at 25 2 C. Then on RM-II (MS salts and vitamins with 2.0 g L 1 myo-inositol, 2% sucrose and 0.3% gellam gum) in light at 25 2 C for 20 days. After 20 days the regenerated plantlets were then transferred on RM-III (1/2MS salts and vitamins with 2% sucrose, 1.0 g L 1 myo-inositol and 0.3% gellam gum) in magenta boxes for rooting. Regenerated plants were then shifted to soil. 2.3. Transformation

thuringiensis, a hygromycin resistant hpt gene and a gusA reporter gene under the control of maize ubiquitin promoter was used for further studies. DNA was coated on tungsten particles and bombarded from a distance of 15 cm and He pressure of 10 kg cm 2. Twenty hours after bombardment, calli were transferred to N6 modified medium containing 40 mg L 1 hygromycin. Transient expression was confirmed by incubating the calli with solution containing substrate X-gluc (5-bromo-4-chloro-3indolyl-beta-D-glucuronide) at 37 C as described by Jefferson et al. (1987). Transformation efficiencies were calculated, on the basis of hygromycin selection, by analysis of variance according to CRD followed by the StudentNewmanKeuls test (SNK). Schematic representation of transformation events is summarized in Fig. 2. 2.4. Molecular analysis

Immature embryos of maize inbred line BR-6 were isolated and cultured on an N6 modified medium as described. Four days after culturing, the explants were cultured on osmoticum medium (1 mg L 1 2,4-D, 25 mM proline, 2% sucrose, 0.2 M sorbitol, 0.2 M mannitol and 0.4% phytagel) for 4 h. First of all the optimum distance (from 9 to 21 cm) or transformation of embryogenic calli were determined. Plasmid pCMAC containing gusA reporter gene was coated on tungsten particles (Sylvania chemical Metals, USA) as described by Husnain et al. (1995, 1997) and bombarded with a biolistic unit at He pressure of 10 kg cm 2. In total, 45 calli were used in three replicates for each distance and were bombarded from a distance of 9, 12, 15, 18 and 21 cm. The optimum distance was calculated on the basis of GUS assay according to the completely randomized design followed by the Student NewmanKeuls test (SNK). Then the same multi-gene vector pCMAC (Fig. 1) containing a synthetic cry1Ac gene of B.
Table 2 Transient expression of gusA gene in immature embryos of inbred line BR-6 bombarded from different distances Distance (cm) 09 12 15 18 21 No. of Calli bombarded 45 48 45 45 42 GUS positive 04 12 24 16 05 No. of blue spots/ Frequency calli (%) 09 26 68 31 08 8.9 c 25.0 b 53.3 a 35.6 b 11.9 c

2.4.1. ELISA Envirologix kit APP003 (Envirologix, Maine, USA) was used to check the expression of cry1Ac gene in transgenic plants. Protein was extracted from leaves of regenerated transgenic plants according to the instructions (Envirologix, Maine, USA). Protein was diluted and estimated with the help of Bradford reagent and 10 g of this protein samples was coated in separate wells along with positive and negative controls. The reaction was processed according to instructions (Envirologix, Maine, USA). Plants positive for the presence of Cry1Ac were identified on the basis of yellow color.

The values followed by the same letter are not significantly different from each other according to ANOVA followed by SNK test.

Fig. 3. Transient expression of GUS gene: (A) immature embryo; (B) callus.

M. Rafiq et al. / South African Journal of Botany 72 (2006) 460466 Table 3 Transformation of immature embryos of maize inbred line BR-6 with pCMAC Exp. no. B01 B02 B04 B05 B06 B09 B10 Total No. of calli bombarded 202 151 285 180 206 316 306 1646 Calli selected on hyg (40 mg/L) 06 05 33 18 09 32 26 129 No. of calli regenerated 04 02 06 04 04 07 08 35 Transformation efficiency (%) 1.98 a 1.32 a 1.40 a 2.22 a 1.94 a 2.21 a 2.62 a 2.21

463

Fig. 5. Southern Blot analysis of transgenic plants: Lane 1 RCB-10-1; Lane 2 RCB-10-2; Lane 3 RCB-12-5; N negative control; P positive control.

The values followed by the same letter are not significantly different from each other according to ANOVA followed by SNK test.

2.4.2. Western Blot analysis Protein was extracted from leaves of transgenic plants as described by Koziel et al. (1993) and quantified by Bradford assay (Bradford, 1976). Twenty micrograms of total protein was separated in 10% polyacrylamide gel containing SDS. The proteins were then electro transferred onto nitrocellulose membrane. The membrane was blocked for 1 h with 5% skim milk in PBST buffer. The membrane was incubated with rabbit anti-Cry1Ac primary antibodies in blocking solution for 2 h. The membrane was then washed three times in 1 PBST for 15 min per washing, probed with alkaline phosphataseconjugated anti-rabbit IgG for 1 h followed by three washes in PBST for 10 min each. Color reaction was developed with sigma fast NBT/BCIP. 2.4.3. PCR and Southern Blot analysis For PCR and Southern Blot analysis, genomic DNA was isolated from 1 g of fresh leaf tissue as described by Dellaporta et al. (1983). PCR was carried out in a volume of 25 l containing 100 ng genomic DNA, forward (5ACAGAAGACCCTTCAATATC3) and reverse primers (5GTTACCGAGTGA AGATGTAA 3) specific for cry1Ac (300 nM each), dNTP's (200 M each), 1 PCR buffer (50 mM KCl, 1.5 mM MgCl2, and 10 mM TrisHCl) and Taq polymerase (one unit). PCR program used for the amplification consisted of 35 cycles of 94 C for 1 min, 54 C for 30 s, 72 C for 1 min, with an additional 5 min at 94 C before first cycle and an additional 10 min at 72 C after last cycle. DNA (20 g) was digested with HindIII for cry1Ac according to supplier's instructions (NEB and enzyme production lab CEMB). The digested DNA samples were electrophoresed

using 1% agarose gel in TBE buffer at 3.0 v cm 1 and 20 C for 18 h. Southern blotting was carried out as described by Sambrook et al. (1989). 2.4.4. Insect bioassays For lab scale bioassay, leaves from 40-day-old transgenic plants were collected and cut into 6 cm pieces. Leaves of untransformed plants were taken as negative control. Leaf pieces were washed with distilled water, dried for 10 min and placed in Petri dishes containing moistened filter papers. The second instar larvae of armyworm (Spodoptera frugiperda) (one larvae/Petri dish) were placed on leaves and incubated at 25 2 C for 3 days in three replicates. Larva survival, leaf area damage and larval characteristics were recorded. 3. Results The capacity of maize to produce calli on different media from immature embryos was investigated for four inbred lines. The five different media used for callus induction were MS, LS, N6, B5 and N6 modified medium. The highest callus formation efficiency was recorded for N6 modified medium with callus formation efficiency ranging from 7997% in different inbred lines. The inbred line B-46 showed maximum response of callus induction (5597%) on different media (Table 1). Similarly, BR-6 showed the highest regeneration percentage of 86% on N6 modified medium while B-46, EX-285 and EX-295 showed a regeneration percentage of 57%, 77%, and 63%, respectively. Regeneration percentage on other media (MS, LS, N6, B5) ranged between 2675%, 4248%, 1874% and 3651% for BR-6, B-46, EX-285 and EX-295, respectively. Based on these results, BR-6 was selected for transformation studies due to its high regeneration percentage. Optimum distance between the 9 and the 21 cm for transformation of maize embryogenic calli was determined by bombarding tungsten particles coated with pCMAC containing gusA reporter gene. Calli were bombarded from 9, 12, 15, 18 and
Table 4 Summary of molecular analysis Genotype GUS + + + + ELISA + + + Western blotting + + + N.D. PCR + + + N.D. Southern blotting + + N.D. N.D.

Fig. 4. Western Blot analysis of transgenic plants: Lane 1 RCB-10-1; Lane 2 RCB-10-2; Lane 3 RCB-12-5; N negative control; P positive control; S size marker.

RCB-10-1 RCB-10-2 RCB-12-5 RCB-12-8

464

M. Rafiq et al. / South African Journal of Botany 72 (2006) 460466

Fig. 6. Insect feeding bioassay of transgenic plants by armyworm (Spodoptera frugiperda): (A) transgenic; (B) control.

21 cm at constant pressure of He. Transformation efficiency differed from 8.9% to 53.3% for 9 and 15 cm, respectively. The highest transformation efficiency was observed by bombarding at a distance of 15 cm where 24 out of 45 calli were GUS positive (Table 2). The immature embryos of BR-6 were then bombarded with a gene gun from a distance of 15 cm with pCMAC vector. A total of 1646 immature embryos were bombarded in ten different experiments and presence and expression of the transgenes were investigated through different molecular and immunological techniques. Histochemical localization of GUS activity was detected by incubating callus and leaf tissue with substrate X-gluc. The expression of gusA was observed both in immature embryos and callus (Fig. 3). A total of 129 calli were selected on media containing hygromycin and 35 were regenerated on regeneration media with a transformation efficiency of 2.21% (Table 3). Selected plants were subjected to ELISA using APP003 Environlogix kit and four plants RCB-10-1, RCB-10-2, RCB12-8 and RCB-12-5 were identified as positive on the basis of yellow color. These plants were then subjected to Western blotting and results confirmed the expression of Cry1Ac protein as 68 kDa band (Fig. 4). For Southern hybridization the genomic DNA of transformed plants was digested with HindIII to release a 4.1 kb fragment containing the full length of cry1Ac which was detected with the help of digoxigenin labeled probe. The plant line RCB-10-2 showed exactly the same size of a band as positive control while RCB-10-1 showed a band slightly above positive control (Fig. 5). Results of molecular analysis are summarized in Table 4. The primary transgenic plants were further analyzed for expression of proteins by insect feeding bioassay. Armyworm larvae fed on untransformed plant tissues grew well. However, larvae fed on transgenic plant tissues suffered from deleterious effects (Fig. 6). Mortality in transformed plants was observed in the range of 80100% and the insects that survived suffered a reduction in body weight. It was observed that the dead larvae severely showed the typical symptom of Bt toxicity e.g. browning before ultimate death. 4. Discussion Five different media were used to assess the callus induction response from scutellum tissue of immature embryos of dif-

ferent inbred lines. N6 modified medium supplemented with 25 mM proline, 100 mg L 1 casein hydrolysate, and 1.0 mg L 1 2,4-D showed the best response of callus induction in the range of 7897% in all inbred lines. The presence of L-proline and Casein hydrolysate in N6 modified medium may increase embryogenic callus formation and regeneration of maize (Register, 1994). The variation in embryogenic calli formation in different inbred lines showed that callus formation is genotype specific, in line with previous reports (Abe and Futsuhara, 1986; Hodges et al., 1986). An increase in sucrose concentration (6%) also increased the somatic embryo maturation when callus was transferred on RM-I. These results are in agreement with Kamo et al. (1985). It was observed that Inbred B-46 showed maximum response of callus induction (97.5 0.2) but failed to regenerate maximum number of calli (57.2 1.35%). In the case of inbred line BR-6, the callus induction response was less than B-46 but the regeneration efficiency was greater than B-46. The varying levels of regeneration of genotypes in different media showed that somatic embryogenesis and regeneration in maize is genotype specific and regeneration efficiency depends on media environment (Hodges et al., 1986; Suprasanna et al., 1994). Immature embryos are commonly used for transformation of monocotyledonous crops, like barley (Kartha et al., 1989) and maize (Koziel et al., 1993). In preliminary experiments, optimization distance for particle bombardment was determined and the maximum transient expression (based on GUS assay) of 53.3% was observed when embryos were bombarded from a distance of 15 cm. GUS coding sequence and reporter gene constructs are being used extensively in gene transfer technology of maize (Brettschneider et al., 1997). A transformation efficiency of 2.21% was calculated on the basis of hygromycin selection. A transformation efficiency of 13% is already reported in maize depending upon optimization parameters like DNA concentration, He pressure and distance for bombardment (Koziel et al., 1993; Brettschneider et al., 1997). Plants obtained on the basis of hygromycin (40 mg L 1) selection were considered as putative transgenic as hygromycin is extensively used for selection of transformants (e.g. Khanna and Rania, 2002). The GUS assay revealed that the activity of this gene was observed in all parts of the plants. No endogenous activity was observed in untransformed tissues. Four plants were selected for detailed molecular analysis to confirm the molecular and agronomical expression of the introduced trait. Transgene integration in maize genome was studied through PCR and Southern DNA hybridization. Single digestion of the plasmid pCMAC was done to release the full cassette and to have an estimation of copy number. From the above results of transgenic plants, it was observed that the co-integration of GUS gene with hpt and cry1Ac genes was 85%. This co-integration may reach up to 100% for linked genes on a single vector (Cooley et al., 1995). ELISA and Western Blot analysis proved that the regenerated plants were stably transformed and expressing the cry1Ac gene. ELISA is usually used for the quantification of the toxin titer (Bashir et al., 2004; Bashir et al., 2005) but our aim was to

M. Rafiq et al. / South African Journal of Botany 72 (2006) 460466

465

confirm the expression. Western Blot analysis showed additional information about the size of expressed protein. Although molecular analysis revealed the complete information about the integration and stable expression of the gene into recipient genome, the most important part of the study was to check the resistance against lepidopteran insects. Although the bioassays were done only against army worms but it is known that the cry1Ac gene is active against all lepidopteran insects (Cannon, 1996) especially against corn borer (Estruch et al., 1994), so it could be concluded that these four transgenic lines could provide desired level of resistance against commercially important insects of maize under local environment. In summary, conditions for the regeneration of fertile transgenic plants of maize from immature embryos were optimized and the results showed that immature embryos could successfully be used for regeneration and transformation of local varieties of maize. Insecticidal cry1Ac gene has been successfully transformed and expressed in local inbred lines of maize. These inbred lines could successfully be used for the construction of hybrid combinations based on their combining ability information as demonstrated in the rice field (Tu et al., 2000). References
Abe, T., Futsuhara, Y., 1986. Genotype variability for callus formation and plant regeneration in rice. Theoretical and Applied Genetics 72, 510. Bashir, K., Husnain, T., Fatima, T., Riaz, N., Makhdoom, R., Riazuddin, S., 2004. Field evaluation and risk assessment of transgenic indica basmati rice. Molecular Breeding 13, 301312. Bashir, K., Husnain, T., Fatima, T., Latif, Z., Mehdi, A., Riazuddin, S., 2005. Novel indica Basmati line (B-370) expressing two unrelated genes of Bacillus Thuringiensis is highly resistant to two lepidopteran insects in the field. Crop Protection 24, 870879. Bennett, J., 1994. DNA-based techniques for control of rice insects and diseases: transformation, gene tagging and DNA fingerprinting. In: Teng, P.S., Heong, K.L., Moody, K. (Eds.), Rice Pest Science and Management. International Rice Research Institute, Los Banos, Philippines, pp. 147172. Bradford, M.M., 1976. A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of proteindyebinding. Analytical Biochemistry 72, 248254. Brettschneider, R., Becker, D., Lorz, H., 1997. Efficient transformation of scutellar tissue of immature embryos. Theoretical and Applied Genetics 94, 737748. Cannon, R.J.C., 1996. Bacillus thuringiensis use in agriculture: a molecular prospective. Biological Reviews 71, 561636. Chang, Y.F., 1983. Plant regeneration in vitro from leaf tissues derived from cultured immature embryos of Zea mays L. Plant Cell Reports 2, 183185. Chu, C.C., Wang, C.C., Sun, C.S., Msu, C., Yin, K.C., Chu, C.Y., Bi, F.Y., 1975. Establishment of an efficient medium for anther cultures of rice through comparative experiments on nitrogen sources. Scientia Sinica 18, 659668. Cooley, J., Ford, T., Christou, P., 1995. Molecular and genetic characterization of elite transgenic plants produced by electric discharge particle acceleration. Theoretical and Applied Genetics 90, 97104. Dellaporta, S.L., Wood, J., Hicks, J.B., 1983. SA plant DNA mini-preparation version II. Plant Molecular Reports 1, 1921. Estruch, J.J., Carozzi, N.B., Desai, N., Warren, G.W., Duck, N.B., Koziel, M.G., 1994. The expression of a synthetic cry1Ac gene in maize confers resistance to European corn borer. Proceedings, Insect Resistant Maize: Recent Advances and Utilisation, 27 Nov3 Dec. CIMMYT, Mexico City, Mexico, pp. 172174. Fromm, M.E., Morrish, F., Armstrong, C., Williams, R., Thomas, J., Klein, T.M., 1990. Inheritance and expression of chimeric genes in the progeny of transgenic maize plants. Bio/Technology 8, 833839.

Gamborg, O.L., Millar, R.A., Ojima, K., 1966. Nutrient experiment of suspension cultures of soybean root cells. Experimental Cell Research 50, 151158. Golovkin, M.V., Abraham, M., Morocz, S., Bottka, S., Feder, A., Dudits, D., 1993. Production of transgenic maize plants by direct DNA uptake into embryogenic protoplast. Plant Sciences 90, 4152. Green, C.E., Phillips, R.L., 1975. Plant regeneration from tissue culture of maize. Crop Sciences 15, 417421. Green, C.E., Rhodes, L.A., 1982. Plant regeneration in tissue culture of maize. In: Sheridan, W.F. (Ed.), Maize for Biological Research. Plant Molecular Biology Association, Charlottesville, Va, pp. 367372. Harms, C.T., Lorz, K.H., Potrykus, I., 1976. Regeneration of plantlets from callus cultures of Zea mays L. Zeitschrift fur Pflanzensuchtg 77, 347351. Hodges, T.K., Kamo, K.K., Imbrie, C.W., Becwar, M.R., 1986. Genotype specificity of somatic embryogenesis and regeneration in maize. Bio/ Technology 4, 219223. Hoftey, H., Whitely, H.R., 1989. Insecticidal crystal protein of Bacillus thuringiensis. Microbiology Review 53, 242255. Husnain, T., Malik, T., Riazuddin, S., Gordon, M.P., 1994. Studies on the expression of marker gene in chickpea (Cicer arietinum L.). Plant Cell, Tissue and Organ Culture 49, 716. Husnain, T., Khanum, F., Riazuddin, S., Gordan, M.P., 1995. Transformation of Basmati rice (Oryza sativa Linn) with bacterial genes by particle bombardment. Pakistan Journal of Plant Sciences 1, 219228. Husnain, T., Malik, T., Riazuddin, S., 1997. Studies on expression of marker genes in chickpea. Plant Cell, Tissue and Organ Culture 49, 716. Husnain, T., Khanum, F., Fatima, T., Khan, S., Riazuddin, S., Altosaar, I., 1998. Transformation of indica with synthetic cry1Ac gene. Biologia 44, 180192. James, C., 2002. Global Status of Commercialized Transgenic Crops: ISAAA Briefs. Preview, vol. 24. ISAAA, Ithaca, NY. Jefferson, R.A., Kavanagh, T.A., Bevan, M.V., 1987. GUS fusions: betaglucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO Journal 6, 39013907. Kamo, K.K., Hodges, T.K., 1987. Establishment and characterization of long term maize callus and cell suspension cultures. Plant Sciences 45, 111117. Kamo, K.K., Michael, R., Becwar, M.R., Hodges, T.K., 1985. Regeneration of Zea mays L. from embryogenic callus. Botany Gazette 146, 327334. Kartha, K.K., Chibbar, R.N., Georges, F., Leung, N., Caswell, K., Kendall, E., Qureshi, J., 1989. Transient expression of Chloramphencol Transferase (CAT) gene in barley cell cultures and immature embryos by microprojectile bombardment. Plant Cell Reports 8, 429432. Khan, Z.R., Litsinger, J.A., Barrion, A.T., Villanueva, F.F.D., Fernandez, N.J., Taylor, L.D., 1991. World Bibliography of Rice Stem Borers, IRRI Los Baos, Philippines, pp. 17941990. Khan, M.A., Mukhdoom, R., Hussnain, T., Saleem, M.Z., Malik, K., Latif, Z., Altossar, I., Riazuddin, S., 2003. Expression of Bt gene in a dicot plant under promoter derived from a monocot plant. PJBS 4, 15181522. Khanna, H.K., Rania, S.K., 2002. Elite Indica transgenic rice plants expressing modified cry1Ac endotoxins of Bacillus thuringiensis show enhanced resistance to yellow stem borer (Scirpophaga incertulas). Transgenic Research 11, 411423. Koziel, M.G., Belang, G.L., Bowman, C., Carazzi, N.B., Crenshaw, R., Crassland, L., Dawson, J., Desi, N., Hill, M., Kadwell, S., Launis, K., Maddox, D., Mcpherson, K., Meghji, M.R., Merlin, E., Rhodes, R., Warren, G.W., Wright, M., Evola, S.V., 1993. Field performance of elite transgenic maize plants expressing an insecticidal protein derived from Bacillus thuringiensis. Bio/Technology 11, 194200. Linsmaier, E.M., Skoog, F., 1965. Organic growth factor requirements of tobacco tissue cultures. Physiologia Plantarum 18, 100127. Majeed, A., Husnain, T., Riazuddin, S., 2000. Transformation of virus resistant genotype of Gossypium hirsutum L. with pesticidal gene. Plant Biotechnology 17, 105110. Maqbool, S.B., Husnain, T., Raizuddin, S., Christou, P., 1998. Effective control of yellow rice stem borer and rice leaf folder in transgenic rice indica varieties Basmati 370 and M 7 using novel -endotoxin cry2A Bacillus thuringiensis gene. Molecular Breeding 4, 501507. Mazier, M., Pannetier, C., Tourneur, J., Jouanin, L., Giband, M., 1997. Expression of Bacillus thuringiensis toxin genes in plant cells. Biotechnology Annual Review 3, 313347.

466

M. Rafiq et al. / South African Journal of Botany 72 (2006) 460466 Tu, J., Zhang, G., Datta, K., Xu, C., He, Y., Zhang, Q., Khush, G.S., Datta, S.K., 2000. Field performance of transgenic elite commercial hybrid rice expressing Bacillus thuringiensis -endotoxin. Nature Biotechnology 18, 11011104. Walters, D.A., Vetsch, C.S., Potts, D.E., Lundquist, R., 1992. Transformation and inheritance of a hygromycin phosphotransferase gene in maize plants. Plant Molecular Biology 18, 189200. Williams, W.P., Sager, J.B., Hanten, J.A., Davis, F.M., Buckley, P.M., 1997. Transgenic corn evaluated for resistance to fall armyworm and southwestern corn borer. Crop Science 37, 957962. Zhong, H., Srinicasan, C., Sticklen, M.B., 1992. In vitro morphogenesis of corn (Zea mays L.). Differentiation of multiple shoot clumps and somatic embryos from shoot tips. Planta 187, 483489.

Murashige, T., Skoog, F., 1962. A revised medium for rapid growth and bioassay with tobacco tissue cultures. Physiologia Plantarum 15, 473497. NRC (National Research Council, USA), 2000. Genetically Modified Pest Protected Plants: Science and Regulation. Natl. Acad. Press, Washington, D.C. Oerke, E.C., Dehne, H.W., Schnobeck, F., Weber, A., 1994. Crop Production and Crop Protection: Estimated Losses in Major Food and Cash Crops. Elsevier, Amsterdam, Netherlands, p. 808. Register, J.C., 1994. Structure and function of selectable and non-selectable transgenes in maize after introduction by particle bombardment. Plant Molecular Biology 25, 951961. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press, New York, USA. Suprasanna, P., Rao, K.V., Reddy, G.M., 1994. Embryogenic callus in maize: genotypic and amino acid effects. Cereal Research Communication 22, 7982.