Professional Documents
Culture Documents
answers. I have to ask myself Why did Tam Tam (Van Eeden) disappear? Is he dead? Did he realize he'd reached the wrong conclusions? Or did he have nothing new to offer and called it quits? I'd have a lot more confidence in his findings, if he were still out there so to speak, for better or worse. Rose] [I agree with Dr. Stricker in San Francisco. Morgellons or Silent Superbug or whatever name you prefer IS NOT CONTAGIOUS !!! If it were, a lot more people would be sick and there would be a national, international uproar. Insect Bite or Arachnid Bite or And I wonder if there isn't something unusual about the genetics of the Morgellons population. I'm no expert, but I suppose Morgellons could mutate into something contagious to general population, but I'm just speculating. Rose] [I gather the following searchable text, well, precisely for that reason. Someone more knowledgeable than I could do a more comprehensive job. This is rather hit or miss. And I just don't like it when pages disappear from the Web.] [I'm not sure what Tam Tam is inferring here. Silent Superbug (Morgellons) is also a cyanobacterium? And these mitochondria are from human cells? As in man-made in a laboratory by mad scientists, then unintentional release?]
http://web.archive.org/web/20070924122109/http://silentsuperbug-reference.blogspot.com/ 5 captures 24 Sep 07 - 9 Mar 13 24 Sep 07 -- Searchable Text SILENTSUPERBUG "Why did previous investigators not find well-defined mitochondria? I am convinced that these mitochondria are from human cells" (Karvita B. Ahluwalia, 2001) TOP IMAGE: Infection of Pleospora papaveracea on Papaver somniferum: Bacteria surrounding the penetration site of the P. papaveracea appressorium (left), and a P. papaveracea hyphae that has penetrated the abaxial surface of the poppy leaf via a stomate (right). (Bailey et al., see article listing) Copyright 2000 by The American Phytopathological Society / BOTTOM IMAGE: STRAIN CBL001 / INFECTION OF HUMAN SKIN WITH PHOMA sp. (ASSOCIATED WITH PLEOSPORA) **** APS / The American Phytopathological Society **** Biowarfare in the Andes / The labs are brewing up two types of killer fungi, Fusarium oxysporum (for use against marijuana and coca plants) and Pleospora papaveracea (to destroy opium poppies). **** Risks of Using Biological Agents to Eradicate Drug Plants "In hairy areas, the fungi grow around the hair shaft" **** PHAEOHYPHOMYCOSIS **** Synonym and Classification Data for Phoma spp. **** Phoma spp. **** DROUHET LECTURE / To make a virtue out of necessity STRAIN CBL001 CLASSIFICATION / FUNGAL LINEAGE
**** teleomorph, anamorph, holomorph and synanamorphs. **** TAXONOMY PHOMA **** TAXONOMY PLEOSPORALES **** TAXONOMY SPHEAOSPHERIA **** TAXONOMY AGROCYBE PEDIADES **** TAXONOMY FUSARIUM Ascomycota: Origin on microalgae and cyanobacteria. Very probable. **** 3318. Pleosporales Luttrell ex M.E. / Notes on ascomycete systematics **** 4324. Ascomycota / 4. Origin on microalgae and cyanobacteria. - Very probable. **** ARTICLE/ Phaeodaria/ PHAEOSPHAERIA spp. **** Bacterial chemotaxis: Rhodobacter sphaeroides and Sinorhizobium meliloti--variations on a theme? **** The teleomorph of the weakly aggressive segregate of Leptosphaeria maculans
**** A New Biotype of Phaeosphaeria sp. of Uncertain Affinity Causing Stagonospora Leaf Blotch Disease in Cereals in Poland METADATA SINCE MAY 28, 2007 FRAPPR! INTERNATIONAL SUPPORT SINCE MAY 28, 2007 **** Human Phaeohyphomycotic Osteomyelitis Caused by the Coelomycete Phomopsis Saccardo 1905: Criteria for Identification, Case History, and Therapy **** First report of subcutaneous phaeohyphomycosis of the foot caused by Phoma minutella. **** A deeply invasive Phoma species infection in a renal transplant recipient. **** Fungi: Phoma **** Phoma glomerata as a Mycoparasite of Powdery Mildew **** Phoma sojicola comb. nov. and other hyaline-spored coelomycetes ... **** First report of Phoma sorghina (Sacc.) **** PHOMA/ WWW.FORENSICA.COM **** ITS sequencing support for Epicoccum nigrum and Phoma epicoccina being the same biological species **** Some isolates originally identified as E. nigrum developed a "Phoma-like" pycnidial state **** Extracellular lipolytic activity in Phoma glomerata **** Freely cultural prevention of petit vert Fusarium wilt (Phoma bacteria) by soil disinfection by solar heat. **** Nomenclature Fact Sheet: Phoma andigena Turkensteen 1995 **** Nomenclatural Fact Sheet - Phoma crystalliniformis **** Registration of Ascochyta Blight and Fusarium Wilt Resistant CA2954 Kabuli Chickpea Germplasm **** Evidence of the production of silver nanoparticles via ... **** Phoma blights **** A PHOMA SP. THAT KILLS COMMON CRUPINA (CRUPINA VULGARIS) **** Biological, Ecological and... **** Identification of Sources of Resistance to Phoma medicaginis Isolates in Medicago truncatula SARDI Core Collection Accessions, and Multigene Differentiation of Isolates **** Clamidspora de Poma glomerata **** Check-list for scientific names of common parasitic fungi. Supplement Series 2c, d (additions and corrections): Fungi on field crops: pulse (legumes), forage crops (herbage legumes), vegetables and cruciferous crop **** PLANT PEST DIAGNOSTIC BRANCH ANNUAL REPORT 2003 **** NEW YORK TIMES: San Francisco to Offer Care for Every Uninsured Adult **** The first distribution, biomass and toxicity study of a newly established bloom of the colonial cyanobacteria Microcystis aeruginosa was conducted on October 15, 2003 in the upper San Francisco Bay Estuary. Microcystis aeruginosa was widely distributed throughout 180 km of waterways in the upper San Francisco Bay Estuary from freshwater to brackish water environments and contained hepatotoxic microcystins at all stations **** HILLARY ON HEALTH CARE **** OBAMA ON HEALTH CARE
CNN's Todd Benjamin interviews Andreas Kluth about Google's quick growth **** WATCH VIDEO: AFRAID OF GOOGLE ? **** ARTICLE: MYCOTOXINS CHLORINE DIOXIDE **** Controlling chloramines in indoor swimming pools **** CHLORINE DIOXIDE **** WHAT IS CHLORINE DIOXIDE **** Chlorine Dioxide was a pesticide used in federal decontamination responses to the anthrax spore bioterrorism attacks of October 2 **** HISTORY OF CHLORINE DIOXIDE **** NEW YORK TIMES: "Medicare Says It Wont Cover Hospital Errors" **** Doctors Offering No-Interest Loans to Patients **** Record Number of Americans Lack Health Insurance PROMISING TREATMENT PROTOCOL WITH NOVEL INTRODUCED POSACONAZOLE ? Therapy with Posaconazole $120 per day, median durance of therapy 105 day WATCH VIDEO! FDA APPROVES NOXAFIL ORAL SUSPENSION **** WATCH VIDEO! FDA APPROVES NOXAFIL ORAL SUSPENSION **** Focus on posaconazole: A novel triazole antifungal for the treatment of invasive fungal infections **** POSACONAZOLE /1 **** POSACONAZOLE /2 **** POSACONAZOLE /3 **** POSACONAZOLE /4 **** POSACONAZOLE /5 **** POSACONAZOLE /6 AUTOMATIC DOWNLOAD: Taxonomy, biology, and clinical aspects of Fusarium species. "serologic tests showed Fusarium, Aspergillus, and Candida antigens" Polycystic Kidney Disease: An Unrecognized Emerging Infectious Disease? ***** Fusarium Infections in Critically Ill Patients ***** Fungal and Parasitic Infections of the Eye ***** Trial of chlorhexidine gluconate for fungal corneal ulcers. ***** Randomised trial of 0.2% chlorhexidine gluconate and 2.5% natamycin for fungal keratitis in Bangladesh **** KEY ARTICLE: BIOFILMS EDITION JUNE 2007 / STRAIN CBL001: INTERFACE EMBRYOLOGY
DIFFERENTIAL: MAMMALIAN LIKE HAIR / PROGLOTTIDS (WATCH VIDEO EDITION JUNE, 2007) STRAIN CBL001 / FORMATION OF CHITIN LIKE CRYSTAL **** C. ELEGANS / CHITIN (https://fungalgenomics.concordia.ca/fungi/Cele.php) **** CHITIN / INDUSTRIAL **** CDC OF CENTER / SENATOR COBURN Human Pathogen From a Novel Group of Aquatic Protistan Parasites / PROGNOSIS BY FREDERICKS ET AL KEY ARTICLE: FREDERICKS ET AL / VETERANS AFFAIRS ***** FREDERICKS ET AL: ARCHIVED ARTICLES WILL SHOW UP MID PAGE ***** GULF WAR RELATED SYNDROME **** KEY ARTICLE / Genetic Identification of the Main Opportunistic Mucorales **** The First Find of Yeast-like Cells of Fusarium moniliforme and Mechanism of Infection Injury. **** Genetic diversity of human pathogenic members of the Fusarium oxysporum complex inferred from multilocus DNA sequence data and amplified fragment length polymorphism analyses: evidence for the recent dispersion of a geographically widespread clonal lineage and nosocomial origin **** Department of Infectious Diseases, Wilford Hall U.S. Air Force Medical Center, Lackland AFB, Texas 78236-5300 **** FUSARIUM: A SIGNIFICANT EMERGING PATHOGEN **** Endophthalmitis Caused by Fusarium proliferatum **** Linear mitochondrial plasmids of Fusarium oxysporum contain genes with sequence similarity to genes encoding a reverse transcriptase from Neurospora spp. USA Admits Possible Link / EUU Admite posible vnculo entre Armas Biolgicas y Agente Verde **** USA Admits Possible Link between Biological Weapons and Agent Green **** EEUU Admite posible vnculo entre Armas Biolgicas y Agente Verde Activities of Caspofungin, Itraconazole, posaconazole, Ravuconazole, Voriconazole, and... **** Activity of a new triazole, Sch 56592, compared with those of four other antifungal agents tested against clinical isolates of Candida spp. and Saccharomyces cerevisiae. **** Activities of Caspofungin, Itraconazole, Posaconazole, Ravuconazole, Voriconazole, and Amphotericin B against 448 Recent Clinical Isolates of Filamentous Fungi **** Combination of a cyclic hexapeptide with antifungal drugs for treatment of fungal pathogens **** FUNGUS TESTING LABORATORY **** universal in vitro antifungal resistance of genetic clades of the fusarium solani species complex **** Biotechnologys advance could give malefactors the ability to manipulate life processes -- and even affect human behavior. **** USA Admits Possible Link between Biological Weapons and Agent Green **** EEUU Admite posible vnculo entre Armas Biolgicas y Agente Verde
**** FIRST FIND OF YEAST LIKE CELL **** Risks of Using Biological Agents to Eradicate Drug Plants **** Fusarium Infections in Critically Ill Patients **** Invasive Infection with Fusarium chlamydosporum in a Patient with Aplastic Anemia **** Localized Cutaneous Hyalohyphomycosis Caused by a Fusarium Species Infection in a Renal Transplant Patient **** Molecular Identification of Fusarium Species in Onychomycoses **** Endophthalmitis Caused by Fusarium proliferatum **** Resolution of disseminated fusariosis in a child with acute leukemia treated with combined antifungal therapy: a case report (2007) **** Clinical and Epidemiological Aspects of Infections Caused by Fusarium Species: a Collaborative Study from Israel **** Disseminated hyalohyphomycosis caused by a novel human pathogen, Fusarium napiforme. **** A mysterious brain disease is killing birds, It is believed that a man-made... PURPLE FILAMENT/ N. LIMICOLA/ BALD EAGLE DEMISE/ avian vacuolar myelinopathy Investigation of a novel epiphytic cyanobacterium associated with.... **** Investigation of a novel epiphytic cyanobacterium associated with.... On R2A medium, all strains generally grew as short filaments or clumps of cocci, whereas on glucose sulfide (GS) medium, all grew as irregular twisting filaments comprising Gram-positive and Gramnegative cells, which is close to their in situ morphology SAN FRANCISCO BAY AREA WITH GOOGLE EARTH (bio-remediation/ sludge and waste water treatment) **** The first distribution, biomass and toxicity study of a newly established bloom of the colonial cyanobacteria Microcystis aeruginosa was conducted on October 15, 2003 in the upper San Francisco Bay Estuary. Microcystis aeruginosa was widely distributed throughout 180 km of waterways in the upper San Francisco Bay Estuary from freshwater to brackish water environments and contained hepatotoxic microcystins at all stations. MICROCYSTIN-LR / FAST DEATH FACTOR The microcystins are hepatotoxic products of freshwater blooms of cyanobacteria of Microcystis spp., M. aeruginosa in particular. Microcystin-LR, also known as the fast death factor, is the most common of the microcystins and presumably the toxin of choice to be weaponized. Although the aerosolized form of microcystin is the most likely threat, ingestion - even from natural sources - must be considered a significant hazard. MICROCYSTIS-LR / PATHOGENICITY **** Freshwater cyanobacterium Microcystis aeruginosa (UTEX 2385) induced DNA damage in vivo and in vitro **** Microcystin-LR induces oxidative DNA damage in human hepatoma cell line HepG2. **** Allergenic (sensitization, skin and eye irritation) effects of freshwater cyanobacteria experimental evidence SILENTSUPERBUG MICRO **** SILENTSUPERBUG MICRO STRAIN CBL001/ FILAMENT PRODUCTION IN HUMAN SKIN (SILENTSUPERBUG MICRO)
**** THE NOSTOCOIDA LIMICOLA STORY www.biosci.utexas.edu/graduate/plantbio/images/noblestree.jpg Tuesday, March 27, 2007 **** Uncultivable bacteria: Implications and recent trends towards identification Posted by http://silentsuperbug-reference.blogspot.com/ at 3:10 AM Older Posts STRAIN CBL001/ GENESIS IN HUMAN SKIN OF A BLUE PIGMENTED FILAMENT / ONYCHOLYSIS / INFILTRATION OF CBL001 IN NAIL BED (ARROW) STRAIN CBL001/ INFECTION/ SKIN GROOVE RIM RELATED GENESIS/ ACCUMULATION OF CBL001 IN EPIDERMIS SKIN ANATOMY **** understanding wounds STRAIN CBL001/ BLUE COLORED BIOFILM/ FALSE COLOR RENDITION / DISSEMINATION IN SKIN AND NAIL (SILENTSUPERBUG MICRO) STRAIN CBL001 / BLUE COLORED BIOFILM GENETICS OF BIOFILMS LABORATORY **** GENETICS OF BIOFILMS LABORATORY CBL001/ BLUE COLORED BIOFILM AND FILAMENT (3D, DYNAMIC AND DIVERSE ARTIFACT) IN HUMAN SKIN QUORUM SENSING VIDEO / ANIMATION ARCHIVE / http://www.learner.org/channel/courses/biology/textbook/microb/microb_9.html **** QUORUM SENSING VIDEO / The Biofilm Lifecycle / ANIMATION ARCHIVE **** Surface-active proteins enable microbial aerial hyphae to grow into the air **** Plants and animals both listen to and disrupt bacterial quorum sensing signaling, prompting interest in mechanisms, applications **** Quorum sensing and bacterial cross-talk in biotechnology **** Slimy businessthe biotechnology of biofilms **** Bacterial Quorum Sensing in Pathogenic Relationships **** MicroMeeting **** Bugging the Bugs **** Quorum Sensing in Bacteria: We Two Are One **** MICROBES, IMMUNITY, AND DISEASE: A Symphony of Bacterial Voices **** Dialogs With Bacteria: Quorum Sensing
**** Revisiting quorum sensing: Discovery of additional chemical and biological functions for 3-oxoN-acylhomoserine lactones **** Molecular structure is solved for key protein of quorum-sensing bacteria **** Quorum-sensing bacteria discovery **** Bacterial quorum sensing (QS) Three other agents, which, like R. seeberi, reproduce by endosporulation include Coccidioides sp., Prototheca sp. and Chlorella sp. Of these, Coccidioides sp. may be the most difficult to differentiate. Prototheca is an achlorophyllic mutant of the green alga Chlorella. The Genus Prototheca was described in 1894 by Kruger to designate a group of non-pigmented unicellular organisms isolated from the mucous flux of trees. Based on a yeast like appearance in culture, early investigators, including Kruger (1849 a, b) considered the organism to be a fungus. This view was generally accepted until West (1916) directed attention to its alga-like mode of reproduction. Unlike most yeasts, Prototheca does not propagate by budding, but by internally produced spores which are morphologically identical to the parent cell. This method of sporulation is indistinguishable from that observed in the green alga chlorella. Based on this observationWest (1916) classified the organism in the chlorophyaceae. Source: Protothecosis - Algal infection, Bernard F. Fetter, Gordon K. Klintworth, and Harry S. Nielsen, Jr Durham/ North Carolina, USA. Cultural Morphology: On solid media, isolates of Prototheca are similar to many yeasts or yeast like fungi. cultures vary from white to cream colored and may be smooth, wrinkled, or pasty depending upon the strain. In diagnostic laboratory, the organism must be distinguished from species of candida and cryptococcus, and to a lesser extent from the yeast forms of Histoplasma and Blastomyces. Alternative formulation: "At first sight Prototheca can be confused with Lacazia loboi, Coccidioides immitis, Pneumocystis carinii, Histoplasma duboisii and Blasto-myces dermatitidis ... New terminology versus old terminology NEW terminology: MESOMYCETOZOA. OLD terminology: The phylogeny of Rhinosporidium seeberi still seems to be somewhat controversial in the literature. Formerly, R. seeberi was classified as a fungus. Recently, based on polymerase chain reaction analysis of its 18S rRNA gene, it has been suggested to be a member of the DRIPs clade, a novel clade of aquatic protistan parasites. The DRIPs clade obtains its name from the other organisms classified in this group: Dermocystidium spp., Rosette Agent, Ichthyophonus spp., and Psorospemium spp., however the term Ichthyosporea has been proposed for future taxonomy of this group of microbes. Based on recent PCR analysis the Dermocystidium genus appears to be the nearest phylogenetic relative to R. seeberi. MESOMYCETOZOA / R. Seeberi / Pathogenicity **** A case of coccidioidal fungemia initially diagnosed as rhinosporidiosis **** Lymphadenitis, trans-epidermal elimination and unusual histopathology in human rhinosporidiosis **** Cell-mediated immune responses (CMIR) in human rhinosporidiosis **** RHINOSPORIDIOSIS PRESENTING WITH TWO SOFT TISSUE TUMORS FOLLOWED BY DISSEMINATION **** Rhinosporidiosis **** Recent advances in rhinosporidiosis and rhinosporidium seeberi NOVEL PROTOTHECA = MESOMYCETOZOEA **** Identification of a unicellular, non-pigmented alga that mediates growth inhibition in anuran tadpoles: a new species of the genus Prototheca (Chlorophyceae: Chlorococcales) **** Mitochondrial genes in the colourless alga Prototheca wickerhamii resemble plant genes in their exons but fungal genes in their introns. PNEUMOCYSTIS CARINII (renamed P. jiroveci) **** Pneumocystis and Trypanosoma cruzi: Nomenclature and Typifications
**** A New Name (Pneumocystis jiroveci) for Pneumocystis from Humans **** Pneumocystis carinii: Taxing taxonomy **** Analysis of gene sequences has also revealed that P. carinii is not a single entity but that the genus Pneumocystis contains a complex group of organisms. **** DNA sequences identical to Pneumocystis carinii f. sp. carinii and Pneumocystis carinii f. sp. hominis in samples of air spora **** Pathology of AIDS/ 2006/ context P.Carinni, coccidioidomycosis etc. SELF ASSEMBLY / EXTRA CELLULAR MATRIX / SIGNALLING **** Evidence for Recombination in the Microcystin Synthetase (mcy) Genes of Toxic Cyanobacteria Microcystis.spp **** The significance of the aromatic-glycine motif **** Systematic survey on crystalline features of algal celluloses **** Isolation, Characterization, and Quantitative Analysis of Microviridin J, a New Microcystis Metabolite Toxic to Daphnia **** Signalling through cyclic nucleotide monophosphates in cyanobacteria **** A mannan binding lectin is involved in cellcell attachment in a toxic strain of Microcystis aeruginosa MICROCYSTIS / CHLORELLA / P. CARINNII **** Analysis of Pneumocystis carinii cyst wall. I. Evidence for an outer surface membrane. **** Studies on ribonucleic acids from Chlorella protothecoides **** A chitin-like glycan in the cell wall of a Chlorella sp. **** Self-splicing group I introns in eukaryotic viruses. **** Sporopollenin in the cell wall of Chlorella and other algae: Ultrastructure, chemistry, and incorporation of 14C-acetate, studied in synchronous cultures **** Variant forms of a group I intron in nuclear small-subunit rRNA genes of the marine red alga Porphyra spiralis var. amplifolia **** Pathologic Quiz Case: Unremitting Ulcer in a Scuba Diver **** Relationship among Several Key Cell Cycle Events in the Developmental Cyanobacterium Anabaena sp. Strain PCC 7120 **** Translation elongation factor-3 (EF-3): An evolving eukaryotic ribosomal protein? MESOMYCETOZOEA **** The two Dermocystidium species resemble Rhinosporidium **** The pathogen of frogs Amphibiocystidium ranae is a member of the order dermocystida in the class mesomycetozoea **** Prototheca richardsi, a pathogen of anuran larvae, is related to a clade of protistan parasites near the animal--fungal divergence **** Parasitism by Dermocystidium ranae **** Phylogenetic Position and Ultrastructure of Two Dermocystidium ... **** Observations on the Life Stages of Sphaerothecum destruens n. g., n. sp., a Mesomycetozoean Fish Pathogen Formally Referred to as the Rosette Agent COCCIDIOIDOMYCOSIS / PNEUMOCYSTIS / EMERGING TB **** A case of coccidioidal fungemia initially diagnosed as rhinosporidiosis **** Coccidioidomycosis: A Regional Disease of National Importance: Rethinking Approaches for Control **** C. IMMITIS / 1 **** C. IMMITIS / 2 **** C. IMMITIS / 3 **** In vitro inhibitory effect of antituberculosis drugs on clinical and environmental strains of Coccidioides posadasii
**** Molecular and phenotypic description of Pneumocystis wakefieldiae sp. nov., a new species in rats RANDOM ACCESS **** Differentiation between Prototheca and morphologically similar green algae in tissue. **** Lacazia Loboi and Rhinosporidium seeberi; a genomic perspective **** E. CRESCENS **** Nature and significance of the electron-dense bodies of the endospores of Rhinosporidium seeberi **** Phylogenetic Analysis of Rhinosporidium seeberi **** A new rubisco-like protein coexists with a photosynthetic rubisco in the planktonic cyanobacteria Microcystis. **** Parasitism by Dermocystidium ranae in a population of Rana esculenta complex in Central Italy and **** Algae as Tools in the Study of Cellulose **** Rhinosporidium seeberi: A Human Pathogen From a Novel Group of Aquatic Protistan Parasites **** Phylogenetic Analysis of Rhinosporidium seeberi's 18S Small-Subunit Ribosomal DNA Groups This Pathogen among Members of the Protoctistan Mesomycetozoa Clade **** Algological and bacteriological investigations on reed periphyton in Lake Velencei, Hungary **** Altered expression of two light-dependent genes in a microcystin-lacking mutant of Microcystis aeruginosa PCC 7806. **** Evidence for recombination in the microcystin synthetase **** INOCULATION OF BALB/C MICE WITH Lacazia loboi **** Release of Extracellular Transformable Plasmid DNA from Escherichia coli Cocultivated with Algae **** Report of the First Human Case of Lobomycosis in the United States **** The occurrence of self-splicing group I introns in viruses that infect the eukaryotic green alga Chlorella **** Transcription and in vivo expression of a Microcystis aeruginosa plasmid **** Fungal and Parasitic Infections of the Eye **** Recreational and occupational field exposure to freshwater cyanobacteria a review of anecdotal and case reports, epidemiological studies and the challenges for epidemiologic assessment SYSTEMATIC http://ijs.sgmjournals.org/cgi/reprint/55/1/487.pdf **** THE INFORMED READER / DISEASE OR DELUSION? **** ARTICLE: Clinton on Health Care, Take 2: **** THE NEW YORK TIMES **** Clinton Unveils Health Care Plan **** Iraq Weapons Are a Focus of Criminal Investigations **** Useful Mutants, Bred With Radiation STRAIN CBL001 / ITS SEQUENCE: Phoma.sp QUICK DETAIL
The abbreviation (sp.) used after a genus name refers to an undetermined species; (spp.) after a genus name refers to several species without naming them individually. INFECTION WITH FUSARIUM: RED COLOR: STATES REPORTING SUSPECTED CASES OF FUSARIOSIS / BLUE COLOR: UNDER INVESTIGATION STRAIN CBL001 / INTERFACE DERMATOLOGY STRAIN CBL001 / INTERFACE PLANT AND INSECT CELL TECHNOLOGY STRAIN CBL001 / INTERFACE MYCOLOGY AND CRYSTALLOGRAPHY STRAIN CBL001 / INTERFACE MYCOLOGY STRAIN CBL001 / INTERFACE MYCOLOGY STRAIN CBL001 / INTERFACE MICROBIOLOGY STRAIN CBL001 / INTERFACE PARASITOLOGY STRAIN CBL001 / INTERFACE MYCOLOGY AND EMBRYOLOGY FDA / REPORT INFECTION WITH FUSARIUM ***** The Centers for Disease Control (CDC) and the Food and Drug Administration (FDC) are investigating to find out what contributing factors or products are behind this fungus. Both agencies are interested in obtaining as much information as possible related to fungal keratitis. They are encouraging people to report these infections to the FDA who will be sharing this information with the CDC. Submit reports to MedWatch at 1-800-FDA-1088 or by FAX at 1-800-FDA-0178 STRAIN CBL001 / INTERFACE DERMATOLOGY: FUSARIUM SPP. INCORPORATED / BLUE FILAMENT FORMATION IN HUMAN SKIN, NAIL AND NAIL BED THE MYSTERIOUS RELATIONSHIPS OF RHINOSPORIDOSIS SEEBERI **** THE MYSTERIOUS RELATIONSHIPS OF RHINOSPORIDOSIS SEEBERI STRAIN CBL001 / INTERFACE MYCOLOGY STRAIN CBL001 / INTERFACE MYCOLOGY: FUSARIUM SPP. INCORPORATED / INTERFACE DERMATOLOGY: DISTAL ONYCHOLYSIS WITH FORMATION OF FILAMENTOUS ARTIFACTS CAUSATIVE AGENT OF RHINOSPORIDOSIS IS MICROCYSTIS SP. ? **** Why did previous investigators not find well-defined mitochondria? I am convinced that these mitochondria are from human cells **** SILENTSUPERBUG VIDEO1 and VIDEO2 **** SILENTSUPERBUG KEY ARTICLES **** SILENTSUPERBUG POLITICAL **** SILENTSUPERBUG ECOLOGY **** SILENTSUPERBUG PLANT AND INSECT CELL TECHNOLOGY **** SILENTSUPERBUG UNEDITED REFERENCE VIDEO **** SILENTSUPERBUG MICROSCOPY / DERMATOPATHOLOGY
antennapedia MUTANT FRUIT FLIES **** MUTANT FRUIT FLIES A Practical Guide and Manual for Human Hairs A Practical Guide and Manual for Human Hairs **** A Practical Guide and Manual for Human Hairs Algae bloom killing wildlife off California coast Bee deaths spark food crisis fear "Scientists fear catastrophic losses" **** THURSDAY / MAY 3, 2007 / Bee deaths spark food crisis fear **** MONDAY / APRIL 30, 2007 / Scientists fear catastrophic losses **** FRIDAY / APRIL 27, 2007 / Algae bloom killing wildlife off California coast **** WASHINGTON (CNN) -- Beekeepers throughout the United States have been losing between 50 and 90 percent of their honeybees over the past six months, perplexing scientists **** Humans Making Wildlife Sick SUSPECTED CASE / COURTESY Mrs. SABRINA, PITTSBURGH, USA **** THE NEW YORK TIMES TODAY **** In the Amazon, Giving Blood but Getting Nothing **** Psychiatrists, Children and Drug Industrys Role. **** Industrys Role in Childrens Antipsychotics **** Doctors Reap Millions for Anemia Drugs **** F.D.A. Limits Role of Advisers Tied to Industry **** Doctors and Drug Makers: A Move to End Cozy Ties **** Minnesota records provide a window on the financial ties between drug companies and the doctors who prescribe their products. http://www.cplbookshop.com/images/0890543356.jpg Emerging (unusual nosocomial) Infections **** Epidemiology and Clinical Aspects of Unusual Fungal Nosocomial Infections **** Fungal and Parasitic Infections of the Eye **** In-vitro antifungal susceptibility of clinical and environmental Fusarium spp. strains **** Cutaneous Infection by Fusarium Species in Healthy and Immunocompromised Hosts: Implications for Diagnosis and Management **** Fatal disseminated fusarium infection in acute lymphoblastic leukaemia in complete remission **** Fusarium Outbreak: Lessons Learned **** The effect of propyl gallate on the activity of various antifungal drugs against filamentous fungi in vitro] **** Fusarium, a Significant Emerging Pathogen STRAIN CBL001/ BIOFILM / FILAMENT PRODUCTION IN HUMAN SKIN (SILENTSUPERBUG MICRO)
CENTRE OF EXCELLENCE IBAES/ FILAMENT PRODUCTION IN WASTE WATER HYPERION TREATMENT PLANT (PLAYA DEL REY, CALIFORNIA) "A NEW WAY TO LOOK AT FILAMENTS" **** A NEW WAY TO LOOK AT FILAMENTS **** 'Candidatus Nostocoida limicola', a filamentous bacterium from.... **** What's New ? **** Tetracycline resistance genes in activated sludge wastewater treatment plants **** MICROORGANISMS AND THEIR ROLE IN THE ACTIVATED-SLUDGE PROCESS *** CENTRE OF EXCELLENCE IBAES **** "If anything unusual happens, the filamentous/microorganism identification support system starts" **** Practical Control Methods For Activated Sludge Bulking and Foaming **** Investigation of Microorganisms Associated with the Foam of a Submerged Membrane Bioreactor in Japan **** Bioaugmentation of Activated Sludge by an Indigenous 3-Chloroaniline-Degrading Comamonas testosteroni Strain, I2gfp **** Isolation and cultivation of filamentous bacteria implicated in... **** Identity and Ecophysiology of Uncultured Actinobacterial Polyphosphate-Accumulating Organisms in Full-Scale Enhanced Biological Phosphorus Removal Plants Cellular fatty acids as chemotaxonomic markers of the genera.... **** Cellular fatty acids as chemotaxonomic markers of the genera Anabaena, Aphanizomenon, Microcystis, Nostoc and Planktothrix (cyanobacteria) **** The clade containing filamentous heterocystous cyanobacteria was divided into three discrete groups of.... ARTICLE: Ecophysiology of Marine Cyanobacterial Blooms Ecophysiology of Marine Cyanobacterial Blooms **** Ecophysiology of Marine Cyanobacterial Blooms GENERAL INTRODUCTION **** Ecophysiology of Marine Cyanobacterial Blooms **** Recreational and occupational field exposure to freshwater cyanobacteria a review of anecdotal and case reports, epidemiological studies and the challenges for epidemiologic assessment GAS VACUOLES, ELECTRON-DENSE BODIES AND VIRUS **** The result of electron microscopic investigation of gas-vacuoles in a culture of the benthal alga Oscillatoria chalybea was compared with the extensive literature concerning gas-vacuole formation and virus infection in bacteria and animals. **** Gas vesicle proteins **** Nauture and significance of the electron-dense bodies.... CLASSIFICATION **** Molecular characterization of planktic cyanobacteria of Anabaena, Aphanizomenon, Microcystis and Planktothrix genera **** Quantitative Real-Time PCR Detection of Toxic Nodularia Cyanobacteria in the Baltic Sea **** A proposal for the unification of five species of the cyanobacterial genus Microcystis Kutzing ex Lemmermann 1907 under the Rules of the Bacteriological Code
**** A proposal for further integration of the cyanobacteria under the Bacteriological Code **** PARTIGENE.DB.STATISTICS **** TAXONOMY BROWSER **** PUREAIRCONTROLS MICROCYSTIS **** Discovery of Rare and Highly Toxic Microcystins from Lichen-Associated Cyanobacterium Nostoc sp. Strain IO-102-I **** Cyanobacterial peptides Nature's own combinatorial biosynthesis **** Genetic identification of microcystin ecotypes in toxic cyanobacteria of the genus Planktothrix **** Inferring the Molecular Phylogeny of Chroococcalian Strains **** Random amplified polymorphic DNA (RAPD) analyses for discriminating genotypes of Microcystis cyanobacteria. **** Microcystin Biosynthesis in Planktothrix: Genes, Evolution, and Manipulation **** The genus Microcystis (Microcystaceae/Cyanobacteria) from a Spanish reservoir: A contribution to the definition of morphological variations **** Phycoerythrincontaining Microcystis isolated from P.R. China and Thailand **** Rapid typing and elucidation of new secondary metabolites of intact cyanobacteria using MALDI-TOF mass spectrometry **** Quantitative Detection of Toxic Strains of the Cyanobacterial Genus Microcystis by Competitive PCR **** Transposons Inactivate Biosynthesis of the Nonribosomal Peptide Microcystin in Naturally Occurring Planktothrix spp. STRAIN CBL001/ PLANT AND INSECT CELL TECHNOLOGY INCORPORATED ARCHIVE (ARCHIVED ARTICLES WILL SHOW UP MID PAGE !) 2007 (55) January (50) **** The Armed Forces Institute of Pathology 2001 ... **** Microcystis as causative agent of Rhinosporid... **** Pathogenic Fungi: Structural Biology and Taxo... **** Nature and significance of the electron-dens... **** Phylogenetic Analysis of Rhinosporidium seebe... **** The Armed Forces Institute of Pathology 2002-... **** Evidence for recombination in the microcystin... **** Transcription and in vivo expression of a Mic... **** A note on ribosomes in cells of Chlorella pro... **** The characterization of pMa025, a plasmid iso... **** Release of Extracellular Transformable Plasmi... **** Lacazia Loboi and Rhinosporidium seeberi; a g... **** Rhinosporidium, is it still a fungus? **** Variant forms of a group I intron in nuclear ... **** Self-splicing group I introns in viruses that... **** Non-Watson Crick base pairs might stabilize R... **** Algae as tools in studying the biosynthesis o... **** Systematic survey on crystalline features of ... **** Structural organization of microcystin biosyn... **** Altered expression of two light-dependent... **** Diversity of microcystin genes within a popul...
**** A new rubisco-like protein coexists with a ph... **** First report of a microcystin-containing bloo... **** Rhinosporidium seeberi. An ultrastructural st... **** Rhinosporidiosis 2 **** Rhinosporidiosis 1 **** Human anti-rhinosporidial antibody does not c... **** Roles of microtubules and cellulose microfibr... **** On the alignment of cellulose microfibrils by... **** Report of the First Human Case of Lobomycosis... **** Reclassification, Lacazia loboi gen. nov., co... **** Phylogenetic Analysis of Lacazia loboi Places... **** The taxonomic status of Lacazia loboi and Rhi... **** Comparative morphology of Lacazia loboi (syn.... **** Characterization of pMa025, a plasmid from th... **** Unusual Fungal and Pseudofungal Infections of... **** Fungal and Parasitic Infections of the Eye **** Rhinosporidium seeberi: A Human Pathogen From... **** Recreational and occupational field exposure ... **** rosette agent 1 **** The rosette agent 2 ***** THE CLASS MESOMYCETOZOEA: A Heterogeneous Gr... **** Rhinosporidiosis: what is the cause? **** DISEASES OF AQUATIC ORGANISMS **** Cyanobacterial lipopolysaccharides and human ... **** Sporopollenin in the cell wall of Chlorella a... **** 8th Cyanobacterial Molecular Workshop **** Analysis of Pneumocystis carinii cyst wall. I... **** Identification of a unicellular, non-pigmente... **** Ecophysiology of Marine Cyanobacterial Blooms... February (1) March (4)
(1)"While environmental SERRATIA MARCESCENS strains are often red, due to the production of prodigiosin, the strains associated with hospital outbreaks are mostly non-pigmented." "NEUROSPORA CRASSA" is a pinkish to red mold but is not as common and is generally lighter in color then Serratia marcescens." "NEUROSPORA CRASSA" , is a central organism in the history of twentieth-century genetics, biochemistry and molecular biology.
Archived Article/ March 26, 2010 (Atlanta, Georgia) March 26, 2010 (Atlanta, Georgia) Nasal application of 2% mupirocin and bleach baths were found to be more effective at eradicating Staphylococcus aureus colonization than other interventions, according to the findings of a randomized trial.
Serratia Marcescens.(SM) Synonomy: Chromobacter prodigiosus, Bacterium prodigiosus, Micrococcus prodigiosus, Serratia marcescens Bizio, Zaogalactina imetropha Sette, Monas prodigiosa Ehrenberg, Palmella prodigiosa Montagne, Micrococcus prodigiosus Cohn, Bacillus prodigiosus Fluegge, Bacillus imetrophus Trevisan, Bacillus marcescens De Toni and Trevisan, "Serratia marcescens, previously called Chromobacterium prodigiosum" **** American Society for Microbiology / Infection and Immunology / Serratia
**** Biotyping of Serratia marcescens and its use in epidemiological studies. **** HEALTH EFFECTS OF PROJECT SHAD BIOLOGICAL AGENT: SERRATIA MARCESCENS **** KARGER **** Biofilm Formation and Sloughing in Serratia marcescens **** J.P. Euzby: List of Prokaryotic names with Standing in Nomenclature - Genus Serratia **** ION CHANNEL **** LABOME.org **** NCBI / Entry/ Serratia **** DSMZ **** Hopkins/ Serratia species **** DOE Genome Projects (06-Oct-2010) **** phage (wIF3) **** phiIF3 Serratia marcescens/ putative reference strain Db11
NO MERCY FOR MRSA / TREATMENT ALTERNATIVES/ Adjunctive Use Rifampin **** NO MERCY FOR MRSA: treatment alternatives to vancomycin and linezolid **** Adjunctive use of rifampin for the treatment of Staphylococcus aureus infections: a systematic review of the literature MRSA/ GREEN TEA/ Epigallocatechin Gallate **** Green Tea to fight MRSA? **** Additive, indifferent and antagonistic effects in combinations of epigallocatechin gallate with 12 non--lactam antibiotics against methicillin-resistant Staphylococcus aureus **** Mechanism of Synergy between Epigallocatechin Gallate and -Lactams against MethicillinResistant Staphylococcus aureus **** The Effect of Green Tea on the Growth and Morphology of Methicillin-resistant and Methicillinsusceptible Staphylococcus aureus CA-MRSA/ MRSA/ MSSA **** JAMA **** Genetic transfer in Staphylococcus: a case study of 13 genomes **** Use of Oligoarrays for Characterization of Community-Onset Methicillin-Resistant Staphylococcus aureus **** Genetic Changes That Correlate with Reduced Suceptibility to Daptomycin in Staphylococcus aureus **** Heterogeneity of Methicillin-Susceptible Staphylococcus aureus Strains at a German University
Hospital Implicates the Circulating-Strain Pool as a Potential Source of Emerging Methicillin-Resistant S. aureus Clones **** Laborotory Detection of Extended-Spectrum B-Lactamases (ESBLs) **** Community-acquired methicillin-resistant Staphylococcus aureus carrying Panton-Valentine leukocidin genes: WORLDWIDE EMERGENGE. **** Professional Report/ OCTENISAN **** Susceptibility of MRSA to octenidine dihydrochloride **** Studies on the Efficacy of Octenidine Dihydrochloride and Octenisan
Your Insect Bite Might be Staph! **** Hospitalizations and Deaths Caused by Methicillin-Resistant Staphylococcus aureus, United States, 19992005 **** Subtle genetic changes enhance virulence of methicillin resistant and sensitive Staphylococcus aureus **** Powerful strains of MRSA are beginning to break out of hospitals into the community. **** Community-associated MRSA: Superbug at our doorstep **** "As amoeba produce cysts to help them spread, this could mean that MRSA maybe able to be 'blown in the wind' between different locations" "This makes matters even more worrying," WHITE HOUSE CUT TESTIMONY **** NEW YORK TIMES / Infection Killed Almost 19,000 in 2005, Study Says **** REDIRECTED / CNN / Sources: White House cut testimony / "It was eviscerated", said a CDC official, familiar with both versions, who spoke on condition of anonymity because of the sensitive nature of the review process. **** Dermatology Times / April 01, 2002/ CDC downplays "mystery rash" link **** AP / 09/17/07/ Mysterious outbreak at Houston school scares parents, teachers **** MIT / TECHNOLOGY REVIEW / Biotechnologys advance could give malefactors the ability to manipulate life processes -- and even affect human behavior. **** WATCH VIDEO! CYANOBACTERIA **** WATCH VIDEO! BROWN ALGAE (PHAEOPHYCEAE = PLEOSPORALES = PHOMA SP.) **** WATCH VIDEO! ASCOMYCETES (Origin on microalgae and cyanobacteria. Very probable) **** WATCH VIDEO! SLIME MOLD/ A Model to Investigate Cytoplasmic Actomyosin **** WATCH VIDEO! MOLECULAR EXPRESSIONS/ CYANOBACTERIUM / BLUE GREEN ALGAE/ Phormidium (Algae) Movies **** WATCH VIDEO! CYANOBACTERIA PHORMIDIUM **** WATCH VIDEO! RESEARCH CHANNEL / BIOLOGY IS NANOTECHNOLOGY **** WATCH VIDEO! EUGLENA / THE EUGLENOID PROJECT Algae **** INVENTAIRE DES ALGUES DE ROSCOFF **** ALGAE INDEX / IMAGE SOURCE / FACULTADES DE CIENCIAS Y FARMACIA / UNIVERSIDAD DE NAVARRA **** UNIVERSITY OF BERKELY / CENTER FOR PHYCOLOGICAL DOCUMENTATION **** VISUALS UNLIMITED (exellent image database) **** Molecular detection of ascomycetes associated with Fucus serratus/ 1 **** Molecular detection of ascomycetes associated with Fucus serratus/ 2 **** Thornber Lab/ University of Rhode Island
**** UTEX / UNIVERSITY OF TEXAS / ALGAE COLLECTION / **** PROTIST INFORMATION CENTER (IMAGE/VIDEO DATABASE) **** Twisted Bacteria FUSARIUM **** USDA / The Fusarium International Genomics Initiative **** Fusarium-mitochondria citations **** FUSARIUM: A SIGNIFICANT EMERGING PATHOGEN **** FUSARIUM / PLEOSPORA MYCO TOXINS **** Pathogenic Fungi Database (PFDB) **** CYBERNOME **** CBMG **** BIOTA TAIWANICA **** UFRGS **** Linear mitochondrial plasmids of Fusarium oxysporum contain genes with sequence similarity to genes encoding a reverse transcriptase from Neurospora spp. **** Endophthalmitis Caused by Fusarium proliferatum **** BJ SIGNAL **** BJ ENERGY / EUGLENA / Maturation of the unusual single-cysteine (XXXCH) mitochondrial c-type cytochromes found in trypanosomatids must occur through a novel biogenesis pathway **** PROTIST INFORMATION SERVER **** INDEX EUGLENA **** The mitochondrial genome of Euglena gracilis. **** FungalGenomics **** MYCONET / 4324. Ascomycota / 4. Origin on microalgae and cyanobacteria. - Very probable. **** MYCONET / 3318. Pleosporales Luttrell ex M.E. / Notes on ascomycete systematics **** DOE FUNGAL GENOMICS PROJECT **** MYCOLEGIUM **** Revista do Instituto de Medicina Tropical de So Paulo / Pheohyphomycosis; Phoma cava; Subcutaneous mycosis **** CYANOBACTERIA/ Great Lakes Water Life / GENUS Coelosphaerium **** GEOFUNGI / BOTANICA COMPLUTENSIS / Nr. 25, 2001 **** GLOSSARY/ MYCOLOGY BIOFILM **** INDEX ARTICLES / Extracellular DNA Required for Bacterial Biofilm Formation **** GENETICS OF BIOFILMS LABORATORY **** Genetic Identification of the Main Opportunistic Mucorales **** Azithromycin Blocks Quorum Sensing and Alginate Polymer Formation and Increases the Sensitivity to Serum and Stationary-Growth-Phase Killing of Pseudomonas aeruginosa and Attenuates Chronic P. aeruginosa Lung Infection in Cftr **** Lateral Gene Transfer and Cyanobacterial Toxicity **** FUNGAL GENOMICS STOCK CENTER NEW FOR 2010: Mystery disease blights Afghan opium poppies **** Risks of Using Biological Agents to Eradicate Drug Plants **** Mystery disease blights Afghan opium poppies **** REUTERS: Mystery disease blights Afghan opium poppy crop
**** New York Times: Mysterious Blight Destroys Afghan Poppy Harvest **** Poppy disease halves Afghan opium crop **** Fungus Hits Afghan Poppies **** First Report of Downy Mildew of Opium Poppy Caused by Peronospora arborescens in Spain BIO-CONTROL **** EEUU Admite posible vnculo entre Armas Biolgicas y Agente Verde **** FIRST FIND OF YEAST LIKE CELL **** Risks of Using Biological Agents to Eradicate Drug Plants **** Molecular Identification of Fusarium Species in Onychomycoses **** Endophthalmitis Caused by Fusarium proliferatum **** Clinical and Epidemiological Aspects of Infections Caused by Fusarium Species: a Collaborative Study from Israel **** Disseminated hyalohyphomycosis caused by a novel human pathogen, Fusarium napiforme. BIO-CONTROL / AGENT GREEN / SUNSHINE PROJECT/ PROJECT BACHUS **** THE SUNSHINE PROJECT **** THE SUNSHINE PROJECT/ GERMAN WEBSITE **** ISR / PROJECT BACHUS / BIOLOGICAL WEAPONS PRODUCTION **** Risks of Using Biological Agents to Eradicate Drug Plants **** USA Admits Possible Link between Biological Weapons and Agent Green **** Biowarfare in the Andes / The labs are brewing up two types of killer fungi, Fusarium oxysporum (for use against marijuana and coca plants) and Pleospora papaveracea (to destroy opium poppies). American Phytopathological Society BIO-CONTROL / PROJECT CLEAR VISION **** THE NEW YORK TIMES **** PROJECT CLEAR VISION / U.S. Germ Warfare Research Pushes Treaty Limits **** Useful Mutants, Bred With Radiation NOSTOCOIDA / TETRASPHAERA / AVIAN VACUOLAR MYELINOPATHY / BALD EAGLE DEMISE NOSTOCOIDA LIMICOLA **** A mysterious brain disease is killing birds, It is believed that a man-made... **** INVESTIGATION OF A NOVEL EPIPHYTIC CYANOBACTERIUM ASSOCIATED WITH RESERVOIRS AFFECTED BY AVIAN VACUOLAR MYELINOPATHY **** Isolates of Candidatus Nostocoida limicola Blackall et al. 2000 should be described as three novel species of the genus Tetrasphaera, as Tetrasphaera jenkinsii sp. nov., Tetrasphaera vanveenii sp. nov. and Tetrasphaera veronensis sp. nov. **** 'Candidatus Nostocoida limicola', a filamentous bacterium from activated sludge. KEY ARTICLE: RECREATIONAL AND OCCUPATIONAL FIELD EXPOSURE TO FRESHWATER CYANOBACTERIA / Ian Stewart **** Recreational and occupational field exposure to freshwater cyanobacteria a review of anecdotal and case reports, epidemiological studies and the challenges for epidemiologic assessment KEY ARTICLE: ECOPHYSIOLOGY OF MARINE CYANOBACTERIAL BLOOMS MICROCYSTIN-LR / FAST DEATH FACTOR The microcystins are hepatotoxic products of freshwater blooms of cyanobacteria of Microcystis spp., M. aeruginosa in particular. Microcystin-LR, also known as the fast death factor, is the most common of the microcystins and presumably the toxin of choice to be weaponized. Although the aerosolized form of microcystin is the most likely threat, ingestion - even from natural sources - must be considered
a significant hazard. MICROCYSTIS-LR / PATHOGENICITY **** Freshwater cyanobacterium Microcystis aeruginosa (UTEX 2385) induced DNA damage in vivo and in vitro **** Microcystin-LR induces oxidative DNA damage in human hepatoma cell line HepG2. **** The Gas Vesicle Gene Cluster from Microcystis aeruginosa and DNA Rearrangements That Lead to Loss of Cell Buoyancy **** Allergenic (sensitization, skin and eye irritation) effects of freshwater cyanobacteria experimental evidence SAN-FRANCISCO The first distribution, biomass and toxocity study of a newly established bloom of the colonial cyanobacteria Microcystis aeruginosa was conducted on October 15, 2003, in the upper San Francisco Bay Estuary. Mycrocystis aeruginosa was widely distributed throughout 180 km of waterways in the upper San Francisco Bay Estuary from freshwater to brackish water environments and contained hepatotoxic microcystins at all stations. CYANO **** The first distribution, biomass and toxicity study of a newly established bloom of the colonial cyanobacteria Microcystis aeruginosa was conducted on October 15, 2003 in the upper San Francisco Bay Estuary. **** Evidence for Recombination in the Microcystin Synthetase (mcy) Genes of Toxic Cyanobacteria Microcystis.spp **** Systematic survey on crystalline features of algal celluloses **** Isolation, Characterization, and Quantitative Analysis of Microviridin J, a New Microcystis Metabolite Toxic to Daphnia **** Signalling through cyclic nucleotide monophosphates in cyanobacteria **** A mannan binding lectin is involved in cellcell attachment in a toxic strain of Microcystis aeruginosa **** HIDDEN ECOLOGIES? "Scientists fear catastrophic losses" **** THURSDAY / MAY 3, 2007 / Bee deaths spark food crisis fear **** MONDAY / APRIL 30, 2007 / Scientists fear catastrophic losses **** FRIDAY / APRIL 27, 2007 / Algae bloom killing wildlife off California coast **** WASHINGTON (CNN) -- Beekeepers throughout the United States have been losing between 50 and 90 percent of their honeybees over the past six months, perplexing scientists **** Humans Making Wildlife Sick PHOMA **** eT SEARCH ENGINE/ articles citing: PHOMA sp. **** Phoma Saccardo: Distribution, secondary metabolite production and biotechnological applications **** Phoma and Stemphol **** Equisetin and a novel opposite stereochemical homolog phomasetin **** (PDF) The fungal strain that produced magenta pigment was closely related to Phoma herbarum. **** Subcutaneous Infection by Phoma Species ***** A class-wide phylogenetic assessment of Dothideomycetes **** (PDF) PHOMA HERBARUM WESTENDORP / PUTATIVE AGENT OF SAPROLEGNIOSIS ? PHOMA AND SARCOIDOSIS **** Experimental Skin Sarcoidosis
**** Sarcoidosis of the Skin/ A Dermatological Puzzle **** Foundation for Sarcoidosis Research **** SUBCUTANEOUS PHEOHYPHOMYCOSIS CAUSED BY Phoma cava. CLICK IMAGE TO OBTAIN PSI BLAST RESULTS BASED ON ITS PHOMA SP. ITS PHOMA sp. >Contig_1 ATCATTAAATACAGTAGATTTCTACTGATCGGGGGGGGTGGAAAGTCCCAGTTTGATTACTG GATCGCGAGTAAGCCCC CTGTCTGCACCCTTGTCTTTTGCGTACTTATGTTTCCTCGGCGGGCTTGCCTGCCGAATGGA CAATTCTAAAACCTTTT TAATTTTCAATCAGCGTCTGAACAATTATAATAATTACAACTTTCAACAACGGATCTCTTGGT TCTGGCATCGATGAAG AACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTG AACGCACATTGCGCCCCT TGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTATGCTTGGTGTTG GGTGTTTGTCCTCTCC CTTGCGTTTGGACTCGCCTTAAAGAAATTGGCAGCCAGTGTATTGGTATAGAAGCGCAGCA CAATTTGCGACTCTAGCT AATAATTACTTGCAACCATCAAGTCTA //// ITS AGROCYBE PEDIADES (Fr.) FAYOD >Contig_1 CCGAGGCAACTCGGTCGGGAGGACTGCTGGCTTTCACGAGTCGGCTTTCCTTGTATTATCC AGGCCTATGTCTTACACA TACCCCAAAGAATGTAACAGAATGTATTGTATATGGCCTAGTGCCTATAAACTATATACAACT TTCAGCAACGGATCTC TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATT CAGTGAATCATCGAATCT TTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATT CTCAACCTTATTAGCTT TTGCTGATAATGGCTTGGACTTGGGGGTCTTTTTGCTGGCTTTCATTAGTCTGCTCCCCTTAA ATGTATTAGCCGGTGC CCCGCAGTGGAACCGTCTATTGGTGTGATAATTATCTACGCCGTGGACGTCTGCTATAATGG GTTTGCGCTGCTTCTAA CCGTCTCTCGGGACAACACAAATGACAA Phoma and related pleosporalean genera Highlights of the Didymellaceae: A polyphasic approach to characterise Phoma and related pleosporalean genera Fungal taxonomists routinely encounter problems when dealing with asexual fungal species due to poly- and paraphyletic generic phylogenies, and unclear species boundaries. These problems are aptly illustrated in the genus Phoma. This phytopathologically significant fungal genus is currently subdivided into nine sections which are mainly based on a single or just a few morphological characters. However, this subdivision is ambiguous as several of the section-specific characters can occur within a single species. In addition, many teleomorph genera have been linked to Phoma, three of which are recognised here. In this study it is attempted to delineate generic boundaries, and to come to a generic circumscription which is more correct from an evolutionary point of view by means of multilocus sequence typing. Therefore, multiple analyses were conducted utilising sequences obtained from 28S nrDNA (Large Subunit - LSU), 18S nrDNA (Small Subunit - SSU), the Internal Transcribed Spacer regions 1 & 2 and 5.8S nrDNA (ITS), and part of the -tubulin (TUB) gene region. A total of 324 strains were included in the analyses of which most belonged to Phoma taxa, whilst 54 to related pleosporalean fungi. In total, 206 taxa were investigated, of which 159 are known to have affinities to Phoma. The phylogenetic analysis revealed that the current Boeremaean subdivision is incorrect from
an evolutionary point of view, revealing the genus to be highly polyphyletic. Phoma species are retrieved in six distinct clades within the Pleosporales, and appear to reside in different families. The majority of the species, however, including the generic type, clustered in a recently established family, Didymellaceae. In the second part of this study, the phylogenetic variation of the species and varieties in this clade was further assessed. Next to the genus Didymella, which is considered to be the sole teleomorph of Phoma s. str., we also retrieved taxa belonging to the teleomorph genera Leptosphaerulina and Macroventuria in this clade. Based on the sequence data obtained, the Didymellaceae segregate into at least 18 distinct clusters, of which many can be associated with several specific taxonomic characters. Four of these clusters were defined well enough by means of phylogeny and morphology, so that the associated taxa could be transferred to separate genera. Aditionally, this study addresses the taxonomic description of eight species and two varieties that are novel to science, and the recombination of 61 additional taxa. Keywords: Boeremia, coelomycetes, Didymella, Didymellaceae, DNA phylogeny, Epicoccum, Leptosphaerulina, Macroventuria, Peyronellaea, Phoma, Pleosporales, taxonomy, Stagonosporopsis Related article/ Click titel: Multiple Didymella teleomorphs are linked to the Phoma clematidina morphotype Articles from Studies in Mycology are provided here courtesy of CBS Fungal Biodiversity Centre Copyright 2010 CBS Fungal Biodiversity Centre PHOMA spp. "In hairy areas, the fungi grow around the hair shaft" **** NCBI / Link to Phoma **** Phoma spp. **** Sekundrstoffe aus endophytischen Pilzen mariner Habitate und Abbaureaktionen an Simocyclinon D8 **** PHOMA/ Anamorph genera associated with Botryosphaeria **** Synonym and Classification Data for Phoma spp. **** PHOMA SPP. FACT SHEET **** Human Phaeohyphomycotic Osteomyelitis Caused by the Coelomycete Phomopsis Saccardo 1905: Criteria for Identification, Case History, and Therapy **** ITS sequencing support for Epicoccum nigrum and Phoma epicoccina being the same biological species **** Association of a new species of Phoma with Pleospora Herbarum (Pers.) Rahb -**** ARTICLE: Applied and Environmental Microbiology/ Characterization and Differentiation of... (Phoma = Myrothecium = Malbranchea) **** Some isolates originally identified as E. nigrum developed a "Phoma-like" pycnidial state **** Evidence of the production of silver nanoparticles via ... **** Nomenclatural Fact Sheet - Phoma crystalliniformis **** Fungi: Phoma **** Phoma glomerata as a Mycoparasite of Powdery Mildew **** First report of Phoma sorghina (Sacc.) **** Extracellular lipolytic activity in Phoma glomerata **** Identification of Sources of Resistance to Phoma medicaginis Isolates in Medicago truncatula
SARDI Core Collection Accessions, and Multigene Differentiation of Isolates FUSARIUM SOLANI / PHOMA TELEOMORPH - ANAMORPH - HOLOMORPH - SYNANAMORPS **** teleomorph, anamorph, holomorph and synanamorphs. **** ANAMORPH INDEX GLOBAL BIODOVERSITY INFORMATION FACILITY Synonyms: Naucoria vervacti, Agrocybe arvalis, Agaricus arenicola, Agaricus temulentus, Agrocybe temulenta, Agrocybe arenaria, Agrocybe subpediades, Naucoria subpediades, Naucoria temulenta, Agrocybe temulenta, Pseudodeconica semiorbicularis, Naucoria pediades, Agaricus pediades, Agrocybe arenicola, Agrocybe semiorbicularis, Nolanea pediades, Naucoria semiorbicularis, Naucoria arenaria, Agaricus semiorbicularis KEY ARTICLE: FREDERICKS ET AL / VETERANS AFFAIRS / GULF WAR RELATED SYNDROME ***** FREDERICKS ET AL: ARCHIVED ARTICLES WILL SHOW UP MID PAGE ***** GULF WAR RELATED SYNDROME **** Surface signaling in pathogenesis. **** Disseminated hyalohyphomycosis caused by a novel human pathogen, Fusarium napiforme. **** The First Find of Yeast-like Cells of Fusarium moniliforme and Mechanism of Infection Injury. **** Disseminated infection by Fusarium moniliforme during treatment for malignant lymphoma. **** Genetic diversity of human pathogenic members of the Fusarium oxysporum complex inferred from multilocus DNA sequence data and amplified fragment length polymorphism analyses: evidence for the recent dispersion of a geographically widespread clonal lineage and nosocomial origin QUORUM SENSING **** QUORUM SENSING VIDEO / The Biofilm Lifecycle / ANIMATION ARCHIVE **** Surface-active proteins enable microbial aerial hyphae to grow into the air **** Plants and animals both listen to and disrupt bacterial quorum sensing signaling, prompting interest in mechanisms, applications **** Quorum sensing and bacterial cross-talk in biotechnology **** Slimy businessthe biotechnology of biofilms **** Bacterial Quorum Sensing in Pathogenic Relationships **** MicroMeeting **** Bugging the Bugs **** MICROBES, IMMUNITY, AND DISEASE: A Symphony of Bacterial Voices **** Revisiting quorum sensing: Discovery of additional chemical and biological functions for 3-oxoN-acylhomoserine lactones **** Molecular structure is solved for key protein of quorum-sensing bacteria MESOMYCETOZOEA / DRIP CLADE / AQUATIC MOLD / RHINOSPORIDOSIS **** The two Dermocystidium species resemble Rhinosporidium **** USE OF STILBENE DERIVATIVES FOR TREATMENT AND PREVENTION OF AQUATIC MOLD INFECTIONS **** FAO / Saprolegnia AND OTHER PHYCOMYCETE INFECTIONS [DERMAL MYCOSES] **** Parasitism by Dermocystidium ranae **** Observations on the Life Stages of Sphaerothecum destruens n. g., n. sp., a Mesomycetozoean Fish Pathogen Formally Referred to as the Rosette Agent **** Differentiation between Prototheca and morphologically similar green algae in tissue. **** A molecular phylogeny of Pythium insidiosum
**** Development of an Immunochromatographic Test for Rapid Serodiagnosis of Human Pythiosis **** Lacazia Loboi and Rhinosporidium seeberi; a genomic perspective **** Molecular Model for Studying the Uncultivated Fungal Pathogen Lacazia loboi **** Nature and significance of the electron-dense bodies of the endospores of Rhinosporidium seeberi **** Phylogenetic Analysis of Rhinosporidium seeberi **** A new rubisco-like protein coexists with a photosynthetic rubisco in the planktonic cyanobacteria Microcystis. **** Algae as Tools in the Study of Cellulose **** Rhinosporidium seeberi: A Human Pathogen From a Novel Group of Aquatic Protistan Parasites **** Phylogenetic Analysis of Rhinosporidium seeberi's 18S Small-Subunit Ribosomal DNA Groups This Pathogen among Members of the Protoctistan Mesomycetozoa Clade **** Altered expression of two light-dependent genes in a microcystin-lacking mutant of Microcystis aeruginosa PCC 7806. **** Evidence for recombination in the microcystin synthetase **** Report of the First Human Case of Lobomycosis in the United States **** Transcription and in vivo expression of a Microcystis aeruginosa plasmid **** Fungal and Parasitic Infections of the Eye **** Recreational and occupational field exposure to freshwater cyanobacteria a review of anecdotal and case reports, epidemiological studies and the challenges for epidemiologic assessment **** Molecular Model for Studying the Uncultivated Fungal Pathogen Lacazia loboi THE WALL STREET JOURNAL / THE INFORMED READER / DISEASE OR DELUSION? **** THE WALL STREET JOURNAL **** THE INFORMED READER / DISEASE OR DELUSION? **** Ear Bacteria Resist Treatment **** HEALTH **** Dettol Man or Lysol: too much of a good sanitizer can kill QUICK DETAIL The abbreviation (sp.) used after a genus name refers to an undetermined species; (spp.) after a genus name refers to several species without naming them individually. THE MYSTERIOUS RELATIONSHIPS OF RHINOSPORIDOSIS SEEBERI **** THE MYSTERIOUS RELATIONSHIPS OF RHINOSPORIDOSIS SEEBERI **** Lymphadenitis, trans-epidermal elimination and unusualhistopathology in human rhinosporidiosis CAUSATIVE AGENT OF RHINOSPORIDOSIS IS MICROCYSTIS SP. ? **** Why did previous investigators not find well-defined mitochondria? I am convinced that these mitochondria are from human cells Emerging (unusual nosocomial) Infections **** Epidemiology and Clinical Aspects of Unusual Fungal Nosocomial Infections **** Fungal and Parasitic Infections of the Eye **** In-vitro antifungal susceptibility of clinical and environmental Fusarium spp. strains **** Cutaneous Infection by Fusarium Species in Healthy and Immunocompromised Hosts: Implications for Diagnosis and Management **** Fatal disseminated fusarium infection in acute lymphoblastic leukaemia in complete remission **** Fusarium Outbreak: Lessons Learned **** The effect of propyl gallate on the activity of various antifungal drugs against filamentous fungi in vitro. **** Fusarium, a Significant Emerging Pathogen "A NEW WAY TO LOOK AT FILAMENTS" **** A NEW WAY TO LOOK AT FILAMENTS **** Isolation and cultivation of filamentous bacteria implicated in...
Cellular fatty acids as chemotaxonomic markers of the genera.... **** Cellular fatty acids as chemotaxonomic markers of the genera Anabaena, Aphanizomenon, Microcystis, Nostoc and Planktothrix (cyanobacteria) **** The clade containing filamentous heterocystous cyanobacteria was divided into three discrete groups of.... GAS VACUOLES, ELECTRON-DENSE BODIES AND VIRUS **** The result of electron microscopic investigation of gas-vacuoles in a culture of the benthal alga Oscillatoria chalybea was compared with the extensive literature concerning gas-vacuole formation and virus infection in bacteria and animals. **** Gas vesicle proteins **** Nauture and significance of the electron-dense bodies.... CLASSIFICATION **** Molecular characterization of planktic cyanobacteria of Anabaena, Aphanizomenon, Microcystis and Planktothrix genera **** Quantitative Real-Time PCR Detection of Toxic Nodularia Cyanobacteria in the Baltic Sea **** A proposal for the unification of five species of the cyanobacterial genus Microcystis Kutzing ex Lemmermann 1907 under the Rules of the Bacteriological Code **** A proposal for further integration of the cyanobacteria under the Bacteriological Code **** TAXONOMY BROWSER **** Systematic-bacteriology--Enterobacteriaceae INDEX DATASERVICES **** SANGER/ Staphylococcus aureus Blast **** List of Prokaryotic names with Standing in Nomenclature **** BLAST INFORMATION **** MAX PLANCK INSTITUTE FOR TERRESTRIAL MICROBIOLOGY (INDEX) **** BROAD INSTITUTE **** IMMUNEEPITOPE **** MAX PLANCK / BIO-MEDICAL **** JVI / CMR (MICROBIAL GENOMES) **** CYANOBASE **** CYANOBASE LINKS **** Synechocystis PCC6803 and Anabaena PCC7120 **** NCBI / BLAST (Basic Local Alignment Search Tool) **** BIOTA TAIWANICA **** Neosartorya fischeri Genome Project **** LANL **** FASTA **** DOE **** EMBL-EBI **** RNA RIBOSOMAL DATABASE **** PFAM/ DB / SANGER **** FUNGAL GENOMES SEARCH **** GOBASE **** GenDis **** IMG **** DDBJ / DNA DATA BANK OF JAPAN **** NEMATOSTELLA VECTENSIS DATA BASE **** INSDC **** CABI Bioscience Databases
**** BIOAFRICA **** ESTREE **** SGD SITE MAP **** TREEBASE **** CLCBIO **** MYCOBANK **** GLOBAL BIODIVERSITY INFORMATION FACILITY **** USDA AGRICULTURAL RESEARCH SERVICE **** BRENDA **** FLYBASE **** PASTEUR/ CYANOLIST **** Genstyle Companion Database Browser **** YEASTGENOME **** YCR (YEAST RESOURCE CENTER) ARCHIVE 2007 (51) 2008 (1) 2010 (1) April (1) BLEACH BATHS MARCH 2010 BLEACH BATHS MARCH 2010 March 26, 2010 (Atlanta, Georgia) Nasal application of 2% mupirocin and bleach baths were found to be more effective at eradicating Staphylococcus aureus colonization than other interventions, according to the findings of a randomized trial. Bernard C. Camins, MD, from the Division of Infectious Diseases at the Washington University School of Medicine in St. Louis, Missouri, reported the findings here at the Fifth Decennial International Conference on Healthcare-Associated Infections 2010. According to the researchers, a variety of strategies have been used to decolonize patients with varying results, and there are "no published data on controlled trials evaluating the optimal methods for decolonization and their efficacy in preventing recurrent S aureus infections." Dr. Camins and colleagues evaluated the effectiveness of decolonization methods in the eradication of S aureus carriage in 193 children and 107 adults presenting with community-acquired S aureus skin and soft tissue infections. In addition to education on personal hygiene, all eligible patients were randomize to 1 of 4 groups: no intervention (control); application of 2% mupirocin ointment to both anterior nares twice daily for 5 days; application of 2% mupirocin ointment intranasally plus daily showers with 4% chlorhexidine solution for 5 days; and application of 2% mupirocin ointment intranasally plus daily 30-minute soaks in dilute bleach water for 5 days. Of the patients, 68% were colonized with methicillin-resistant S aureus (MRSA) and 32% were colonized with methicillin-sensitive S aureus alone. All interventions were effective 1 month postintervention at eradicating S aureus carriage, compared with the control group. At 4 months postintervention, only the mupirocin plus bleach bath was found to be effective at eradicating S aureus colonization (69% vs 48%; relative risk, 1.26; 95% confidence interval, 1.05 2.01; P = .02). All treatment groups were well tolerated, with dry skin being the most common adverse effect. "This current study is a pilot feasibility study for a larger trial to determine whether decolonization would prevent future episodes of skin and soft tissue infection," Dr. Camins told Medscape Infectious Diseases. "Before we completed the trial, decolonization methods were being used clinically without any
scientific data supporting their use," he said. "Now that we have completed our trial, at least clinicians can feel comfortable recommending the intranasal application of mupirocin plus bleach baths in patients with recurrent community-acquired MRSA skin/soft tissue infections," he said. Dr. Camins added that they were surprised that the mupirocin plus chlorhexidine intervention did not lead to decolonization, compared with the control group, at 4 months. According to Keith M. Ramsey, MD, from the Brody School of Medicine at East Carolina University in Greenville, North Carolina, who attended the meeting, the addition of the diluted 30-minute bleach bath to nasal mupirocintreatments, resulting in two thirds of the S aureus carriers remaining free of carriage for up to 4 months, is a new finding, and should be explored in larger studies. Dr. Ramsey told Medscape infectious Diseases that "it would be interesting to follow the subjects in the treatment arms to determine if any of the decolonization regimens result in differences in subsequent or recurrent clinical disease with S aureus or MRSA." This study was supported by an unrestricted grant from Pfizer. Chlorhexidine solution was provided by Mlnlycke Health Care. Taro Pharmaceuticals contributed generic mupirocin ointment. Dr. Camins reports being a consultant for Pfizer. Dr. Ramsey reports being a consultant for BD GeneOhm and on the speakers' bureau for MedImmune, Cubist, and OrthoMcNeil. Fifth Decennial International Conference on Healthcare-Associated Infections (ICHAI) 2010: Abstract 502. Presented March 20, 2010. **** KEY ARTICLES VIA: Fungal Genomes and Comparative Genomics **** Uncultivable bacteria: Implications and recent trends towards identification **** Ecophysiology of Marine Cyanobacterial Blooms Older Posts Home Developments in Fungal Taxonomy GENERAL CONCLUSIONS Fungal systematics is still based mainly on morphological criteria, and pathogenic fungi are usually recognized and identified basically by their phenotypes. Numerous alternative approaches have been developed, including nutritional and physiological studies, serologic tests, secondary metabolites, ubiquinone systems, and fatty acids. Although some of these are very useful for identifying poorly differentiated fungi such as yeasts and black yeasts, they are only complementary tools of morphological data in most cases. Molecular biology techniques, especially the analysis of rRNA sequences, are currently used for reliable phylogenetic studies, which enable a more natural classification system to be established. However, despite the effective application of these techniques in PCRmediated identification systems, they are not yet currently available in the routine clinical mycology environment. The constant discovery of new emerging mycotic agents in different clinical settings that often affect critically ill patients increases the need for the development of rapid and accurate identification systems, since delay in the diagnosis and initiation of therapy leads to a high mortality rate. On the other hand, if the isolates described in a report are discarded after a study finishes, the etiological data cannot then be checked in any further investigations (119). Therefore, contemporary practitioners and laboratorians should contact expert
mycologists to identify the clinical isolates correctly and should deposit the strains in a reference culture collection. Most of these isolates must be reidentified by modern methods for a critical evaluation of the clinical cases. The problem of numerous undescribed species, together with the superficial level of knowledge that we have even for the fungi which have names, argues for a much greater emphasis on fungal biosystematics in the future. More attention to medical mycology and increased funding for training of medical mycologists are critical to address the current threats from new and reemerging fungal infections. **** TmPrime/ Agrocybe Pediades Awesome Inc. template. Powered by Blogger.
(1)"While environmental SERRATIA MARCESCENS strains are often red, due to the production of prodigiosin, the strains associated with hospital outbreaks are mostly non-pigmented." "NEUROSPORA CRASSA" is a pinkish to red mold but is not as common and is generally lighter in color then Serratia marcescens." "NEUROSPORA CRASSA" , is a central organism in the history of twentieth-century genetics, biochemistry and molecular biology.
Archived Article/ March 26, 2010 (Atlanta, Georgia) March 26, 2010 (Atlanta, Georgia) Nasal application of 2% mupirocin and bleach baths were found to be more effective at eradicating Staphylococcus aureus colonization than other interventions, according to the findings of a randomized trial.
Serratia Marcescens.(SM) Synonomy: Chromobacter prodigiosus, Bacterium prodigiosus, Micrococcus prodigiosus, Serratia marcescens Bizio, Zaogalactina imetropha Sette, Monas prodigiosa Ehrenberg, Palmella prodigiosa Montagne, Micrococcus prodigiosus Cohn, Bacillus prodigiosus Fluegge, Bacillus imetrophus Trevisan, Bacillus marcescens De Toni and Trevisan, "Serratia marcescens, previously called Chromobacterium prodigiosum" **** American Society for Microbiology / Infection and Immunology / Serratia
**** Biotyping of Serratia marcescens and its use in epidemiological studies. **** HEALTH EFFECTS OF PROJECT SHAD BIOLOGICAL AGENT: SERRATIA MARCESCENS **** KARGER **** Biofilm Formation and Sloughing in Serratia marcescens **** J.P. Euzby: List of Prokaryotic names with Standing in Nomenclature - Genus Serratia **** ION CHANNEL **** LABOME.org **** NCBI / Entry/ Serratia **** DSMZ **** Hopkins/ Serratia species **** DOE Genome Projects (06-Oct-2010) **** phage (wIF3) **** phiIF3 Serratia marcescens/ putative reference strain Db11
NO MERCY FOR MRSA / TREATMENT ALTERNATIVES/ Adjunctive Use Rifampin **** NO MERCY FOR MRSA: treatment alternatives to vancomycin and linezolid **** Adjunctive use of rifampin for the treatment of Staphylococcus aureus infections: a systematic review of the literature MRSA/ GREEN TEA/ Epigallocatechin Gallate **** Green Tea to fight MRSA? **** Additive, indifferent and antagonistic effects in combinations of epigallocatechin gallate with 12 non--lactam antibiotics against methicillin-resistant Staphylococcus aureus **** Mechanism of Synergy between Epigallocatechin Gallate and -Lactams against MethicillinResistant Staphylococcus aureus **** The Effect of Green Tea on the Growth and Morphology of Methicillin-resistant and Methicillinsusceptible Staphylococcus aureus CA-MRSA/ MRSA/ MSSA **** JAMA **** Genetic transfer in Staphylococcus: a case study of 13 genomes **** Use of Oligoarrays for Characterization of Community-Onset Methicillin-Resistant Staphylococcus aureus **** Genetic Changes That Correlate with Reduced Suceptibility to Daptomycin in Staphylococcus aureus **** Heterogeneity of Methicillin-Susceptible Staphylococcus aureus Strains at a German University
Hospital Implicates the Circulating-Strain Pool as a Potential Source of Emerging Methicillin-Resistant S. aureus Clones **** Laborotory Detection of Extended-Spectrum B-Lactamases (ESBLs) **** Community-acquired methicillin-resistant Staphylococcus aureus carrying Panton-Valentine leukocidin genes: WORLDWIDE EMERGENGE. **** Professional Report/ OCTENISAN **** Susceptibility of MRSA to octenidine dihydrochloride **** Studies on the Efficacy of Octenidine Dihydrochloride and Octenisan
Your Insect Bite Might be Staph! **** Hospitalizations and Deaths Caused by Methicillin-Resistant Staphylococcus aureus, United States, 19992005 **** Subtle genetic changes enhance virulence of methicillin resistant and sensitive Staphylococcus aureus **** Powerful strains of MRSA are beginning to break out of hospitals into the community. **** Community-associated MRSA: Superbug at our doorstep **** "As amoeba produce cysts to help them spread, this could mean that MRSA maybe able to be 'blown in the wind' between different locations" "This makes matters even more worrying," WHITE HOUSE CUT TESTIMONY **** NEW YORK TIMES / Infection Killed Almost 19,000 in 2005, Study Says **** REDIRECTED / CNN / Sources: White House cut testimony / "It was eviscerated", said a CDC official, familiar with both versions, who spoke on condition of anonymity because of the sensitive nature of the review process. **** Dermatology Times / April 01, 2002/ CDC downplays "mystery rash" link **** AP / 09/17/07/ Mysterious outbreak at Houston school scares parents, teachers **** MIT / TECHNOLOGY REVIEW / Biotechnologys advance could give malefactors the ability to manipulate life processes -- and even affect human behavior. **** WATCH VIDEO! CYANOBACTERIA **** WATCH VIDEO! BROWN ALGAE (PHAEOPHYCEAE = PLEOSPORALES = PHOMA SP.) **** WATCH VIDEO! ASCOMYCETES (Origin on microalgae and cyanobacteria. Very probable) **** WATCH VIDEO! SLIME MOLD/ A Model to Investigate Cytoplasmic Actomyosin **** WATCH VIDEO! MOLECULAR EXPRESSIONS/ CYANOBACTERIUM / BLUE GREEN ALGAE/ Phormidium (Algae) Movies **** WATCH VIDEO! CYANOBACTERIA PHORMIDIUM **** WATCH VIDEO! RESEARCH CHANNEL / BIOLOGY IS NANOTECHNOLOGY **** WATCH VIDEO! EUGLENA / THE EUGLENOID PROJECT Algae **** INVENTAIRE DES ALGUES DE ROSCOFF **** ALGAE INDEX / IMAGE SOURCE / FACULTADES DE CIENCIAS Y FARMACIA / UNIVERSIDAD DE NAVARRA **** UNIVERSITY OF BERKELY / CENTER FOR PHYCOLOGICAL DOCUMENTATION **** VISUALS UNLIMITED (exellent image database) **** Molecular detection of ascomycetes associated with Fucus serratus/ 1 **** Molecular detection of ascomycetes associated with Fucus serratus/ 2 **** Thornber Lab/ University of Rhode Island
**** UTEX / UNIVERSITY OF TEXAS / ALGAE COLLECTION / **** PROTIST INFORMATION CENTER (IMAGE/VIDEO DATABASE) **** Twisted Bacteria FUSARIUM **** USDA / The Fusarium International Genomics Initiative **** Fusarium-mitochondria citations **** FUSARIUM: A SIGNIFICANT EMERGING PATHOGEN **** FUSARIUM / PLEOSPORA MYCO TOXINS **** Pathogenic Fungi Database (PFDB) **** CYBERNOME **** CBMG **** BIOTA TAIWANICA **** UFRGS **** Linear mitochondrial plasmids of Fusarium oxysporum contain genes with sequence similarity to genes encoding a reverse transcriptase from Neurospora spp. **** Endophthalmitis Caused by Fusarium proliferatum **** BJ SIGNAL **** BJ ENERGY / EUGLENA / Maturation of the unusual single-cysteine (XXXCH) mitochondrial c-type cytochromes found in trypanosomatids must occur through a novel biogenesis pathway **** PROTIST INFORMATION SERVER **** INDEX EUGLENA **** The mitochondrial genome of Euglena gracilis. **** FungalGenomics **** MYCONET / 4324. Ascomycota / 4. Origin on microalgae and cyanobacteria. - Very probable. **** MYCONET / 3318. Pleosporales Luttrell ex M.E. / Notes on ascomycete systematics **** DOE FUNGAL GENOMICS PROJECT **** MYCOLEGIUM **** Revista do Instituto de Medicina Tropical de So Paulo / Pheohyphomycosis; Phoma cava; Subcutaneous mycosis **** CYANOBACTERIA/ Great Lakes Water Life / GENUS Coelosphaerium **** GEOFUNGI / BOTANICA COMPLUTENSIS / Nr. 25, 2001 **** GLOSSARY/ MYCOLOGY BIOFILM **** INDEX ARTICLES / Extracellular DNA Required for Bacterial Biofilm Formation **** GENETICS OF BIOFILMS LABORATORY **** Genetic Identification of the Main Opportunistic Mucorales **** Azithromycin Blocks Quorum Sensing and Alginate Polymer Formation and Increases the Sensitivity to Serum and Stationary-Growth-Phase Killing of Pseudomonas aeruginosa and Attenuates Chronic P. aeruginosa Lung Infection in Cftr **** Lateral Gene Transfer and Cyanobacterial Toxicity **** FUNGAL GENOMICS STOCK CENTER NEW FOR 2010: Mystery disease blights Afghan opium poppies **** Risks of Using Biological Agents to Eradicate Drug Plants **** Mystery disease blights Afghan opium poppies **** REUTERS: Mystery disease blights Afghan opium poppy crop
**** New York Times: Mysterious Blight Destroys Afghan Poppy Harvest **** Poppy disease halves Afghan opium crop **** Fungus Hits Afghan Poppies **** First Report of Downy Mildew of Opium Poppy Caused by Peronospora arborescens in Spain BIO-CONTROL **** EEUU Admite posible vnculo entre Armas Biolgicas y Agente Verde **** FIRST FIND OF YEAST LIKE CELL **** Risks of Using Biological Agents to Eradicate Drug Plants **** Molecular Identification of Fusarium Species in Onychomycoses **** Endophthalmitis Caused by Fusarium proliferatum **** Clinical and Epidemiological Aspects of Infections Caused by Fusarium Species: a Collaborative Study from Israel **** Disseminated hyalohyphomycosis caused by a novel human pathogen, Fusarium napiforme. BIO-CONTROL / AGENT GREEN / SUNSHINE PROJECT/ PROJECT BACHUS **** THE SUNSHINE PROJECT **** THE SUNSHINE PROJECT/ GERMAN WEBSITE **** ISR / PROJECT BACHUS / BIOLOGICAL WEAPONS PRODUCTION **** Risks of Using Biological Agents to Eradicate Drug Plants **** USA Admits Possible Link between Biological Weapons and Agent Green **** Biowarfare in the Andes / The labs are brewing up two types of killer fungi, Fusarium oxysporum (for use against marijuana and coca plants) and Pleospora papaveracea (to destroy opium poppies). American Phytopathological Society BIO-CONTROL / PROJECT CLEAR VISION **** THE NEW YORK TIMES **** PROJECT CLEAR VISION / U.S. Germ Warfare Research Pushes Treaty Limits **** Useful Mutants, Bred With Radiation NOSTOCOIDA / TETRASPHAERA / AVIAN VACUOLAR MYELINOPATHY / BALD EAGLE DEMISE NOSTOCOIDA LIMICOLA **** A mysterious brain disease is killing birds, It is believed that a man-made... **** INVESTIGATION OF A NOVEL EPIPHYTIC CYANOBACTERIUM ASSOCIATED WITH RESERVOIRS AFFECTED BY AVIAN VACUOLAR MYELINOPATHY **** Isolates of Candidatus Nostocoida limicola Blackall et al. 2000 should be described as three novel species of the genus Tetrasphaera, as Tetrasphaera jenkinsii sp. nov., Tetrasphaera vanveenii sp. nov. and Tetrasphaera veronensis sp. nov. **** 'Candidatus Nostocoida limicola', a filamentous bacterium from activated sludge. KEY ARTICLE: RECREATIONAL AND OCCUPATIONAL FIELD EXPOSURE TO FRESHWATER CYANOBACTERIA / Ian Stewart **** Recreational and occupational field exposure to freshwater cyanobacteria a review of anecdotal and case reports, epidemiological studies and the challenges for epidemiologic assessment KEY ARTICLE: ECOPHYSIOLOGY OF MARINE CYANOBACTERIAL BLOOMS MICROCYSTIN-LR / FAST DEATH FACTOR The microcystins are hepatotoxic products of freshwater blooms of cyanobacteria of Microcystis spp., M. aeruginosa in particular. Microcystin-LR, also known as the fast death factor, is the most common of the microcystins and presumably the toxin of choice to be weaponized. Although the aerosolized form of microcystin is the most likely threat, ingestion - even from natural sources - must be considered
a significant hazard. MICROCYSTIS-LR / PATHOGENICITY **** Freshwater cyanobacterium Microcystis aeruginosa (UTEX 2385) induced DNA damage in vivo and in vitro **** Microcystin-LR induces oxidative DNA damage in human hepatoma cell line HepG2. **** The Gas Vesicle Gene Cluster from Microcystis aeruginosa and DNA Rearrangements That Lead to Loss of Cell Buoyancy **** Allergenic (sensitization, skin and eye irritation) effects of freshwater cyanobacteria experimental evidence SAN-FRANCISCO The first distribution, biomass and toxocity study of a newly established bloom of the colonial cyanobacteria Microcystis aeruginosa was conducted on October 15, 2003, in the upper San Francisco Bay Estuary. Mycrocystis aeruginosa was widely distributed throughout 180 km of waterways in the upper San Francisco Bay Estuary from freshwater to brackish water environments and contained hepatotoxic microcystins at all stations. CYANO **** The first distribution, biomass and toxicity study of a newly established bloom of the colonial cyanobacteria Microcystis aeruginosa was conducted on October 15, 2003 in the upper San Francisco Bay Estuary. **** Evidence for Recombination in the Microcystin Synthetase (mcy) Genes of Toxic Cyanobacteria Microcystis.spp **** Systematic survey on crystalline features of algal celluloses **** Isolation, Characterization, and Quantitative Analysis of Microviridin J, a New Microcystis Metabolite Toxic to Daphnia **** Signalling through cyclic nucleotide monophosphates in cyanobacteria **** A mannan binding lectin is involved in cellcell attachment in a toxic strain of Microcystis aeruginosa **** HIDDEN ECOLOGIES? "Scientists fear catastrophic losses" **** THURSDAY / MAY 3, 2007 / Bee deaths spark food crisis fear **** MONDAY / APRIL 30, 2007 / Scientists fear catastrophic losses **** FRIDAY / APRIL 27, 2007 / Algae bloom killing wildlife off California coast **** WASHINGTON (CNN) -- Beekeepers throughout the United States have been losing between 50 and 90 percent of their honeybees over the past six months, perplexing scientists **** Humans Making Wildlife Sick PHOMA **** eT SEARCH ENGINE/ articles citing: PHOMA sp. **** Phoma Saccardo: Distribution, secondary metabolite production and biotechnological applications **** Phoma and Stemphol **** Equisetin and a novel opposite stereochemical homolog phomasetin **** (PDF) The fungal strain that produced magenta pigment was closely related to Phoma herbarum. **** Subcutaneous Infection by Phoma Species ***** A class-wide phylogenetic assessment of Dothideomycetes **** (PDF) PHOMA HERBARUM WESTENDORP / PUTATIVE AGENT OF SAPROLEGNIOSIS ? PHOMA AND SARCOIDOSIS **** Experimental Skin Sarcoidosis
**** Sarcoidosis of the Skin/ A Dermatological Puzzle **** Foundation for Sarcoidosis Research **** SUBCUTANEOUS PHEOHYPHOMYCOSIS CAUSED BY Phoma cava. CLICK IMAGE TO OBTAIN PSI BLAST RESULTS BASED ON ITS PHOMA SP. ITS PHOMA sp. >Contig_1 ATCATTAAATACAGTAGATTTCTACTGATCGGGGGGGGTGGAAAGTCCCAGTTTGATTACTG GATCGCGAGTAAGCCCC CTGTCTGCACCCTTGTCTTTTGCGTACTTATGTTTCCTCGGCGGGCTTGCCTGCCGAATGGA CAATTCTAAAACCTTTT TAATTTTCAATCAGCGTCTGAACAATTATAATAATTACAACTTTCAACAACGGATCTCTTGGT TCTGGCATCGATGAAG AACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTG AACGCACATTGCGCCCCT TGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTATGCTTGGTGTTG GGTGTTTGTCCTCTCC CTTGCGTTTGGACTCGCCTTAAAGAAATTGGCAGCCAGTGTATTGGTATAGAAGCGCAGCA CAATTTGCGACTCTAGCT AATAATTACTTGCAACCATCAAGTCTA //// ITS AGROCYBE PEDIADES (Fr.) FAYOD >Contig_1 CCGAGGCAACTCGGTCGGGAGGACTGCTGGCTTTCACGAGTCGGCTTTCCTTGTATTATCC AGGCCTATGTCTTACACA TACCCCAAAGAATGTAACAGAATGTATTGTATATGGCCTAGTGCCTATAAACTATATACAACT TTCAGCAACGGATCTC TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATT CAGTGAATCATCGAATCT TTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATT CTCAACCTTATTAGCTT TTGCTGATAATGGCTTGGACTTGGGGGTCTTTTTGCTGGCTTTCATTAGTCTGCTCCCCTTAA ATGTATTAGCCGGTGC CCCGCAGTGGAACCGTCTATTGGTGTGATAATTATCTACGCCGTGGACGTCTGCTATAATGG GTTTGCGCTGCTTCTAA CCGTCTCTCGGGACAACACAAATGACAA Phoma and related pleosporalean genera Highlights of the Didymellaceae: A polyphasic approach to characterise Phoma and related pleosporalean genera Fungal taxonomists routinely encounter problems when dealing with asexual fungal species due to poly- and paraphyletic generic phylogenies, and unclear species boundaries. These problems are aptly illustrated in the genus Phoma. This phytopathologically significant fungal genus is currently subdivided into nine sections which are mainly based on a single or just a few morphological characters. However, this subdivision is ambiguous as several of the section-specific characters can occur within a single species. In addition, many teleomorph genera have been linked to Phoma, three of which are recognised here. In this study it is attempted to delineate generic boundaries, and to come to a generic circumscription which is more correct from an evolutionary point of view by means of multilocus sequence typing. Therefore, multiple analyses were conducted utilising sequences obtained from 28S nrDNA (Large Subunit - LSU), 18S nrDNA (Small Subunit - SSU), the Internal Transcribed Spacer regions 1 & 2 and 5.8S nrDNA (ITS), and part of the -tubulin (TUB) gene region. A total of 324 strains were included in the analyses of which most belonged to Phoma taxa, whilst 54 to related pleosporalean fungi. In total, 206 taxa were investigated, of which 159 are known to have affinities to Phoma. The phylogenetic analysis revealed that the current Boeremaean subdivision is incorrect from
an evolutionary point of view, revealing the genus to be highly polyphyletic. Phoma species are retrieved in six distinct clades within the Pleosporales, and appear to reside in different families. The majority of the species, however, including the generic type, clustered in a recently established family, Didymellaceae. In the second part of this study, the phylogenetic variation of the species and varieties in this clade was further assessed. Next to the genus Didymella, which is considered to be the sole teleomorph of Phoma s. str., we also retrieved taxa belonging to the teleomorph genera Leptosphaerulina and Macroventuria in this clade. Based on the sequence data obtained, the Didymellaceae segregate into at least 18 distinct clusters, of which many can be associated with several specific taxonomic characters. Four of these clusters were defined well enough by means of phylogeny and morphology, so that the associated taxa could be transferred to separate genera. Aditionally, this study addresses the taxonomic description of eight species and two varieties that are novel to science, and the recombination of 61 additional taxa. Keywords: Boeremia, coelomycetes, Didymella, Didymellaceae, DNA phylogeny, Epicoccum, Leptosphaerulina, Macroventuria, Peyronellaea, Phoma, Pleosporales, taxonomy, Stagonosporopsis Related article/ Click titel: Multiple Didymella teleomorphs are linked to the Phoma clematidina morphotype Articles from Studies in Mycology are provided here courtesy of CBS Fungal Biodiversity Centre Copyright 2010 CBS Fungal Biodiversity Centre PHOMA spp. "In hairy areas, the fungi grow around the hair shaft" **** NCBI / Link to Phoma **** Phoma spp. **** Sekundrstoffe aus endophytischen Pilzen mariner Habitate und Abbaureaktionen an Simocyclinon D8 **** PHOMA/ Anamorph genera associated with Botryosphaeria **** Synonym and Classification Data for Phoma spp. **** PHOMA SPP. FACT SHEET **** Human Phaeohyphomycotic Osteomyelitis Caused by the Coelomycete Phomopsis Saccardo 1905: Criteria for Identification, Case History, and Therapy **** ITS sequencing support for Epicoccum nigrum and Phoma epicoccina being the same biological species **** Association of a new species of Phoma with Pleospora Herbarum (Pers.) Rahb -**** ARTICLE: Applied and Environmental Microbiology/ Characterization and Differentiation of... (Phoma = Myrothecium = Malbranchea) **** Some isolates originally identified as E. nigrum developed a "Phoma-like" pycnidial state **** Evidence of the production of silver nanoparticles via ... **** Nomenclatural Fact Sheet - Phoma crystalliniformis **** Fungi: Phoma **** Phoma glomerata as a Mycoparasite of Powdery Mildew **** First report of Phoma sorghina (Sacc.) **** Extracellular lipolytic activity in Phoma glomerata **** Identification of Sources of Resistance to Phoma medicaginis Isolates in Medicago truncatula
SARDI Core Collection Accessions, and Multigene Differentiation of Isolates FUSARIUM SOLANI / PHOMA TELEOMORPH - ANAMORPH - HOLOMORPH - SYNANAMORPS **** teleomorph, anamorph, holomorph and synanamorphs. **** ANAMORPH INDEX GLOBAL BIODOVERSITY INFORMATION FACILITY Synonyms: Naucoria vervacti, Agrocybe arvalis, Agaricus arenicola, Agaricus temulentus, Agrocybe temulenta, Agrocybe arenaria, Agrocybe subpediades, Naucoria subpediades, Naucoria temulenta, Agrocybe temulenta, Pseudodeconica semiorbicularis, Naucoria pediades, Agaricus pediades, Agrocybe arenicola, Agrocybe semiorbicularis, Nolanea pediades, Naucoria semiorbicularis, Naucoria arenaria, Agaricus semiorbicularis KEY ARTICLE: FREDERICKS ET AL / VETERANS AFFAIRS / GULF WAR RELATED SYNDROME ***** FREDERICKS ET AL: ARCHIVED ARTICLES WILL SHOW UP MID PAGE ***** GULF WAR RELATED SYNDROME **** Surface signaling in pathogenesis. **** Disseminated hyalohyphomycosis caused by a novel human pathogen, Fusarium napiforme. **** The First Find of Yeast-like Cells of Fusarium moniliforme and Mechanism of Infection Injury. **** Disseminated infection by Fusarium moniliforme during treatment for malignant lymphoma. **** Genetic diversity of human pathogenic members of the Fusarium oxysporum complex inferred from multilocus DNA sequence data and amplified fragment length polymorphism analyses: evidence for the recent dispersion of a geographically widespread clonal lineage and nosocomial origin QUORUM SENSING **** QUORUM SENSING VIDEO / The Biofilm Lifecycle / ANIMATION ARCHIVE **** Surface-active proteins enable microbial aerial hyphae to grow into the air **** Plants and animals both listen to and disrupt bacterial quorum sensing signaling, prompting interest in mechanisms, applications **** Quorum sensing and bacterial cross-talk in biotechnology **** Slimy businessthe biotechnology of biofilms **** Bacterial Quorum Sensing in Pathogenic Relationships **** MicroMeeting **** Bugging the Bugs **** MICROBES, IMMUNITY, AND DISEASE: A Symphony of Bacterial Voices **** Revisiting quorum sensing: Discovery of additional chemical and biological functions for 3-oxoN-acylhomoserine lactones **** Molecular structure is solved for key protein of quorum-sensing bacteria MESOMYCETOZOEA / DRIP CLADE / AQUATIC MOLD / RHINOSPORIDOSIS **** The two Dermocystidium species resemble Rhinosporidium **** USE OF STILBENE DERIVATIVES FOR TREATMENT AND PREVENTION OF AQUATIC MOLD INFECTIONS **** FAO / Saprolegnia AND OTHER PHYCOMYCETE INFECTIONS [DERMAL MYCOSES] **** Parasitism by Dermocystidium ranae **** Observations on the Life Stages of Sphaerothecum destruens n. g., n. sp., a Mesomycetozoean Fish Pathogen Formally Referred to as the Rosette Agent **** Differentiation between Prototheca and morphologically similar green algae in tissue. **** A molecular phylogeny of Pythium insidiosum
**** Development of an Immunochromatographic Test for Rapid Serodiagnosis of Human Pythiosis **** Lacazia Loboi and Rhinosporidium seeberi; a genomic perspective **** Molecular Model for Studying the Uncultivated Fungal Pathogen Lacazia loboi **** Nature and significance of the electron-dense bodies of the endospores of Rhinosporidium seeberi **** Phylogenetic Analysis of Rhinosporidium seeberi **** A new rubisco-like protein coexists with a photosynthetic rubisco in the planktonic cyanobacteria Microcystis. **** Algae as Tools in the Study of Cellulose **** Rhinosporidium seeberi: A Human Pathogen From a Novel Group of Aquatic Protistan Parasites **** Phylogenetic Analysis of Rhinosporidium seeberi's 18S Small-Subunit Ribosomal DNA Groups This Pathogen among Members of the Protoctistan Mesomycetozoa Clade **** Altered expression of two light-dependent genes in a microcystin-lacking mutant of Microcystis aeruginosa PCC 7806. **** Evidence for recombination in the microcystin synthetase **** Report of the First Human Case of Lobomycosis in the United States **** Transcription and in vivo expression of a Microcystis aeruginosa plasmid **** Fungal and Parasitic Infections of the Eye **** Recreational and occupational field exposure to freshwater cyanobacteria a review of anecdotal and case reports, epidemiological studies and the challenges for epidemiologic assessment **** Molecular Model for Studying the Uncultivated Fungal Pathogen Lacazia loboi THE WALL STREET JOURNAL / THE INFORMED READER / DISEASE OR DELUSION? **** THE WALL STREET JOURNAL **** THE INFORMED READER / DISEASE OR DELUSION? **** Ear Bacteria Resist Treatment **** HEALTH **** Dettol Man or Lysol: too much of a good sanitizer can kill QUICK DETAIL The abbreviation (sp.) used after a genus name refers to an undetermined species; (spp.) after a genus name refers to several species without naming them individually. THE MYSTERIOUS RELATIONSHIPS OF RHINOSPORIDOSIS SEEBERI **** THE MYSTERIOUS RELATIONSHIPS OF RHINOSPORIDOSIS SEEBERI **** Lymphadenitis, trans-epidermal elimination and unusualhistopathology in human rhinosporidiosis CAUSATIVE AGENT OF RHINOSPORIDOSIS IS MICROCYSTIS SP. ? **** Why did previous investigators not find well-defined mitochondria? I am convinced that these mitochondria are from human cells Emerging (unusual nosocomial) Infections **** Epidemiology and Clinical Aspects of Unusual Fungal Nosocomial Infections **** Fungal and Parasitic Infections of the Eye **** In-vitro antifungal susceptibility of clinical and environmental Fusarium spp. strains **** Cutaneous Infection by Fusarium Species in Healthy and Immunocompromised Hosts: Implications for Diagnosis and Management **** Fatal disseminated fusarium infection in acute lymphoblastic leukaemia in complete remission **** Fusarium Outbreak: Lessons Learned **** The effect of propyl gallate on the activity of various antifungal drugs against filamentous fungi in vitro. **** Fusarium, a Significant Emerging Pathogen "A NEW WAY TO LOOK AT FILAMENTS" **** A NEW WAY TO LOOK AT FILAMENTS **** Isolation and cultivation of filamentous bacteria implicated in...
Cellular fatty acids as chemotaxonomic markers of the genera.... **** Cellular fatty acids as chemotaxonomic markers of the genera Anabaena, Aphanizomenon, Microcystis, Nostoc and Planktothrix (cyanobacteria) **** The clade containing filamentous heterocystous cyanobacteria was divided into three discrete groups of.... GAS VACUOLES, ELECTRON-DENSE BODIES AND VIRUS **** The result of electron microscopic investigation of gas-vacuoles in a culture of the benthal alga Oscillatoria chalybea was compared with the extensive literature concerning gas-vacuole formation and virus infection in bacteria and animals. **** Gas vesicle proteins **** Nauture and significance of the electron-dense bodies.... CLASSIFICATION **** Molecular characterization of planktic cyanobacteria of Anabaena, Aphanizomenon, Microcystis and Planktothrix genera **** Quantitative Real-Time PCR Detection of Toxic Nodularia Cyanobacteria in the Baltic Sea **** A proposal for the unification of five species of the cyanobacterial genus Microcystis Kutzing ex Lemmermann 1907 under the Rules of the Bacteriological Code **** A proposal for further integration of the cyanobacteria under the Bacteriological Code **** TAXONOMY BROWSER **** Systematic-bacteriology--Enterobacteriaceae INDEX DATASERVICES **** SANGER/ Staphylococcus aureus Blast **** List of Prokaryotic names with Standing in Nomenclature **** BLAST INFORMATION **** MAX PLANCK INSTITUTE FOR TERRESTRIAL MICROBIOLOGY (INDEX) **** BROAD INSTITUTE **** IMMUNEEPITOPE **** MAX PLANCK / BIO-MEDICAL **** JVI / CMR (MICROBIAL GENOMES) **** CYANOBASE **** CYANOBASE LINKS **** Synechocystis PCC6803 and Anabaena PCC7120 **** NCBI / BLAST (Basic Local Alignment Search Tool) **** BIOTA TAIWANICA **** Neosartorya fischeri Genome Project **** LANL **** FASTA **** DOE **** EMBL-EBI **** RNA RIBOSOMAL DATABASE **** PFAM/ DB / SANGER **** FUNGAL GENOMES SEARCH **** GOBASE **** GenDis **** IMG **** DDBJ / DNA DATA BANK OF JAPAN **** NEMATOSTELLA VECTENSIS DATA BASE **** INSDC **** CABI Bioscience Databases
**** BIOAFRICA **** ESTREE **** SGD SITE MAP **** TREEBASE **** CLCBIO **** MYCOBANK **** GLOBAL BIODIVERSITY INFORMATION FACILITY **** USDA AGRICULTURAL RESEARCH SERVICE **** BRENDA **** FLYBASE **** PASTEUR/ CYANOLIST **** Genstyle Companion Database Browser **** YEASTGENOME **** YCR (YEAST RESOURCE CENTER) ARCHIVE 2007 (51) 2008 (1) 2010 (1) April (1) BLEACH BATHS MARCH 2010 BLEACH BATHS MARCH 2010 March 26, 2010 (Atlanta, Georgia) Nasal application of 2% mupirocin and bleach baths were found to be more effective at eradicating Staphylococcus aureus colonization than other interventions, according to the findings of a randomized trial. Bernard C. Camins, MD, from the Division of Infectious Diseases at the Washington University School of Medicine in St. Louis, Missouri, reported the findings here at the Fifth Decennial International Conference on Healthcare-Associated Infections 2010. According to the researchers, a variety of strategies have been used to decolonize patients with varying results, and there are "no published data on controlled trials evaluating the optimal methods for decolonization and their efficacy in preventing recurrent S aureus infections." Dr. Camins and colleagues evaluated the effectiveness of decolonization methods in the eradication of S aureus carriage in 193 children and 107 adults presenting with community-acquired S aureus skin and soft tissue infections. In addition to education on personal hygiene, all eligible patients were randomize to 1 of 4 groups: no intervention (control); application of 2% mupirocin ointment to both anterior nares twice daily for 5 days; application of 2% mupirocin ointment intranasally plus daily showers with 4% chlorhexidine solution for 5 days; and application of 2% mupirocin ointment intranasally plus daily 30-minute soaks in dilute bleach water for 5 days. Of the patients, 68% were colonized with methicillin-resistant S aureus (MRSA) and 32% were colonized with methicillin-sensitive S aureus alone. All interventions were effective 1 month postintervention at eradicating S aureus carriage, compared with the control group. At 4 months postintervention, only the mupirocin plus bleach bath was found to be effective at eradicating S aureus colonization (69% vs 48%; relative risk, 1.26; 95% confidence interval, 1.05 2.01; P = .02). All treatment groups were well tolerated, with dry skin being the most common adverse effect. "This current study is a pilot feasibility study for a larger trial to determine whether decolonization would prevent future episodes of skin and soft tissue infection," Dr. Camins told Medscape Infectious Diseases. "Before we completed the trial, decolonization methods were being used clinically without any
scientific data supporting their use," he said. "Now that we have completed our trial, at least clinicians can feel comfortable recommending the intranasal application of mupirocin plus bleach baths in patients with recurrent community-acquired MRSA skin/soft tissue infections," he said. Dr. Camins added that they were surprised that the mupirocin plus chlorhexidine intervention did not lead to decolonization, compared with the control group, at 4 months. According to Keith M. Ramsey, MD, from the Brody School of Medicine at East Carolina University in Greenville, North Carolina, who attended the meeting, the addition of the diluted 30-minute bleach bath to nasal mupirocintreatments, resulting in two thirds of the S aureus carriers remaining free of carriage for up to 4 months, is a new finding, and should be explored in larger studies. Dr. Ramsey told Medscape infectious Diseases that "it would be interesting to follow the subjects in the treatment arms to determine if any of the decolonization regimens result in differences in subsequent or recurrent clinical disease with S aureus or MRSA." This study was supported by an unrestricted grant from Pfizer. Chlorhexidine solution was provided by Mlnlycke Health Care. Taro Pharmaceuticals contributed generic mupirocin ointment. Dr. Camins reports being a consultant for Pfizer. Dr. Ramsey reports being a consultant for BD GeneOhm and on the speakers' bureau for MedImmune, Cubist, and OrthoMcNeil. Fifth Decennial International Conference on Healthcare-Associated Infections (ICHAI) 2010: Abstract 502. Presented March 20, 2010. **** KEY ARTICLES VIA: Fungal Genomes and Comparative Genomics **** Uncultivable bacteria: Implications and recent trends towards identification **** Ecophysiology of Marine Cyanobacterial Blooms Older Posts Home Developments in Fungal Taxonomy GENERAL CONCLUSIONS Fungal systematics is still based mainly on morphological criteria, and pathogenic fungi are usually recognized and identified basically by their phenotypes. Numerous alternative approaches have been developed, including nutritional and physiological studies, serologic tests, secondary metabolites, ubiquinone systems, and fatty acids. Although some of these are very useful for identifying poorly differentiated fungi such as yeasts and black yeasts, they are only complementary tools of morphological data in most cases. Molecular biology techniques, especially the analysis of rRNA sequences, are currently used for reliable phylogenetic studies, which enable a more natural classification system to be established. However, despite the effective application of these techniques in PCRmediated identification systems, they are not yet currently available in the routine clinical mycology environment. The constant discovery of new emerging mycotic agents in different clinical settings that often affect critically ill patients increases the need for the development of rapid and accurate identification systems, since delay in the diagnosis and initiation of therapy leads to a high mortality rate. On the other hand, if the isolates described in a report are discarded after a study finishes, the etiological data cannot then be checked in any further investigations (119). Therefore, contemporary practitioners and laboratorians should contact expert
mycologists to identify the clinical isolates correctly and should deposit the strains in a reference culture collection. Most of these isolates must be reidentified by modern methods for a critical evaluation of the clinical cases. The problem of numerous undescribed species, together with the superficial level of knowledge that we have even for the fungi which have names, argues for a much greater emphasis on fungal biosystematics in the future. More attention to medical mycology and increased funding for training of medical mycologists are critical to address the current threats from new and reemerging fungal infections. **** TmPrime/ Agrocybe Pediades Awesome Inc. template. Powered by Blogger.
(1)"While environmental SERRATIA MARCESCENS strains are often red, due to the production of prodigiosin, the strains associated with hospital outbreaks are mostly non-pigmented." "NEUROSPORA CRASSA" is a pinkish to red mold but is not as common and is generally lighter in color then Serratia marcescens." "NEUROSPORA CRASSA" , is a central organism in the history of twentieth-century genetics, biochemistry and molecular biology.
Archived Article/ March 26, 2010 (Atlanta, Georgia) March 26, 2010 (Atlanta, Georgia) Nasal application of 2% mupirocin and bleach baths were found to be more effective at eradicating Staphylococcus aureus colonization than other interventions, according to the findings of a randomized trial.
Serratia Marcescens.(SM) Synonomy: Chromobacter prodigiosus, Bacterium prodigiosus, Micrococcus prodigiosus, Serratia marcescens Bizio, Zaogalactina imetropha Sette, Monas prodigiosa Ehrenberg, Palmella prodigiosa Montagne, Micrococcus prodigiosus Cohn, Bacillus prodigiosus Fluegge, Bacillus imetrophus Trevisan, Bacillus marcescens De Toni and Trevisan, "Serratia marcescens, previously called Chromobacterium prodigiosum" **** American Society for Microbiology / Infection and Immunology / Serratia
**** Biotyping of Serratia marcescens and its use in epidemiological studies. **** HEALTH EFFECTS OF PROJECT SHAD BIOLOGICAL AGENT: SERRATIA MARCESCENS **** KARGER **** Biofilm Formation and Sloughing in Serratia marcescens **** J.P. Euzby: List of Prokaryotic names with Standing in Nomenclature - Genus Serratia **** ION CHANNEL **** LABOME.org **** NCBI / Entry/ Serratia **** DSMZ **** Hopkins/ Serratia species **** DOE Genome Projects (06-Oct-2010) **** phage (wIF3) **** phiIF3 Serratia marcescens/ putative reference strain Db11
NO MERCY FOR MRSA / TREATMENT ALTERNATIVES/ Adjunctive Use Rifampin **** NO MERCY FOR MRSA: treatment alternatives to vancomycin and linezolid **** Adjunctive use of rifampin for the treatment of Staphylococcus aureus infections: a systematic review of the literature MRSA/ GREEN TEA/ Epigallocatechin Gallate **** Green Tea to fight MRSA? **** Additive, indifferent and antagonistic effects in combinations of epigallocatechin gallate with 12 non--lactam antibiotics against methicillin-resistant Staphylococcus aureus **** Mechanism of Synergy between Epigallocatechin Gallate and -Lactams against MethicillinResistant Staphylococcus aureus **** The Effect of Green Tea on the Growth and Morphology of Methicillin-resistant and Methicillinsusceptible Staphylococcus aureus CA-MRSA/ MRSA/ MSSA **** JAMA **** Genetic transfer in Staphylococcus: a case study of 13 genomes **** Use of Oligoarrays for Characterization of Community-Onset Methicillin-Resistant Staphylococcus aureus **** Genetic Changes That Correlate with Reduced Suceptibility to Daptomycin in Staphylococcus aureus **** Heterogeneity of Methicillin-Susceptible Staphylococcus aureus Strains at a German University
Hospital Implicates the Circulating-Strain Pool as a Potential Source of Emerging Methicillin-Resistant S. aureus Clones **** Laborotory Detection of Extended-Spectrum B-Lactamases (ESBLs) **** Community-acquired methicillin-resistant Staphylococcus aureus carrying Panton-Valentine leukocidin genes: WORLDWIDE EMERGENGE. **** Professional Report/ OCTENISAN **** Susceptibility of MRSA to octenidine dihydrochloride **** Studies on the Efficacy of Octenidine Dihydrochloride and Octenisan
Your Insect Bite Might be Staph! **** Hospitalizations and Deaths Caused by Methicillin-Resistant Staphylococcus aureus, United States, 19992005 **** Subtle genetic changes enhance virulence of methicillin resistant and sensitive Staphylococcus aureus **** Powerful strains of MRSA are beginning to break out of hospitals into the community. **** Community-associated MRSA: Superbug at our doorstep **** "As amoeba produce cysts to help them spread, this could mean that MRSA maybe able to be 'blown in the wind' between different locations" "This makes matters even more worrying," WHITE HOUSE CUT TESTIMONY **** NEW YORK TIMES / Infection Killed Almost 19,000 in 2005, Study Says **** REDIRECTED / CNN / Sources: White House cut testimony / "It was eviscerated", said a CDC official, familiar with both versions, who spoke on condition of anonymity because of the sensitive nature of the review process. **** Dermatology Times / April 01, 2002/ CDC downplays "mystery rash" link **** AP / 09/17/07/ Mysterious outbreak at Houston school scares parents, teachers **** MIT / TECHNOLOGY REVIEW / Biotechnologys advance could give malefactors the ability to manipulate life processes -- and even affect human behavior. **** WATCH VIDEO! CYANOBACTERIA **** WATCH VIDEO! BROWN ALGAE (PHAEOPHYCEAE = PLEOSPORALES = PHOMA SP.) **** WATCH VIDEO! ASCOMYCETES (Origin on microalgae and cyanobacteria. Very probable) **** WATCH VIDEO! SLIME MOLD/ A Model to Investigate Cytoplasmic Actomyosin **** WATCH VIDEO! MOLECULAR EXPRESSIONS/ CYANOBACTERIUM / BLUE GREEN ALGAE/ Phormidium (Algae) Movies **** WATCH VIDEO! CYANOBACTERIA PHORMIDIUM **** WATCH VIDEO! RESEARCH CHANNEL / BIOLOGY IS NANOTECHNOLOGY **** WATCH VIDEO! EUGLENA / THE EUGLENOID PROJECT Algae **** INVENTAIRE DES ALGUES DE ROSCOFF **** ALGAE INDEX / IMAGE SOURCE / FACULTADES DE CIENCIAS Y FARMACIA / UNIVERSIDAD DE NAVARRA **** UNIVERSITY OF BERKELY / CENTER FOR PHYCOLOGICAL DOCUMENTATION **** VISUALS UNLIMITED (exellent image database) **** Molecular detection of ascomycetes associated with Fucus serratus/ 1 **** Molecular detection of ascomycetes associated with Fucus serratus/ 2 **** Thornber Lab/ University of Rhode Island
**** UTEX / UNIVERSITY OF TEXAS / ALGAE COLLECTION / **** PROTIST INFORMATION CENTER (IMAGE/VIDEO DATABASE) **** Twisted Bacteria FUSARIUM **** USDA / The Fusarium International Genomics Initiative **** Fusarium-mitochondria citations **** FUSARIUM: A SIGNIFICANT EMERGING PATHOGEN **** FUSARIUM / PLEOSPORA MYCO TOXINS **** Pathogenic Fungi Database (PFDB) **** CYBERNOME **** CBMG **** BIOTA TAIWANICA **** UFRGS **** Linear mitochondrial plasmids of Fusarium oxysporum contain genes with sequence similarity to genes encoding a reverse transcriptase from Neurospora spp. **** Endophthalmitis Caused by Fusarium proliferatum **** BJ SIGNAL **** BJ ENERGY / EUGLENA / Maturation of the unusual single-cysteine (XXXCH) mitochondrial c-type cytochromes found in trypanosomatids must occur through a novel biogenesis pathway **** PROTIST INFORMATION SERVER **** INDEX EUGLENA **** The mitochondrial genome of Euglena gracilis. **** FungalGenomics **** MYCONET / 4324. Ascomycota / 4. Origin on microalgae and cyanobacteria. - Very probable. **** MYCONET / 3318. Pleosporales Luttrell ex M.E. / Notes on ascomycete systematics **** DOE FUNGAL GENOMICS PROJECT **** MYCOLEGIUM **** Revista do Instituto de Medicina Tropical de So Paulo / Pheohyphomycosis; Phoma cava; Subcutaneous mycosis **** CYANOBACTERIA/ Great Lakes Water Life / GENUS Coelosphaerium **** GEOFUNGI / BOTANICA COMPLUTENSIS / Nr. 25, 2001 **** GLOSSARY/ MYCOLOGY BIOFILM **** INDEX ARTICLES / Extracellular DNA Required for Bacterial Biofilm Formation **** GENETICS OF BIOFILMS LABORATORY **** Genetic Identification of the Main Opportunistic Mucorales **** Azithromycin Blocks Quorum Sensing and Alginate Polymer Formation and Increases the Sensitivity to Serum and Stationary-Growth-Phase Killing of Pseudomonas aeruginosa and Attenuates Chronic P. aeruginosa Lung Infection in Cftr **** Lateral Gene Transfer and Cyanobacterial Toxicity **** FUNGAL GENOMICS STOCK CENTER NEW FOR 2010: Mystery disease blights Afghan opium poppies **** Risks of Using Biological Agents to Eradicate Drug Plants **** Mystery disease blights Afghan opium poppies **** REUTERS: Mystery disease blights Afghan opium poppy crop
**** New York Times: Mysterious Blight Destroys Afghan Poppy Harvest **** Poppy disease halves Afghan opium crop **** Fungus Hits Afghan Poppies **** First Report of Downy Mildew of Opium Poppy Caused by Peronospora arborescens in Spain BIO-CONTROL **** EEUU Admite posible vnculo entre Armas Biolgicas y Agente Verde **** FIRST FIND OF YEAST LIKE CELL **** Risks of Using Biological Agents to Eradicate Drug Plants **** Molecular Identification of Fusarium Species in Onychomycoses **** Endophthalmitis Caused by Fusarium proliferatum **** Clinical and Epidemiological Aspects of Infections Caused by Fusarium Species: a Collaborative Study from Israel **** Disseminated hyalohyphomycosis caused by a novel human pathogen, Fusarium napiforme. BIO-CONTROL / AGENT GREEN / SUNSHINE PROJECT/ PROJECT BACHUS **** THE SUNSHINE PROJECT **** THE SUNSHINE PROJECT/ GERMAN WEBSITE **** ISR / PROJECT BACHUS / BIOLOGICAL WEAPONS PRODUCTION **** Risks of Using Biological Agents to Eradicate Drug Plants **** USA Admits Possible Link between Biological Weapons and Agent Green **** Biowarfare in the Andes / The labs are brewing up two types of killer fungi, Fusarium oxysporum (for use against marijuana and coca plants) and Pleospora papaveracea (to destroy opium poppies). American Phytopathological Society BIO-CONTROL / PROJECT CLEAR VISION **** THE NEW YORK TIMES **** PROJECT CLEAR VISION / U.S. Germ Warfare Research Pushes Treaty Limits **** Useful Mutants, Bred With Radiation NOSTOCOIDA / TETRASPHAERA / AVIAN VACUOLAR MYELINOPATHY / BALD EAGLE DEMISE NOSTOCOIDA LIMICOLA **** A mysterious brain disease is killing birds, It is believed that a man-made... **** INVESTIGATION OF A NOVEL EPIPHYTIC CYANOBACTERIUM ASSOCIATED WITH RESERVOIRS AFFECTED BY AVIAN VACUOLAR MYELINOPATHY **** Isolates of Candidatus Nostocoida limicola Blackall et al. 2000 should be described as three novel species of the genus Tetrasphaera, as Tetrasphaera jenkinsii sp. nov., Tetrasphaera vanveenii sp. nov. and Tetrasphaera veronensis sp. nov. **** 'Candidatus Nostocoida limicola', a filamentous bacterium from activated sludge. KEY ARTICLE: RECREATIONAL AND OCCUPATIONAL FIELD EXPOSURE TO FRESHWATER CYANOBACTERIA / Ian Stewart **** Recreational and occupational field exposure to freshwater cyanobacteria a review of anecdotal and case reports, epidemiological studies and the challenges for epidemiologic assessment KEY ARTICLE: ECOPHYSIOLOGY OF MARINE CYANOBACTERIAL BLOOMS MICROCYSTIN-LR / FAST DEATH FACTOR The microcystins are hepatotoxic products of freshwater blooms of cyanobacteria of Microcystis spp., M. aeruginosa in particular. Microcystin-LR, also known as the fast death factor, is the most common of the microcystins and presumably the toxin of choice to be weaponized. Although the aerosolized form of microcystin is the most likely threat, ingestion - even from natural sources - must be considered
a significant hazard. MICROCYSTIS-LR / PATHOGENICITY **** Freshwater cyanobacterium Microcystis aeruginosa (UTEX 2385) induced DNA damage in vivo and in vitro **** Microcystin-LR induces oxidative DNA damage in human hepatoma cell line HepG2. **** The Gas Vesicle Gene Cluster from Microcystis aeruginosa and DNA Rearrangements That Lead to Loss of Cell Buoyancy **** Allergenic (sensitization, skin and eye irritation) effects of freshwater cyanobacteria experimental evidence SAN-FRANCISCO The first distribution, biomass and toxocity study of a newly established bloom of the colonial cyanobacteria Microcystis aeruginosa was conducted on October 15, 2003, in the upper San Francisco Bay Estuary. Mycrocystis aeruginosa was widely distributed throughout 180 km of waterways in the upper San Francisco Bay Estuary from freshwater to brackish water environments and contained hepatotoxic microcystins at all stations. CYANO **** The first distribution, biomass and toxicity study of a newly established bloom of the colonial cyanobacteria Microcystis aeruginosa was conducted on October 15, 2003 in the upper San Francisco Bay Estuary. **** Evidence for Recombination in the Microcystin Synthetase (mcy) Genes of Toxic Cyanobacteria Microcystis.spp **** Systematic survey on crystalline features of algal celluloses **** Isolation, Characterization, and Quantitative Analysis of Microviridin J, a New Microcystis Metabolite Toxic to Daphnia **** Signalling through cyclic nucleotide monophosphates in cyanobacteria **** A mannan binding lectin is involved in cellcell attachment in a toxic strain of Microcystis aeruginosa **** HIDDEN ECOLOGIES? "Scientists fear catastrophic losses" **** THURSDAY / MAY 3, 2007 / Bee deaths spark food crisis fear **** MONDAY / APRIL 30, 2007 / Scientists fear catastrophic losses **** FRIDAY / APRIL 27, 2007 / Algae bloom killing wildlife off California coast **** WASHINGTON (CNN) -- Beekeepers throughout the United States have been losing between 50 and 90 percent of their honeybees over the past six months, perplexing scientists **** Humans Making Wildlife Sick PHOMA **** eT SEARCH ENGINE/ articles citing: PHOMA sp. **** Phoma Saccardo: Distribution, secondary metabolite production and biotechnological applications **** Phoma and Stemphol **** Equisetin and a novel opposite stereochemical homolog phomasetin **** (PDF) The fungal strain that produced magenta pigment was closely related to Phoma herbarum. **** Subcutaneous Infection by Phoma Species ***** A class-wide phylogenetic assessment of Dothideomycetes **** (PDF) PHOMA HERBARUM WESTENDORP / PUTATIVE AGENT OF SAPROLEGNIOSIS ? PHOMA AND SARCOIDOSIS **** Experimental Skin Sarcoidosis
**** Sarcoidosis of the Skin/ A Dermatological Puzzle **** Foundation for Sarcoidosis Research **** SUBCUTANEOUS PHEOHYPHOMYCOSIS CAUSED BY Phoma cava. CLICK IMAGE TO OBTAIN PSI BLAST RESULTS BASED ON ITS PHOMA SP. ITS PHOMA sp. >Contig_1 ATCATTAAATACAGTAGATTTCTACTGATCGGGGGGGGTGGAAAGTCCCAGTTTGATTACTG GATCGCGAGTAAGCCCC CTGTCTGCACCCTTGTCTTTTGCGTACTTATGTTTCCTCGGCGGGCTTGCCTGCCGAATGGA CAATTCTAAAACCTTTT TAATTTTCAATCAGCGTCTGAACAATTATAATAATTACAACTTTCAACAACGGATCTCTTGGT TCTGGCATCGATGAAG AACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTG AACGCACATTGCGCCCCT TGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTATGCTTGGTGTTG GGTGTTTGTCCTCTCC CTTGCGTTTGGACTCGCCTTAAAGAAATTGGCAGCCAGTGTATTGGTATAGAAGCGCAGCA CAATTTGCGACTCTAGCT AATAATTACTTGCAACCATCAAGTCTA //// ITS AGROCYBE PEDIADES (Fr.) FAYOD >Contig_1 CCGAGGCAACTCGGTCGGGAGGACTGCTGGCTTTCACGAGTCGGCTTTCCTTGTATTATCC AGGCCTATGTCTTACACA TACCCCAAAGAATGTAACAGAATGTATTGTATATGGCCTAGTGCCTATAAACTATATACAACT TTCAGCAACGGATCTC TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATT CAGTGAATCATCGAATCT TTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATT CTCAACCTTATTAGCTT TTGCTGATAATGGCTTGGACTTGGGGGTCTTTTTGCTGGCTTTCATTAGTCTGCTCCCCTTAA ATGTATTAGCCGGTGC CCCGCAGTGGAACCGTCTATTGGTGTGATAATTATCTACGCCGTGGACGTCTGCTATAATGG GTTTGCGCTGCTTCTAA CCGTCTCTCGGGACAACACAAATGACAA Phoma and related pleosporalean genera Highlights of the Didymellaceae: A polyphasic approach to characterise Phoma and related pleosporalean genera Fungal taxonomists routinely encounter problems when dealing with asexual fungal species due to poly- and paraphyletic generic phylogenies, and unclear species boundaries. These problems are aptly illustrated in the genus Phoma. This phytopathologically significant fungal genus is currently subdivided into nine sections which are mainly based on a single or just a few morphological characters. However, this subdivision is ambiguous as several of the section-specific characters can occur within a single species. In addition, many teleomorph genera have been linked to Phoma, three of which are recognised here. In this study it is attempted to delineate generic boundaries, and to come to a generic circumscription which is more correct from an evolutionary point of view by means of multilocus sequence typing. Therefore, multiple analyses were conducted utilising sequences obtained from 28S nrDNA (Large Subunit - LSU), 18S nrDNA (Small Subunit - SSU), the Internal Transcribed Spacer regions 1 & 2 and 5.8S nrDNA (ITS), and part of the -tubulin (TUB) gene region. A total of 324 strains were included in the analyses of which most belonged to Phoma taxa, whilst 54 to related pleosporalean fungi. In total, 206 taxa were investigated, of which 159 are known to have affinities to Phoma. The phylogenetic analysis revealed that the current Boeremaean subdivision is incorrect from
an evolutionary point of view, revealing the genus to be highly polyphyletic. Phoma species are retrieved in six distinct clades within the Pleosporales, and appear to reside in different families. The majority of the species, however, including the generic type, clustered in a recently established family, Didymellaceae. In the second part of this study, the phylogenetic variation of the species and varieties in this clade was further assessed. Next to the genus Didymella, which is considered to be the sole teleomorph of Phoma s. str., we also retrieved taxa belonging to the teleomorph genera Leptosphaerulina and Macroventuria in this clade. Based on the sequence data obtained, the Didymellaceae segregate into at least 18 distinct clusters, of which many can be associated with several specific taxonomic characters. Four of these clusters were defined well enough by means of phylogeny and morphology, so that the associated taxa could be transferred to separate genera. Aditionally, this study addresses the taxonomic description of eight species and two varieties that are novel to science, and the recombination of 61 additional taxa. Keywords: Boeremia, coelomycetes, Didymella, Didymellaceae, DNA phylogeny, Epicoccum, Leptosphaerulina, Macroventuria, Peyronellaea, Phoma, Pleosporales, taxonomy, Stagonosporopsis Related article/ Click titel: Multiple Didymella teleomorphs are linked to the Phoma clematidina morphotype Articles from Studies in Mycology are provided here courtesy of CBS Fungal Biodiversity Centre Copyright 2010 CBS Fungal Biodiversity Centre PHOMA spp. "In hairy areas, the fungi grow around the hair shaft" **** NCBI / Link to Phoma **** Phoma spp. **** Sekundrstoffe aus endophytischen Pilzen mariner Habitate und Abbaureaktionen an Simocyclinon D8 **** PHOMA/ Anamorph genera associated with Botryosphaeria **** Synonym and Classification Data for Phoma spp. **** PHOMA SPP. FACT SHEET **** Human Phaeohyphomycotic Osteomyelitis Caused by the Coelomycete Phomopsis Saccardo 1905: Criteria for Identification, Case History, and Therapy **** ITS sequencing support for Epicoccum nigrum and Phoma epicoccina being the same biological species **** Association of a new species of Phoma with Pleospora Herbarum (Pers.) Rahb -**** ARTICLE: Applied and Environmental Microbiology/ Characterization and Differentiation of... (Phoma = Myrothecium = Malbranchea) **** Some isolates originally identified as E. nigrum developed a "Phoma-like" pycnidial state **** Evidence of the production of silver nanoparticles via ... **** Nomenclatural Fact Sheet - Phoma crystalliniformis **** Fungi: Phoma **** Phoma glomerata as a Mycoparasite of Powdery Mildew **** First report of Phoma sorghina (Sacc.) **** Extracellular lipolytic activity in Phoma glomerata **** Identification of Sources of Resistance to Phoma medicaginis Isolates in Medicago truncatula
SARDI Core Collection Accessions, and Multigene Differentiation of Isolates FUSARIUM SOLANI / PHOMA TELEOMORPH - ANAMORPH - HOLOMORPH - SYNANAMORPS **** teleomorph, anamorph, holomorph and synanamorphs. **** ANAMORPH INDEX GLOBAL BIODOVERSITY INFORMATION FACILITY Synonyms: Naucoria vervacti, Agrocybe arvalis, Agaricus arenicola, Agaricus temulentus, Agrocybe temulenta, Agrocybe arenaria, Agrocybe subpediades, Naucoria subpediades, Naucoria temulenta, Agrocybe temulenta, Pseudodeconica semiorbicularis, Naucoria pediades, Agaricus pediades, Agrocybe arenicola, Agrocybe semiorbicularis, Nolanea pediades, Naucoria semiorbicularis, Naucoria arenaria, Agaricus semiorbicularis KEY ARTICLE: FREDERICKS ET AL / VETERANS AFFAIRS / GULF WAR RELATED SYNDROME ***** FREDERICKS ET AL: ARCHIVED ARTICLES WILL SHOW UP MID PAGE ***** GULF WAR RELATED SYNDROME **** Surface signaling in pathogenesis. **** Disseminated hyalohyphomycosis caused by a novel human pathogen, Fusarium napiforme. **** The First Find of Yeast-like Cells of Fusarium moniliforme and Mechanism of Infection Injury. **** Disseminated infection by Fusarium moniliforme during treatment for malignant lymphoma. **** Genetic diversity of human pathogenic members of the Fusarium oxysporum complex inferred from multilocus DNA sequence data and amplified fragment length polymorphism analyses: evidence for the recent dispersion of a geographically widespread clonal lineage and nosocomial origin QUORUM SENSING **** QUORUM SENSING VIDEO / The Biofilm Lifecycle / ANIMATION ARCHIVE **** Surface-active proteins enable microbial aerial hyphae to grow into the air **** Plants and animals both listen to and disrupt bacterial quorum sensing signaling, prompting interest in mechanisms, applications **** Quorum sensing and bacterial cross-talk in biotechnology **** Slimy businessthe biotechnology of biofilms **** Bacterial Quorum Sensing in Pathogenic Relationships **** MicroMeeting **** Bugging the Bugs **** MICROBES, IMMUNITY, AND DISEASE: A Symphony of Bacterial Voices **** Revisiting quorum sensing: Discovery of additional chemical and biological functions for 3-oxoN-acylhomoserine lactones **** Molecular structure is solved for key protein of quorum-sensing bacteria MESOMYCETOZOEA / DRIP CLADE / AQUATIC MOLD / RHINOSPORIDOSIS **** The two Dermocystidium species resemble Rhinosporidium **** USE OF STILBENE DERIVATIVES FOR TREATMENT AND PREVENTION OF AQUATIC MOLD INFECTIONS **** FAO / Saprolegnia AND OTHER PHYCOMYCETE INFECTIONS [DERMAL MYCOSES] **** Parasitism by Dermocystidium ranae **** Observations on the Life Stages of Sphaerothecum destruens n. g., n. sp., a Mesomycetozoean Fish Pathogen Formally Referred to as the Rosette Agent **** Differentiation between Prototheca and morphologically similar green algae in tissue. **** A molecular phylogeny of Pythium insidiosum
**** Development of an Immunochromatographic Test for Rapid Serodiagnosis of Human Pythiosis **** Lacazia Loboi and Rhinosporidium seeberi; a genomic perspective **** Molecular Model for Studying the Uncultivated Fungal Pathogen Lacazia loboi **** Nature and significance of the electron-dense bodies of the endospores of Rhinosporidium seeberi **** Phylogenetic Analysis of Rhinosporidium seeberi **** A new rubisco-like protein coexists with a photosynthetic rubisco in the planktonic cyanobacteria Microcystis. **** Algae as Tools in the Study of Cellulose **** Rhinosporidium seeberi: A Human Pathogen From a Novel Group of Aquatic Protistan Parasites **** Phylogenetic Analysis of Rhinosporidium seeberi's 18S Small-Subunit Ribosomal DNA Groups This Pathogen among Members of the Protoctistan Mesomycetozoa Clade **** Altered expression of two light-dependent genes in a microcystin-lacking mutant of Microcystis aeruginosa PCC 7806. **** Evidence for recombination in the microcystin synthetase **** Report of the First Human Case of Lobomycosis in the United States **** Transcription and in vivo expression of a Microcystis aeruginosa plasmid **** Fungal and Parasitic Infections of the Eye **** Recreational and occupational field exposure to freshwater cyanobacteria a review of anecdotal and case reports, epidemiological studies and the challenges for epidemiologic assessment **** Molecular Model for Studying the Uncultivated Fungal Pathogen Lacazia loboi THE WALL STREET JOURNAL / THE INFORMED READER / DISEASE OR DELUSION? **** THE WALL STREET JOURNAL **** THE INFORMED READER / DISEASE OR DELUSION? **** Ear Bacteria Resist Treatment **** HEALTH **** Dettol Man or Lysol: too much of a good sanitizer can kill QUICK DETAIL The abbreviation (sp.) used after a genus name refers to an undetermined species; (spp.) after a genus name refers to several species without naming them individually. THE MYSTERIOUS RELATIONSHIPS OF RHINOSPORIDOSIS SEEBERI **** THE MYSTERIOUS RELATIONSHIPS OF RHINOSPORIDOSIS SEEBERI **** Lymphadenitis, trans-epidermal elimination and unusualhistopathology in human rhinosporidiosis CAUSATIVE AGENT OF RHINOSPORIDOSIS IS MICROCYSTIS SP. ? **** Why did previous investigators not find well-defined mitochondria? I am convinced that these mitochondria are from human cells Emerging (unusual nosocomial) Infections **** Epidemiology and Clinical Aspects of Unusual Fungal Nosocomial Infections **** Fungal and Parasitic Infections of the Eye **** In-vitro antifungal susceptibility of clinical and environmental Fusarium spp. strains **** Cutaneous Infection by Fusarium Species in Healthy and Immunocompromised Hosts: Implications for Diagnosis and Management **** Fatal disseminated fusarium infection in acute lymphoblastic leukaemia in complete remission **** Fusarium Outbreak: Lessons Learned **** The effect of propyl gallate on the activity of various antifungal drugs against filamentous fungi in vitro. **** Fusarium, a Significant Emerging Pathogen "A NEW WAY TO LOOK AT FILAMENTS" **** A NEW WAY TO LOOK AT FILAMENTS **** Isolation and cultivation of filamentous bacteria implicated in...
Cellular fatty acids as chemotaxonomic markers of the genera.... **** Cellular fatty acids as chemotaxonomic markers of the genera Anabaena, Aphanizomenon, Microcystis, Nostoc and Planktothrix (cyanobacteria) **** The clade containing filamentous heterocystous cyanobacteria was divided into three discrete groups of.... GAS VACUOLES, ELECTRON-DENSE BODIES AND VIRUS **** The result of electron microscopic investigation of gas-vacuoles in a culture of the benthal alga Oscillatoria chalybea was compared with the extensive literature concerning gas-vacuole formation and virus infection in bacteria and animals. **** Gas vesicle proteins **** Nauture and significance of the electron-dense bodies.... CLASSIFICATION **** Molecular characterization of planktic cyanobacteria of Anabaena, Aphanizomenon, Microcystis and Planktothrix genera **** Quantitative Real-Time PCR Detection of Toxic Nodularia Cyanobacteria in the Baltic Sea **** A proposal for the unification of five species of the cyanobacterial genus Microcystis Kutzing ex Lemmermann 1907 under the Rules of the Bacteriological Code **** A proposal for further integration of the cyanobacteria under the Bacteriological Code **** TAXONOMY BROWSER **** Systematic-bacteriology--Enterobacteriaceae INDEX DATASERVICES **** SANGER/ Staphylococcus aureus Blast **** List of Prokaryotic names with Standing in Nomenclature **** BLAST INFORMATION **** MAX PLANCK INSTITUTE FOR TERRESTRIAL MICROBIOLOGY (INDEX) **** BROAD INSTITUTE **** IMMUNEEPITOPE **** MAX PLANCK / BIO-MEDICAL **** JVI / CMR (MICROBIAL GENOMES) **** CYANOBASE **** CYANOBASE LINKS **** Synechocystis PCC6803 and Anabaena PCC7120 **** NCBI / BLAST (Basic Local Alignment Search Tool) **** BIOTA TAIWANICA **** Neosartorya fischeri Genome Project **** LANL **** FASTA **** DOE **** EMBL-EBI **** RNA RIBOSOMAL DATABASE **** PFAM/ DB / SANGER **** FUNGAL GENOMES SEARCH **** GOBASE **** GenDis **** IMG **** DDBJ / DNA DATA BANK OF JAPAN **** NEMATOSTELLA VECTENSIS DATA BASE **** INSDC **** CABI Bioscience Databases
**** BIOAFRICA **** ESTREE **** SGD SITE MAP **** TREEBASE **** CLCBIO **** MYCOBANK **** GLOBAL BIODIVERSITY INFORMATION FACILITY **** USDA AGRICULTURAL RESEARCH SERVICE **** BRENDA **** FLYBASE **** PASTEUR/ CYANOLIST **** Genstyle Companion Database Browser **** YEASTGENOME **** YCR (YEAST RESOURCE CENTER) ARCHIVE 2007 (51) 2008 (1) 2010 (1) 2012 (1) January (1) DIRTY PRACTICE/ SCIENTIFIC MISCONDUCT DIRTY PRACTICE/ SCIENTIFIC MISCONDUCT BLEACH BATHS MARCH 2010 March 26, 2010 (Atlanta, Georgia) Nasal application of 2% mupirocin and bleach baths were found to be more effective at eradicating Staphylococcus aureus colonization than other interventions, according to the findings of a randomized trial. Bernard C. Camins, MD, from the Division of Infectious Diseases at the Washington University School of Medicine in St. Louis, Missouri, reported the findings here at the Fifth Decennial International Conference on Healthcare-Associated Infections 2010. According to the researchers, a variety of strategies have been used to decolonize patients with varying results, and there are "no published data on controlled trials evaluating the optimal methods for decolonization and their efficacy in preventing recurrent S aureus infections." Dr. Camins and colleagues evaluated the effectiveness of decolonization methods in the eradication of S aureus carriage in 193 children and 107 adults presenting with community-acquired S aureus skin and soft tissue infections. In addition to education on personal hygiene, all eligible patients were randomize to 1 of 4 groups: no intervention (control); application of 2% mupirocin ointment to both anterior nares twice daily for 5 days; application of 2% mupirocin ointment intranasally plus daily showers with 4% chlorhexidine solution for 5 days; and application of 2% mupirocin ointment intranasally plus daily 30-minute soaks in dilute bleach water for 5 days. Of the patients, 68% were colonized with methicillin-resistant S aureus (MRSA) and 32% were colonized with methicillin-sensitive S aureus alone. All interventions were effective 1 month postintervention at eradicating S aureus carriage, compared with the control group. At 4 months postintervention, only the mupirocin plus bleach bath was found to be effective at eradicating S aureus colonization (69% vs 48%; relative risk, 1.26; 95% confidence interval, 1.05 2.01; P = .02). All treatment groups were well tolerated, with dry skin being the most common adverse effect. "This current study is a pilot feasibility study for a larger trial to determine whether decolonization
would prevent future episodes of skin and soft tissue infection," Dr. Camins told Medscape Infectious Diseases. "Before we completed the trial, decolonization methods were being used clinically without any scientific data supporting their use," he said. "Now that we have completed our trial, at least clinicians can feel comfortable recommending the intranasal application of mupirocin plus bleach baths in patients with recurrent community-acquired MRSA skin/soft tissue infections," he said. Dr. Camins added that they were surprised that the mupirocin plus chlorhexidine intervention did not lead to decolonization, compared with the control group, at 4 months. According to Keith M. Ramsey, MD, from the Brody School of Medicine at East Carolina University in Greenville, North Carolina, who attended the meeting, the addition of the diluted 30-minute bleach bath to nasal mupirocintreatments, resulting in two thirds of the S aureus carriers remaining free of carriage for up to 4 months, is a new finding, and should be explored in larger studies. Dr. Ramsey told Medscape infectious Diseases that "it would be interesting to follow the subjects in the treatment arms to determine if any of the decolonization regimens result in differences in subsequent or recurrent clinical disease with S aureus or MRSA." This study was supported by an unrestricted grant from Pfizer. Chlorhexidine solution was provided by Mlnlycke Health Care. Taro Pharmaceuticals contributed generic mupirocin ointment. Dr. Camins reports being a consultant for Pfizer. Dr. Ramsey reports being a consultant for BD GeneOhm and on the speakers' bureau for MedImmune, Cubist, and OrthoMcNeil. Fifth Decennial International Conference on Healthcare-Associated Infections (ICHAI) 2010: Abstract 502. Presented March 20, 2010. **** KEY ARTICLES VIA: Fungal Genomes and Comparative Genomics **** Uncultivable bacteria: Implications and recent trends towards identification Older Posts Home Developments in Fungal Taxonomy GENERAL CONCLUSIONS Fungal systematics is still based mainly on morphological criteria, and pathogenic fungi are usually recognized and identified basically by their phenotypes. Numerous alternative approaches have been developed, including nutritional and physiological studies, serologic tests, secondary metabolites, ubiquinone systems, and fatty acids. Although some of these are very useful for identifying poorly differentiated fungi such as yeasts and black yeasts, they are only complementary tools of morphological data in most cases. Molecular biology techniques, especially the analysis of rRNA sequences, are currently used for reliable phylogenetic studies, which enable a more natural classification system to be established. However, despite the effective application of these techniques in PCRmediated identification systems, they are not yet currently available in the routine clinical mycology environment. The constant discovery of new emerging mycotic agents in different clinical settings that often affect critically ill patients increases the need for the development of rapid and accurate identification systems, since delay in the diagnosis and initiation of therapy leads to a high mortality rate. On the other hand, if the isolates described in a report are discarded after a study finishes, the etiological data cannot then be checked in any further investigations (119). Therefore,
contemporary practitioners and laboratorians should contact expert mycologists to identify the clinical isolates correctly and should deposit the strains in a reference culture collection. Most of these isolates must be reidentified by modern methods for a critical evaluation of the clinical cases. The problem of numerous undescribed species, together with the superficial level of knowledge that we have even for the fungi which have names, argues for a much greater emphasis on fungal biosystematics in the future. More attention to medical mycology and increased funding for training of medical mycologists are critical to address the current threats from new and reemerging fungal infections. **** TmPrime/ Agrocybe Pediades Awesome Inc. template. Powered by Blogger.
(1)"While environmental SERRATIA MARCESCENS strains are often red, due to the production of prodigiosin, the strains associated with hospital outbreaks are mostly non-pigmented." "NEUROSPORA CRASSA" is a pinkish to red mold but is not as common and is generally lighter in color then Serratia marcescens." "NEUROSPORA CRASSA" , is a central organism in the history of twentieth-century genetics, biochemistry and molecular biology.
Archived Article/ March 26, 2010 (Atlanta, Georgia) March 26, 2010 (Atlanta, Georgia) Nasal application of 2% mupirocin and bleach baths were found to be more effective at eradicating Staphylococcus aureus colonization than other interventions, according to the findings of a randomized trial.
Serratia Marcescens.(SM) Synonomy: Chromobacter prodigiosus, Bacterium prodigiosus, Micrococcus prodigiosus, Serratia marcescens Bizio, Zaogalactina imetropha Sette, Monas prodigiosa Ehrenberg, Palmella prodigiosa Montagne, Micrococcus prodigiosus Cohn, Bacillus prodigiosus Fluegge, Bacillus
imetrophus Trevisan, Bacillus marcescens De Toni and Trevisan, "Serratia marcescens, previously called Chromobacterium prodigiosum" **** American Society for Microbiology / Infection and Immunology / Serratia **** Biotyping of Serratia marcescens and its use in epidemiological studies. **** HEALTH EFFECTS OF PROJECT SHAD BIOLOGICAL AGENT: SERRATIA MARCESCENS **** KARGER **** Biofilm Formation and Sloughing in Serratia marcescens **** J.P. Euzby: List of Prokaryotic names with Standing in Nomenclature - Genus Serratia **** ION CHANNEL **** LABOME.org **** NCBI / Entry/ Serratia **** DSMZ **** Hopkins/ Serratia species **** DOE Genome Projects (06-Oct-2010) **** phage (wIF3) **** phiIF3 Serratia marcescens/ putative reference strain Db11
NO MERCY FOR MRSA / TREATMENT ALTERNATIVES/ Adjunctive Use Rifampin **** NO MERCY FOR MRSA: treatment alternatives to vancomycin and linezolid **** Adjunctive use of rifampin for the treatment of Staphylococcus aureus infections: a systematic review of the literature MRSA/ GREEN TEA/ Epigallocatechin Gallate **** Green Tea to fight MRSA? **** Additive, indifferent and antagonistic effects in combinations of epigallocatechin gallate with 12 non--lactam antibiotics against methicillin-resistant Staphylococcus aureus **** Mechanism of Synergy between Epigallocatechin Gallate and -Lactams against MethicillinResistant Staphylococcus aureus **** The Effect of Green Tea on the Growth and Morphology of Methicillin-resistant and Methicillinsusceptible Staphylococcus aureus CA-MRSA/ MRSA/ MSSA **** JAMA **** Genetic transfer in Staphylococcus: a case study of 13 genomes **** Use of Oligoarrays for Characterization of Community-Onset Methicillin-Resistant Staphylococcus aureus
**** Genetic Changes That Correlate with Reduced Suceptibility to Daptomycin in Staphylococcus aureus **** Heterogeneity of Methicillin-Susceptible Staphylococcus aureus Strains at a German University Hospital Implicates the Circulating-Strain Pool as a Potential Source of Emerging Methicillin-Resistant S. aureus Clones **** Laborotory Detection of Extended-Spectrum B-Lactamases (ESBLs) **** Community-acquired methicillin-resistant Staphylococcus aureus carrying Panton-Valentine leukocidin genes: WORLDWIDE EMERGENGE. **** Professional Report/ OCTENISAN **** Susceptibility of MRSA to octenidine dihydrochloride **** Studies on the Efficacy of Octenidine Dihydrochloride and Octenisan
Your Insect Bite Might be Staph! **** Hospitalizations and Deaths Caused by Methicillin-Resistant Staphylococcus aureus, United States, 19992005 **** Subtle genetic changes enhance virulence of methicillin resistant and sensitive Staphylococcus aureus **** Powerful strains of MRSA are beginning to break out of hospitals into the community. **** Community-associated MRSA: Superbug at our doorstep **** "As amoeba produce cysts to help them spread, this could mean that MRSA maybe able to be 'blown in the wind' between different locations" "This makes matters even more worrying," WHITE HOUSE CUT TESTIMONY **** NEW YORK TIMES / Infection Killed Almost 19,000 in 2005, Study Says **** REDIRECTED / CNN / Sources: White House cut testimony / "It was eviscerated", said a CDC official, familiar with both versions, who spoke on condition of anonymity because of the sensitive nature of the review process. **** Dermatology Times / April 01, 2002/ CDC downplays "mystery rash" link **** AP / 09/17/07/ Mysterious outbreak at Houston school scares parents, teachers **** MIT / TECHNOLOGY REVIEW / Biotechnologys advance could give malefactors the ability to manipulate life processes -- and even affect human behavior. **** WATCH VIDEO! CYANOBACTERIA **** WATCH VIDEO! BROWN ALGAE (PHAEOPHYCEAE = PLEOSPORALES = PHOMA SP.) **** WATCH VIDEO! ASCOMYCETES (Origin on microalgae and cyanobacteria. Very probable) **** WATCH VIDEO! SLIME MOLD/ A Model to Investigate Cytoplasmic Actomyosin **** WATCH VIDEO! MOLECULAR EXPRESSIONS/ CYANOBACTERIUM / BLUE GREEN ALGAE/ Phormidium (Algae) Movies **** WATCH VIDEO! CYANOBACTERIA PHORMIDIUM **** WATCH VIDEO! RESEARCH CHANNEL / BIOLOGY IS NANOTECHNOLOGY **** WATCH VIDEO! EUGLENA / THE EUGLENOID PROJECT Algae **** INVENTAIRE DES ALGUES DE ROSCOFF **** ALGAE INDEX / IMAGE SOURCE / FACULTADES DE CIENCIAS Y FARMACIA / UNIVERSIDAD DE NAVARRA **** UNIVERSITY OF BERKELY / CENTER FOR PHYCOLOGICAL DOCUMENTATION **** VISUALS UNLIMITED (exellent image database)
**** Molecular detection of ascomycetes associated with Fucus serratus/ 1 **** Molecular detection of ascomycetes associated with Fucus serratus/ 2 **** Thornber Lab/ University of Rhode Island **** UTEX / UNIVERSITY OF TEXAS / ALGAE COLLECTION / **** PROTIST INFORMATION CENTER (IMAGE/VIDEO DATABASE) **** Twisted Bacteria FUSARIUM **** USDA / The Fusarium International Genomics Initiative **** Fusarium-mitochondria citations **** FUSARIUM: A SIGNIFICANT EMERGING PATHOGEN **** FUSARIUM / PLEOSPORA MYCO TOXINS **** Pathogenic Fungi Database (PFDB) **** CYBERNOME **** CBMG **** BIOTA TAIWANICA **** UFRGS **** Linear mitochondrial plasmids of Fusarium oxysporum contain genes with sequence similarity to genes encoding a reverse transcriptase from Neurospora spp. **** Endophthalmitis Caused by Fusarium proliferatum **** BJ SIGNAL **** BJ ENERGY / EUGLENA / Maturation of the unusual single-cysteine (XXXCH) mitochondrial c-type cytochromes found in trypanosomatids must occur through a novel biogenesis pathway **** PROTIST INFORMATION SERVER **** INDEX EUGLENA **** The mitochondrial genome of Euglena gracilis. **** FungalGenomics **** MYCONET / 4324. Ascomycota / 4. Origin on microalgae and cyanobacteria. - Very probable. **** MYCONET / 3318. Pleosporales Luttrell ex M.E. / Notes on ascomycete systematics **** DOE FUNGAL GENOMICS PROJECT **** MYCOLEGIUM **** Revista do Instituto de Medicina Tropical de So Paulo / Pheohyphomycosis; Phoma cava; Subcutaneous mycosis **** CYANOBACTERIA/ Great Lakes Water Life / GENUS Coelosphaerium **** GEOFUNGI / BOTANICA COMPLUTENSIS / Nr. 25, 2001 **** GLOSSARY/ MYCOLOGY BIOFILM **** INDEX ARTICLES / Extracellular DNA Required for Bacterial Biofilm Formation **** GENETICS OF BIOFILMS LABORATORY **** Genetic Identification of the Main Opportunistic Mucorales **** Azithromycin Blocks Quorum Sensing and Alginate Polymer Formation and Increases the Sensitivity to Serum and Stationary-Growth-Phase Killing of Pseudomonas aeruginosa and Attenuates Chronic P. aeruginosa Lung Infection in Cftr **** Lateral Gene Transfer and Cyanobacterial Toxicity **** FUNGAL GENOMICS STOCK CENTER NEW FOR 2010: Mystery disease blights Afghan opium poppies
**** Risks of Using Biological Agents to Eradicate Drug Plants **** Mystery disease blights Afghan opium poppies **** REUTERS: Mystery disease blights Afghan opium poppy crop **** New York Times: Mysterious Blight Destroys Afghan Poppy Harvest **** Poppy disease halves Afghan opium crop **** Fungus Hits Afghan Poppies **** First Report of Downy Mildew of Opium Poppy Caused by Peronospora arborescens in Spain BIO-CONTROL **** EEUU Admite posible vnculo entre Armas Biolgicas y Agente Verde **** FIRST FIND OF YEAST LIKE CELL **** Risks of Using Biological Agents to Eradicate Drug Plants **** Molecular Identification of Fusarium Species in Onychomycoses **** Endophthalmitis Caused by Fusarium proliferatum **** Clinical and Epidemiological Aspects of Infections Caused by Fusarium Species: a Collaborative Study from Israel **** Disseminated hyalohyphomycosis caused by a novel human pathogen, Fusarium napiforme. BIO-CONTROL / AGENT GREEN / SUNSHINE PROJECT/ PROJECT BACHUS **** THE SUNSHINE PROJECT **** THE SUNSHINE PROJECT/ GERMAN WEBSITE **** ISR / PROJECT BACHUS / BIOLOGICAL WEAPONS PRODUCTION **** Risks of Using Biological Agents to Eradicate Drug Plants **** USA Admits Possible Link between Biological Weapons and Agent Green **** Biowarfare in the Andes / The labs are brewing up two types of killer fungi, Fusarium oxysporum (for use against marijuana and coca plants) and Pleospora papaveracea (to destroy opium poppies). American Phytopathological Society BIO-CONTROL / PROJECT CLEAR VISION **** THE NEW YORK TIMES **** PROJECT CLEAR VISION / U.S. Germ Warfare Research Pushes Treaty Limits **** Useful Mutants, Bred With Radiation NOSTOCOIDA / TETRASPHAERA / AVIAN VACUOLAR MYELINOPATHY / BALD EAGLE DEMISE NOSTOCOIDA LIMICOLA **** A mysterious brain disease is killing birds, It is believed that a man-made... **** INVESTIGATION OF A NOVEL EPIPHYTIC CYANOBACTERIUM ASSOCIATED WITH RESERVOIRS AFFECTED BY AVIAN VACUOLAR MYELINOPATHY **** Isolates of Candidatus Nostocoida limicola Blackall et al. 2000 should be described as three novel species of the genus Tetrasphaera, as Tetrasphaera jenkinsii sp. nov., Tetrasphaera vanveenii sp. nov. and Tetrasphaera veronensis sp. nov. **** 'Candidatus Nostocoida limicola', a filamentous bacterium from activated sludge. KEY ARTICLE: RECREATIONAL AND OCCUPATIONAL FIELD EXPOSURE TO FRESHWATER CYANOBACTERIA / Ian Stewart **** Recreational and occupational field exposure to freshwater cyanobacteria a review of anecdotal and case reports, epidemiological studies and the challenges for epidemiologic assessment KEY ARTICLE: ECOPHYSIOLOGY OF MARINE CYANOBACTERIAL BLOOMS MICROCYSTIN-LR / FAST DEATH FACTOR The microcystins are hepatotoxic products of freshwater blooms of cyanobacteria of Microcystis spp.,
M. aeruginosa in particular. Microcystin-LR, also known as the fast death factor, is the most common of the microcystins and presumably the toxin of choice to be weaponized. Although the aerosolized form of microcystin is the most likely threat, ingestion - even from natural sources - must be considered a significant hazard. MICROCYSTIS-LR / PATHOGENICITY **** Freshwater cyanobacterium Microcystis aeruginosa (UTEX 2385) induced DNA damage in vivo and in vitro **** Microcystin-LR induces oxidative DNA damage in human hepatoma cell line HepG2. **** The Gas Vesicle Gene Cluster from Microcystis aeruginosa and DNA Rearrangements That Lead to Loss of Cell Buoyancy **** Allergenic (sensitization, skin and eye irritation) effects of freshwater cyanobacteria experimental evidence SAN-FRANCISCO The first distribution, biomass and toxocity study of a newly established bloom of the colonial cyanobacteria Microcystis aeruginosa was conducted on October 15, 2003, in the upper San Francisco Bay Estuary. Mycrocystis aeruginosa was widely distributed throughout 180 km of waterways in the upper San Francisco Bay Estuary from freshwater to brackish water environments and contained hepatotoxic microcystins at all stations. CYANO **** The first distribution, biomass and toxicity study of a newly established bloom of the colonial cyanobacteria Microcystis aeruginosa was conducted on October 15, 2003 in the upper San Francisco Bay Estuary. **** Evidence for Recombination in the Microcystin Synthetase (mcy) Genes of Toxic Cyanobacteria Microcystis.spp **** Systematic survey on crystalline features of algal celluloses **** Isolation, Characterization, and Quantitative Analysis of Microviridin J, a New Microcystis Metabolite Toxic to Daphnia **** Signalling through cyclic nucleotide monophosphates in cyanobacteria **** A mannan binding lectin is involved in cellcell attachment in a toxic strain of Microcystis aeruginosa **** HIDDEN ECOLOGIES? "Scientists fear catastrophic losses" **** THURSDAY / MAY 3, 2007 / Bee deaths spark food crisis fear **** MONDAY / APRIL 30, 2007 / Scientists fear catastrophic losses **** FRIDAY / APRIL 27, 2007 / Algae bloom killing wildlife off California coast **** WASHINGTON (CNN) -- Beekeepers throughout the United States have been losing between 50 and 90 percent of their honeybees over the past six months, perplexing scientists **** Humans Making Wildlife Sick PHOMA **** eT SEARCH ENGINE/ articles citing: PHOMA sp. **** Phoma Saccardo: Distribution, secondary metabolite production and biotechnological applications **** Phoma and Stemphol **** Equisetin and a novel opposite stereochemical homolog phomasetin **** (PDF) The fungal strain that produced magenta pigment was closely related to Phoma herbarum. **** Subcutaneous Infection by Phoma Species ***** A class-wide phylogenetic assessment of Dothideomycetes
**** (PDF) PHOMA HERBARUM WESTENDORP / PUTATIVE AGENT OF SAPROLEGNIOSIS ? PHOMA AND SARCOIDOSIS **** Experimental Skin Sarcoidosis **** Sarcoidosis of the Skin/ A Dermatological Puzzle **** Foundation for Sarcoidosis Research **** SUBCUTANEOUS PHEOHYPHOMYCOSIS CAUSED BY Phoma cava. CLICK IMAGE TO OBTAIN PSI BLAST RESULTS BASED ON ITS PHOMA SP. ITS PHOMA sp. >Contig_1 ATCATTAAATACAGTAGATTTCTACTGATCGGGGGGGGTGGAAAGTCCCAGTTTGATTACTG GATCGCGAGTAAGCCCC CTGTCTGCACCCTTGTCTTTTGCGTACTTATGTTTCCTCGGCGGGCTTGCCTGCCGAATGGA CAATTCTAAAACCTTTT TAATTTTCAATCAGCGTCTGAACAATTATAATAATTACAACTTTCAACAACGGATCTCTTGGT TCTGGCATCGATGAAG AACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTG AACGCACATTGCGCCCCT TGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTATGCTTGGTGTTG GGTGTTTGTCCTCTCC CTTGCGTTTGGACTCGCCTTAAAGAAATTGGCAGCCAGTGTATTGGTATAGAAGCGCAGCA CAATTTGCGACTCTAGCT AATAATTACTTGCAACCATCAAGTCTA //// ITS AGROCYBE PEDIADES (Fr.) FAYOD >Contig_1 CCGAGGCAACTCGGTCGGGAGGACTGCTGGCTTTCACGAGTCGGCTTTCCTTGTATTATCC AGGCCTATGTCTTACACA TACCCCAAAGAATGTAACAGAATGTATTGTATATGGCCTAGTGCCTATAAACTATATACAACT TTCAGCAACGGATCTC TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATT CAGTGAATCATCGAATCT TTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATT CTCAACCTTATTAGCTT TTGCTGATAATGGCTTGGACTTGGGGGTCTTTTTGCTGGCTTTCATTAGTCTGCTCCCCTTAA ATGTATTAGCCGGTGC CCCGCAGTGGAACCGTCTATTGGTGTGATAATTATCTACGCCGTGGACGTCTGCTATAATGG GTTTGCGCTGCTTCTAA CCGTCTCTCGGGACAACACAAATGACAA Phoma and related pleosporalean genera Highlights of the Didymellaceae: A polyphasic approach to characterise Phoma and related pleosporalean genera Fungal taxonomists routinely encounter problems when dealing with asexual fungal species due to poly- and paraphyletic generic phylogenies, and unclear species boundaries. These problems are aptly illustrated in the genus Phoma. This phytopathologically significant fungal genus is currently subdivided into nine sections which are mainly based on a single or just a few morphological characters. However, this subdivision is ambiguous as several of the section-specific characters can occur within a single species. In addition, many teleomorph genera have been linked to Phoma, three of which are recognised here. In this study it is attempted to delineate generic boundaries, and to come to a generic circumscription which is more correct from an evolutionary point of view by means of multilocus sequence typing. Therefore, multiple analyses were conducted utilising sequences obtained from 28S nrDNA (Large Subunit - LSU), 18S nrDNA (Small Subunit - SSU), the Internal Transcribed Spacer regions 1 & 2 and 5.8S nrDNA (ITS), and part of the -tubulin (TUB) gene region. A total of
324 strains were included in the analyses of which most belonged to Phoma taxa, whilst 54 to related pleosporalean fungi. In total, 206 taxa were investigated, of which 159 are known to have affinities to Phoma. The phylogenetic analysis revealed that the current Boeremaean subdivision is incorrect from an evolutionary point of view, revealing the genus to be highly polyphyletic. Phoma species are retrieved in six distinct clades within the Pleosporales, and appear to reside in different families. The majority of the species, however, including the generic type, clustered in a recently established family, Didymellaceae. In the second part of this study, the phylogenetic variation of the species and varieties in this clade was further assessed. Next to the genus Didymella, which is considered to be the sole teleomorph of Phoma s. str., we also retrieved taxa belonging to the teleomorph genera Leptosphaerulina and Macroventuria in this clade. Based on the sequence data obtained, the Didymellaceae segregate into at least 18 distinct clusters, of which many can be associated with several specific taxonomic characters. Four of these clusters were defined well enough by means of phylogeny and morphology, so that the associated taxa could be transferred to separate genera. Aditionally, this study addresses the taxonomic description of eight species and two varieties that are novel to science, and the recombination of 61 additional taxa. Keywords: Boeremia, coelomycetes, Didymella, Didymellaceae, DNA phylogeny, Epicoccum, Leptosphaerulina, Macroventuria, Peyronellaea, Phoma, Pleosporales, taxonomy, Stagonosporopsis Related article/ Click titel: Multiple Didymella teleomorphs are linked to the Phoma clematidina morphotype Articles from Studies in Mycology are provided here courtesy of CBS Fungal Biodiversity Centre Copyright 2010 CBS Fungal Biodiversity Centre PHOMA spp. "In hairy areas, the fungi grow around the hair shaft" **** NCBI / Link to Phoma **** Phoma spp. **** Sekundrstoffe aus endophytischen Pilzen mariner Habitate und Abbaureaktionen an Simocyclinon D8 **** PHOMA/ Anamorph genera associated with Botryosphaeria **** Synonym and Classification Data for Phoma spp. **** PHOMA SPP. FACT SHEET **** Human Phaeohyphomycotic Osteomyelitis Caused by the Coelomycete Phomopsis Saccardo 1905: Criteria for Identification, Case History, and Therapy **** ITS sequencing support for Epicoccum nigrum and Phoma epicoccina being the same biological species **** Association of a new species of Phoma with Pleospora Herbarum (Pers.) Rahb -**** ARTICLE: Applied and Environmental Microbiology/ Characterization and Differentiation of... (Phoma = Myrothecium = Malbranchea) **** Some isolates originally identified as E. nigrum developed a "Phoma-like" pycnidial state **** Evidence of the production of silver nanoparticles via ... **** Nomenclatural Fact Sheet - Phoma crystalliniformis **** Fungi: Phoma **** Phoma glomerata as a Mycoparasite of Powdery Mildew
**** First report of Phoma sorghina (Sacc.) **** Extracellular lipolytic activity in Phoma glomerata **** Identification of Sources of Resistance to Phoma medicaginis Isolates in Medicago truncatula SARDI Core Collection Accessions, and Multigene Differentiation of Isolates FUSARIUM SOLANI / PHOMA TELEOMORPH - ANAMORPH - HOLOMORPH - SYNANAMORPS **** teleomorph, anamorph, holomorph and synanamorphs. **** ANAMORPH INDEX GLOBAL BIODOVERSITY INFORMATION FACILITY Synonyms: Naucoria vervacti, Agrocybe arvalis, Agaricus arenicola, Agaricus temulentus, Agrocybe temulenta, Agrocybe arenaria, Agrocybe subpediades, Naucoria subpediades, Naucoria temulenta, Agrocybe temulenta, Pseudodeconica semiorbicularis, Naucoria pediades, Agaricus pediades, Agrocybe arenicola, Agrocybe semiorbicularis, Nolanea pediades, Naucoria semiorbicularis, Naucoria arenaria, Agaricus semiorbicularis KEY ARTICLE: FREDERICKS ET AL / VETERANS AFFAIRS / GULF WAR RELATED SYNDROME ***** FREDERICKS ET AL: ARCHIVED ARTICLES WILL SHOW UP MID PAGE ***** GULF WAR RELATED SYNDROME **** Surface signaling in pathogenesis. **** Disseminated hyalohyphomycosis caused by a novel human pathogen, Fusarium napiforme. **** The First Find of Yeast-like Cells of Fusarium moniliforme and Mechanism of Infection Injury. **** Disseminated infection by Fusarium moniliforme during treatment for malignant lymphoma. **** Genetic diversity of human pathogenic members of the Fusarium oxysporum complex inferred from multilocus DNA sequence data and amplified fragment length polymorphism analyses: evidence for the recent dispersion of a geographically widespread clonal lineage and nosocomial origin QUORUM SENSING **** QUORUM SENSING VIDEO / The Biofilm Lifecycle / ANIMATION ARCHIVE **** Surface-active proteins enable microbial aerial hyphae to grow into the air **** Plants and animals both listen to and disrupt bacterial quorum sensing signaling, prompting interest in mechanisms, applications **** Quorum sensing and bacterial cross-talk in biotechnology **** Slimy businessthe biotechnology of biofilms **** Bacterial Quorum Sensing in Pathogenic Relationships **** MicroMeeting **** Bugging the Bugs **** MICROBES, IMMUNITY, AND DISEASE: A Symphony of Bacterial Voices **** Revisiting quorum sensing: Discovery of additional chemical and biological functions for 3-oxoN-acylhomoserine lactones **** Molecular structure is solved for key protein of quorum-sensing bacteria MESOMYCETOZOEA / DRIP CLADE / AQUATIC MOLD / RHINOSPORIDOSIS **** The two Dermocystidium species resemble Rhinosporidium **** USE OF STILBENE DERIVATIVES FOR TREATMENT AND PREVENTION OF AQUATIC MOLD INFECTIONS **** FAO / Saprolegnia AND OTHER PHYCOMYCETE INFECTIONS [DERMAL MYCOSES] **** Parasitism by Dermocystidium ranae **** Observations on the Life Stages of Sphaerothecum destruens n. g., n. sp., a Mesomycetozoean
Fish Pathogen Formally Referred to as the Rosette Agent **** Differentiation between Prototheca and morphologically similar green algae in tissue. **** A molecular phylogeny of Pythium insidiosum **** Development of an Immunochromatographic Test for Rapid Serodiagnosis of Human Pythiosis **** Lacazia Loboi and Rhinosporidium seeberi; a genomic perspective **** Molecular Model for Studying the Uncultivated Fungal Pathogen Lacazia loboi **** Nature and significance of the electron-dense bodies of the endospores of Rhinosporidium seeberi **** Phylogenetic Analysis of Rhinosporidium seeberi **** A new rubisco-like protein coexists with a photosynthetic rubisco in the planktonic cyanobacteria Microcystis. **** Algae as Tools in the Study of Cellulose **** Rhinosporidium seeberi: A Human Pathogen From a Novel Group of Aquatic Protistan Parasites **** Phylogenetic Analysis of Rhinosporidium seeberi's 18S Small-Subunit Ribosomal DNA Groups This Pathogen among Members of the Protoctistan Mesomycetozoa Clade **** Altered expression of two light-dependent genes in a microcystin-lacking mutant of Microcystis aeruginosa PCC 7806. **** Evidence for recombination in the microcystin synthetase **** Report of the First Human Case of Lobomycosis in the United States **** Transcription and in vivo expression of a Microcystis aeruginosa plasmid **** Fungal and Parasitic Infections of the Eye **** Recreational and occupational field exposure to freshwater cyanobacteria a review of anecdotal and case reports, epidemiological studies and the challenges for epidemiologic assessment **** Molecular Model for Studying the Uncultivated Fungal Pathogen Lacazia loboi THE WALL STREET JOURNAL / THE INFORMED READER / DISEASE OR DELUSION? **** THE WALL STREET JOURNAL **** THE INFORMED READER / DISEASE OR DELUSION? **** Ear Bacteria Resist Treatment **** HEALTH **** Dettol Man or Lysol: too much of a good sanitizer can kill QUICK DETAIL The abbreviation (sp.) used after a genus name refers to an undetermined species; (spp.) after a genus name refers to several species without naming them individually. THE MYSTERIOUS RELATIONSHIPS OF RHINOSPORIDOSIS SEEBERI **** THE MYSTERIOUS RELATIONSHIPS OF RHINOSPORIDOSIS SEEBERI **** Lymphadenitis, trans-epidermal elimination and unusualhistopathology in human rhinosporidiosis CAUSATIVE AGENT OF RHINOSPORIDOSIS IS MICROCYSTIS SP. ? **** Why did previous investigators not find well-defined mitochondria? I am convinced that these mitochondria are from human cells Emerging (unusual nosocomial) Infections **** Epidemiology and Clinical Aspects of Unusual Fungal Nosocomial Infections **** Fungal and Parasitic Infections of the Eye **** In-vitro antifungal susceptibility of clinical and environmental Fusarium spp. strains **** Cutaneous Infection by Fusarium Species in Healthy and Immunocompromised Hosts: Implications for Diagnosis and Management **** Fatal disseminated fusarium infection in acute lymphoblastic leukaemia in complete remission **** Fusarium Outbreak: Lessons Learned **** The effect of propyl gallate on the activity of various antifungal drugs against filamentous fungi in vitro. **** Fusarium, a Significant Emerging Pathogen
"A NEW WAY TO LOOK AT FILAMENTS" **** A NEW WAY TO LOOK AT FILAMENTS **** Isolation and cultivation of filamentous bacteria implicated in... Cellular fatty acids as chemotaxonomic markers of the genera.... **** Cellular fatty acids as chemotaxonomic markers of the genera Anabaena, Aphanizomenon, Microcystis, Nostoc and Planktothrix (cyanobacteria) **** The clade containing filamentous heterocystous cyanobacteria was divided into three discrete groups of.... GAS VACUOLES, ELECTRON-DENSE BODIES AND VIRUS **** The result of electron microscopic investigation of gas-vacuoles in a culture of the benthal alga Oscillatoria chalybea was compared with the extensive literature concerning gas-vacuole formation and virus infection in bacteria and animals. **** Gas vesicle proteins **** Nauture and significance of the electron-dense bodies.... CLASSIFICATION **** Molecular characterization of planktic cyanobacteria of Anabaena, Aphanizomenon, Microcystis and Planktothrix genera **** Quantitative Real-Time PCR Detection of Toxic Nodularia Cyanobacteria in the Baltic Sea **** A proposal for the unification of five species of the cyanobacterial genus Microcystis Kutzing ex Lemmermann 1907 under the Rules of the Bacteriological Code **** A proposal for further integration of the cyanobacteria under the Bacteriological Code **** TAXONOMY BROWSER **** Systematic-bacteriology--Enterobacteriaceae INDEX DATASERVICES **** SANGER/ Staphylococcus aureus Blast **** List of Prokaryotic names with Standing in Nomenclature **** BLAST INFORMATION **** MAX PLANCK INSTITUTE FOR TERRESTRIAL MICROBIOLOGY (INDEX) **** BROAD INSTITUTE **** IMMUNEEPITOPE **** MAX PLANCK / BIO-MEDICAL **** JVI / CMR (MICROBIAL GENOMES) **** CYANOBASE **** CYANOBASE LINKS **** Synechocystis PCC6803 and Anabaena PCC7120 **** NCBI / BLAST (Basic Local Alignment Search Tool) **** BIOTA TAIWANICA **** Neosartorya fischeri Genome Project **** LANL **** FASTA **** DOE **** EMBL-EBI **** RNA RIBOSOMAL DATABASE **** PFAM/ DB / SANGER **** FUNGAL GENOMES SEARCH **** GOBASE **** GenDis **** IMG **** DDBJ / DNA DATA BANK OF JAPAN
**** NEMATOSTELLA VECTENSIS DATA BASE **** INSDC **** CABI Bioscience Databases **** BIOAFRICA **** ESTREE **** SGD SITE MAP **** TREEBASE **** CLCBIO **** MYCOBANK **** GLOBAL BIODIVERSITY INFORMATION FACILITY **** USDA AGRICULTURAL RESEARCH SERVICE **** BRENDA **** FLYBASE **** PASTEUR/ CYANOLIST **** Genstyle Companion Database Browser **** YEASTGENOME **** YCR (YEAST RESOURCE CENTER) ARCHIVE 2007 (51) January (50) **** The Armed Forces Institute of Pathology 2001 ... **** Microcystis as causative agent of Rhinosporid... **** Pathogenic Fungi: Structural Biology and Taxo... **** Nature and significance of the electron-dens... **** Phylogenetic Analysis of Rhinosporidium seebe... **** The Armed Forces Institute of Pathology 2002-... **** Evidence for recombination in the microcystin... **** Transcription and in vivo expression of a Mic... **** A note on ribosomes in cells of Chlorella pro... **** The characterization of pMa025, a plasmid iso... **** Release of Extracellular Transformable Plasmi... **** Lacazia Loboi and Rhinosporidium seeberi; a g... **** Rhinosporidium, is it still a fungus? **** Variant forms of a group I intron in nuclear ... **** Self-splicing group I introns in viruses that... **** Non-Watson Crick base pairs might stabilize R... **** Algae as tools in studying the biosynthesis o... **** Systematic survey on crystalline features of ... **** Structural organization of microcystin biosyn... **** Altered expression of two light-dependent... **** Diversity of microcystin genes within a popul... **** A new rubisco-like protein coexists with a ph... **** First report of a microcystin-containing bloo... **** Rhinosporidium seeberi. An ultrastructural st... **** Rhinosporidiosis 2 **** Rhinosporidiosis 1 **** Human anti-rhinosporidial antibody does not c... **** Roles of microtubules and cellulose microfibr... **** On the alignment of cellulose microfibrils by...
**** Report of the First Human Case of Lobomycosis... **** Reclassification, Lacazia loboi gen. nov., co... **** Phylogenetic Analysis of Lacazia loboi Places... **** The taxonomic status of Lacazia loboi and Rhi... **** Comparative morphology of Lacazia loboi (syn.... **** Characterization of pMa025, a plasmid from th... **** Unusual Fungal and Pseudofungal Infections of... **** Fungal and Parasitic Infections of the Eye **** Rhinosporidium seeberi: A Human Pathogen From... **** Recreational and occupational field exposure ... **** rosette agent 1 **** The rosette agent 2 ***** THE CLASS MESOMYCETOZOEA: A Heterogeneous Gr... **** Rhinosporidiosis: what is the cause? **** DISEASES OF AQUATIC ORGANISMS **** Cyanobacterial lipopolysaccharides and human ... **** Sporopollenin in the cell wall of Chlorella a... **** 8th Cyanobacterial Molecular Workshop **** Analysis of Pneumocystis carinii cyst wall. I... **** Identification of a unicellular, non-pigmente... **** Ecophysiology of Marine Cyanobacterial Blooms... March (1) 2008 (1) 2010 (1) Showing newest 4 of 50 posts from January 2007. Show older posts **** Ecophysiology of Marine Cyanobacterial Blooms **** Identification of a unicellular, non-pigmented alga that mediates growth inhibition in anuran tadpoles: a new species of the genus Prototheca Identification of a unicellular, non-pigmented alga that mediates growth inhibition in anuran tadpoles: a new species of the genus Prototheca (Chlorophyceae: Chlorococcales) Adeline Wong1 and Trevor Beebee1 (1) School of Biological Sciences, University of Sussex, BN1 9QG Falmer, Brighton, U.K. Received: 24 September 1992 Revised: 7 April 1993 Accepted: 27 April 1993 Abstract A non-pigmented, unicellular alga isolated from the faeces of British anuran tadpoles and which is associated with growth inhibition in these tadpoles, was described and identified using cytological, ultrastructural, nutrient assimilation and immunological studies. The alga possessed all the distinctive morphological features of the genus Prototheca, it grew weakly on Prototheca Isolation Medium (PIM), it required thiamine for continued growth and replication, and it could assimilate the five major substrates used to speciate the protothecans. All of these characteristics, together with previous nucleic acid hybridisation studies, indicated that the microorganism belonged to the genus Prototheca. There are currently five species recognised as valid (Pore, 1985 & 1986): Prototheca zopfii Kruger, 1884, P. wickerhamii Tubaki & Soneda, 1959, P. moriformis Kruger, 1884, P. stagnora Cooke, 1968 and P. ulmea Pore, 1986. The immunology showed that the new species was related to two of the protothecans, but overall it showed that the alga was antigenically distinct from the other protothecans tested in the immunoassay. This, together with its inability to grow strongly on PIM, its ability to assimilate a wide rage of carbon substrates and its ability to mediate growth inhibition in anuran tadpoles, indicated a new species of
Prototheca. We therefore propose the name Prototheca richardsi sp. n. Key words alga - growth inhibition - tadpoles - new species - Prototheca **** Analysis of Pneumocystis carinii cyst wall. I. Evidence for an outer surface membrane. Department of Anatomy, University of Cincinnati College of Medicine, Ohio 45267. It has long been thought that the cyst form of Pneumocystis carinii, which can resist host defenses and antimicrobial drugs, is responsible for relapses of P. carinii pneumonia. The thick wall of the cyst is immunogenic and rich in glucosyl/mannosyl and N-acetyl-D-glucosamine residues. In this study we have demonstrated the presence of a hitherto unreported outer membrane in the cyst wall of P. carinii. This membrane was detected by a combination of techniques, including transmission electron microscopy, freeze-fracture electron microscopy, and membrane labeling with fluorescent lipid analogs following treatment of P. carinii cysts from infected rats for 30 min with Zymolyase, a beta-1-3 glucanase. As in gram-negative bacteria and blue-green algae, this 2nd membrane may have an important role in osmoregulation and nutrient utilization; it may also mediate the interaction of P. carinii with its host and serve as a target for drug therapy. PMID: 2213655 [PubMed - indexed for MEDLINE] **** 8th Cyanobacterial Molecular Workshop 8th Cyanobacterial Molecular Biology Workshop 1 August 10, 2004 Dear Colleagues, The organizers would like to welcome you to the 8th Cyanobacterial Molecular Biology Workshop. It has been our honor and pleasure to organize this latest gathering of cyanobacteriologists and we thank all participants for their contributions to what ought to be a highly stimulating meeting in a new and beautiful location. The assistance and advice of previous organizers, along with the help of Mike Schroder at Virgina Tech has been invaluable to us. As in previous meetings, the major objective of the workshop is encourage productive interactions among reserarchers of cyanobacteria and give students, postdocs, and junior faculty a chance to voice their latest findings alongside more seasoned scientists. This event is also the 20th anniversary of the first Workshop, and we are happy that several of the original participants, including the founding organizer Bob Haselkorn, are presenting their work. The original 1984 program for the first workshop is appended to this book to offer perspective on what continues to be a vibrant and progressive portion of the scientific community. Thank you for joining us and we look forward to a great meeting! Rob Burnap George Bullerjahn 2 Table of Contents Brief History of the Workshop 3 Workshop Schedule 4 Poster Presentations 10 Session I Oral Presentation Abstracts 15 Session II Oral Presentation Abstracts 24 Session III Oral Presentation Abstracts 31 Session IV Oral Presentation Abstracts 40 Session V Oral Presentation Abstracts 48 Session VI Oral Presentation Abstracts 57
Session I Poster Presentation Abstracts 64 Session II Poster Presentation Abstracts 72 Session III Poster Presentation Abstracts 81 Session IV Poster Presentation Abstracts 90 Session V Poster Presentation Abstracts 99 Session VI Poster Presentation Abstracts 105 Participants 111 Program of the 1st Cyanobacterial Molecular Biology Workshop (September 1984) 114 3 Brief History of the Workshop The first Cyanobacterial Molecular Biology Workshop was convened in September 1984 by Robert Haselkorn at the University of Chicago. At that time, molecular genetic analyses were being developed for many unicellular and filamentous cyanobacteria, thus it was appropriate to bring together the major research groups to discuss and share current molecular approaches and future research directions. The 1st Workshop set the tone for subsequent meetings by encouraging graduate students and postdoctoral fellows to present their work. Following the success of the 1st Workshop, subsequent meetings were arranged so as not to conflict with other meetings such as the Photosynthesis Gordon Conference and the ISPP (International Symposium on Phototrophic Prokaryotes). As a result, the 2nd and 3rd Workshops were held as satellite meetings to the ASPP Annual meetings in St. Louis and Toronto (1986 and 1989). Following the Toronto Workshop, the conference moved to Asilomar Conference Center in Pacific Grove, CA in 1992. At the conclusion of the 2001 meeting, the attendees agreed that the Workshop be moved to a new location, and that a Canadian site (perhaps aligned with the Photosynthesis Congress) would be an appropriate venue. The site and timing of the 8th Workshop thus reflects the decision to stage it as a satellite meeting immediately prior to the 13th International Congress on Photosynthesis in Montreal (August 29 September 3, 2004). 4 Section One: Workshop Schedule Schedule of Events 5 Program Schedule: 8th Cyanobacterial Molecular Biology Workshop Wednesday, August 25, 2004 3:00 - 6:00 p.m. Registration/Poster set-up 6:00 - 7:30 p.m. Dinner 7:45 - 8:00 Opening remarks and welcome: Rob Burnap and George Bullerjahn 8:00 - 9:00 Keynote Address: Robert Haselkorn, University of Chicago, Heterocyst differentiation in Anabaena: old wine, new bottles. 9:00 p.m. Poster Viewing Thursday, August 26, 2004 7:30-9:00 a.m. Breakfast Session I: Physiology, Metabolism and Global Responses (I): Session Chair: Gnter Peschek, University of Vienna 9:00 - 9:20 Rakefet Schwarz, NblC, a novel modulator of pigment level during
nutrient limitation in Synechococcus elongates PCC 7942 9:20 - 9:40 Yukako Hihara, A small transcriptional regulator, Ssl0564, is involved in a novel mechanism of redox regulation in a cyanobacterium Synechocystis sp. PCC 6803 9:40 10:00 Galyna Kufryk, Functional complementation of the cytochrome c oxidase deletion mutant by transposon mutagenesis in Synechocystis sp. PCC6803 10:00 10:20 Miriam Martin, The myriad lifestyles of Nostoc punctiforme: an array of possibilities 10:20 - 10:40 a.m. Coffee break 10:40 11:00 Aaron Kaplan, Photoreduction of O2, mediated by two A-type flavoproteins, may consume large fraction of the electrons produced by water cleavage in cyanobacteria but does not produce H2O2 11:00 11:20 Jean-Charles Cadoret, Cyclic nucleotides and response to a UV-B stress in Synechocystis PCC 6803 Schedule of Events 6 11:20 11:40 Jessica Brown, A cool twist on RNA helicase expression 11:40 12:00 Gnter Peschek, Dissection and reassembly of a cyanobacterial respiratory chain using recombinant electron transport proteins from Synechocystis sp. PCC6803 throughout 12:00 1:00 p.m. Lunch Session II: Heterocysts and nitrogen metabolism: Session Chair Karl Forchammer, Justus-Liebig Universitt Giessen 1:00 1:20 p.m. Alicia Muro-Pastor, The role of NtcA in heterocyst development and function. 1:20 1:40 Mani Maheswaran, Arginine biosynthesis in Cyanobacteria is subjected to global nitrogen control via PII signal transduction 1:40 2:00 Teresa Thiel, Developmental and metal regulation of the modA gene of Anabaena variabilis ATCC 29413 2:00 2:20 Qing Fan, Identification of Anabaena sp. PCC 7120 genes required specifically for heterocyst formation and function 2:20 2:40 Francisca Fernandez-Pias, Calcium is required for heterocyst differentiation in Anabaena sp. PCC 7120 2:40 - 4:20 Poster viewing (authors stand by odd-numbered posters) 4:20 - 6:00 Jeff Elhai, Workshop: BioLingua, a knowledge-base and programming environment for the analysis of cyanobacterial genes and genomes 6:00 - 7:30 Barbeque; Le Chantecler Terrace 8:00 - 9:00 Seminar: James Golden, Texas A&M University, Regulation of heterocyst development and pattern formation 9:00 p.m. Poster viewing Friday, August 27, 2004 7:30-9:00 a.m. Breakfast Session III: Physiology, Metabolism and Global Responses (II): Session Chair - Francis X. Cunningham, Jr., University of Maryland 9:00 9:20 a.m. Robert J. Jeanjean, Study on the transcription of genes encoding for putative peptide synthetases in Anabaena PCC7120 Schedule of Events 7
9:20 9:40 Karen E. Chapman, Characterisation of three adenylate cyclase Nostoc punctiforme ATCC 29133 mutants shows phenotypic disparity 9:40 10:00 Mathew Carberry, Pervasive cyanophage in a Laurentian Great Lakes: applications of molecular techniques to gain insight on their distribution and ecology 10:00 10:20 Christophe Six, Evidences for two novel phycobilisome linkers in the marine cyanobacterium Synechococcus sp. WH8102, impact of high light and ultraviolet radiations on the phycobilisome structure and composition 10:20 - 10:40 a.m. Coffee break 10:40 - 11:20 Martin Hagemann, Salt stress response in cyanobacteria: mechanisms involved in the salt-regulation in Synechocystis sp. strain PCC 6803 11:20 11:40 Mary Allen, Acid stress response in two strains of Synechocystis species 11:40 12:00 Francisco Lagans, Characterization of mrpA, a gene with roles in pH adaptation and resistance to Na+ in the cyanobacterium Anabaena sp. PCC7120 12:00 - 1:00 Lunch 1:00 - 3:00 p.m. Poster Viewing (authors stand by even-numbered posters) Session IV: Photosynthesis and responses to light: Session Chair - John Cobley, University of San Francisco 3:00 3:20 p.m. Masayuki Muramatsu, Promoter analysis of genes encoding subunits of photosystem I in Synechocystis sp. PCC 6803 3:20 3:40 Anthony Kappell, Identification of a cis-acting element involved in negative control of the hliA gene of cyanobacteria in response to light 3:40 4:00 John Cobley, PsoR is a regulator of phycobilisome abundance in the cyanobacterium, Fremyella diplosiphon 4:00 - 4:20 p.m. Coffee break 4:20 4:40 Natalia Ivleva, LdpA: a component of the circadian clock senses redox state of the cell 4:40 5:00 You Chen, Global functional analysis of circadian clock genes in Synechococcus elongatus PCC 7942: strategy and progress Schedule of Events 8 5:20 5:40 Masato Nakajima, The mechanism of circadian regulation of gene expression in the cyanobacterium Synechococcus elongatus PCC 7942 5:40 6:00 Yao Xu, Circadian mechanisms in cyanobacteria 6:00 - 7:30 Dinner 8:00 - 9:00 Seminar: Petra Fromme, Arizona State University; Structure and Function of Photosystem I and II" 9:00 p.m. Poster Viewing Saturday, August 28, 2004 7:30 - 9:00 a.m. Breakfast Session V: General Structural Aspects: Session Chair - Cheryl Kerfeld, UCLA 9:00 9:20 Nataliya Yeremenko, Supramolecular organization and dual function of the IsiA chlorophyll-binding proteins in cyanobacteria 9:20 9:40 Wendy Schluchter, Identification of a new family of phycobiliprotein lyases in cyanobacteria: characterization of a phycocyanin lyase 9:40 10:00 Darryl Horn, Synechococcus sp. PCC 7002 PetB arginine 214: a key residue for quinone-reductase function and possible oxygen radical
production in the cytochrome b6/f complex 10:00 10:20 Cheryl Kerfeld, Structure and function of protein complexes in photoprotection and carbon fixation: the orange carotenoid protein and the carboxysome 10:20 - 10:40 a.m. Coffee break 10:40-11:00 Gouzhong Shen, Functional genomics of genes for biogenesis of Fe/S proteins in cyanobacteria 11:00 11:20 Marc Nowaczyk, Preliminary structural characterization of the 33-kDa protein (PsbO) in solution studied by site-directed mutagenesis and NMR spectroscopy 11:20 11:40 Archana Mukopadhyay- Identification of a low molecular weight protein tyrosine phosphatase and its potential substrates in Synechocystis sp. PCC 6803 11:40 - 1:00 p.m. Lunch Schedule of Events 9 Session VI: Carbon metabolism: Session Chair Dean Price, Australian National University 1:00 1:20 p.m. Martin Cann, Signal transduction molecules directly regulated by bicarbonate and sodium ions 1:20 1:40 Suzanne Burey, Response to low carbon dioxide in the glaucocystophyte alga, Cyanophora paradoxa 1:40 2:00 Michael Summers, Identification and analysis of akinete specific genes in Nostoc punctiforme 2:00 2:20 Fiona Woodger, Regulation of the cyanobacterial CO2 concentrating mechanism 2:20 2:40 Graciaela Solerno, Regulation of sucrose metabolism in salt-treated cells of Nostoc sp. PCC 7120: towards the understanding of the role of sucrose in cyanobacteria 2:40 - 4:40 Poster viewing then posters to be taken down 4:40 - 6:00 Free time (and time for break-out groups to discuss specific areas) 6:00 - 7:30 Dinner 8:00 - 9:00 Seminar: Murray Badger, Australian National University; Cyanobacterial photosynthetic CO2 concentrating mechanisms: solutions employing many Ci transporters, two carboxysomes types and diverse carbonic anhydrases Sunday, August 29, 2004 7:30-9:00 a.m. Breakfast Depart Ste. Adele. In Montral, the 13th International Congress of Photosynthesis registration starts at 1:00 p.m. in Hall Bleury (1001 Place Jean-Paul-Riopelle) and will be followed by a mixer buffet at 6:00 p.m in panoramic room 710. The opening ceremony is Monday, August 30th, at 8:30 in room 210-A. Poster Listing Section 10 Poster Presentation Listing Session I: Physiology, Metabolism and Global Responses (I): Session Chair: Gnter Peschek, University of Vienna 1. Akiko Tomitami- Isolation and characterization of Nostoc punctiforme ATCC 29133 mutants unable to differentiate into hormogonia 2. Alicia M. Muro-Pastor- Identification of a cis-acting antisense RNA potentially regulating furA expression in Anabaena sp. PCC 7120.
3. Shannon R. Cannales-Differential circadian regulation of psbA gene expression in Synechococcus elongatus PCC 7942 4. Laura Patterson-Fortin- Novel expression regulation and biochemical activities of a redox-regulated RNA helicase 5. George W. Owtrim- RNA Structural Rearrangements by the Synechocystis RNA Helicase, CrhR 6. Kirsten Gutekunst- Transcriptional regulation of the bidirectional NiFe-hydrogenase in Synechocystis sp. PCC 6803 7. Ninja Backasch, The role of tocopherol in preventing oxidative damage at the cyanobacterial photosystem II from Synechocystis sp.PCC 6803 8. Young Mok Park- Novel Interaction between Two CheA-like Molecules Involved in Gliding Motility of Cyanobacterium Synechocystis sp. PCC 6803 Session II: Heterocysts and nitrogen metabolism: Session Chair Karl Forchhammer, Justus-Liebig Universitt Giessen 9. Rebecca Thayer- Characterization of Anabaena sp. strain PCC 7120 genes alr4311 and all4312. 10. Ignacio Luque- Nitrogen control of the glutamyl-tRNA synthetase in Tolypothrix sp. PCC 7601 11. Karl Forchhammer- Nitrogen regulation in cyanobacteria: new insights in responses mediated by the PII signal transduction protein 12. Jeff Elhai- Possible role of a non-coding RNA in the initiation of heterocyst differentiation 13. Natalia Ivanikova- Construction of a nitrate responsive Synechocystis sp. strain PCC 6803 bioreporter for estimating nitrate bioavailability in freshwater Poster Listing Section 11 14. Martha Ramirez- Characterization of the DNA-binding activity of Anabaena 7120 devH protein 15. Sigal Lechno-Yossef- alr1086 is an ORF required for regulation of heterocyst polysaccharide synthesis in Anabaena sp. strain PCC 7120 16. Vladimir Krasikov- The response of Synechocystis sp. PCC 6803 to nitrogen starvation: transcriptomics versus proteomics Session III: Physiology, Metabolism and Global Responses (II): Session Chair: Francis X. Cunningham, Jr., University of Maryland 17. Akito Nishizawa-Genetic analysis of nonribosomal peptide synthetase genes in cyanobacteria 18. Florence Gleason- Ribonucleotide reduction in the cyanobacteria 19. Jens Appel- Protein trans-splicing of the -subunit of the DNA-polymerase III of Synechocystis sp. PCC 6803: does it exert a regulatory role? 20. Sousuke Imamura- Characterization of group 2 sigma factors of RNA polymerase and their roles in the cyanobacterium Synechocystis sp. strain PCC 6803 21. Aaron Kaplan- The composition and dynamics of the phytoplankton assemblage in Lake Kinneret is strongly affected by cyanobacterium - dinoflagellate communication 22. Douglas Graham- Investigation of carbon and light on cyanobacterial toxin production 23. Yuichi Fujita- Chlorophyll Pasteur point, a critical atmospheric oxygen level for ancestral chlorophyll biosynthesis 24. Ramakrishna Boyanpalli- Construction of cyanobacterial bioreporters for detecting nutrient deficiency in marine waters. 25. George S. Bullerjahn- Expression and mutagenesis of mapA, a Synechococcus sp. PCC
7942 iron responsive gene: evidence for oxidative stress protection 26. Katie M. Shea, Acid stress response in two strains of Synechocystis species Session IV: Photosynthesis and responses to light: Session Chair - John Cobley, University of San Francisco 27. Georg Schmetterer- Cyanobacterial respiratory terminal oxidases 28. Kazuki Terauchi- Circadian rhythm of gene expression and cloning of clock genes in the facultative filamentous cyanobacterium Plectonema boryanum 29. Eugenia Clerico- Unveiling the presence of more than one oscillator in S. elongatus PCC7942 Poster Listing Section 12 30. Jayna Ditty- Role of kaiBC transcriptional timing in the circadian clock mechanism of Synechococcus elongatus PCC 7942 31. Gogang Dong- Homotypic interactions of central oscillator components in the cyanobacterial circadian clock 32. Mitsunori Katayama- Alterations in the gene expressions by the disruption of genes encoding phytochrome-related protein in Synechocystis sp. PCC 6803 33. Aaron Kaplan- Activation of photosynthesis and resistance to photoinhibition in cyanobacteria within biological desert crust. Session V: Structural aspects: Session Chair: Cheryl Kerfeld, UCLA 34. Hans C. P. Matthijis- Photosystem I cyclic electron transfer pathways and function 35. Robert L. Burnap- In situ effects of mutations of the extrinsic cytochrome c550 of Photosystem II in Synechocystis sp. PCC6803 36. Gaozhong Shen- Progress in sequencing, assembly and annotation of the genome of the marine unicellular cyanobacterium Synechococcus sp. PCC 7002 37. C. Kay Holtman- First fruits of the Synechococcus elongatus PCC 7942 functional genomics project 38. Jingdong Zhao- Deletion of large chromosomal fragments of Anabaena sp. PCC 7120 with a Cre/loxP system 39. Marc Nowaczyk,- Preliminary structural characterization of the 33-kDa protein (PsbO) in solution studied by site-directed mutagenesis and NMR spectroscopy Session VI: Carbon metabolism: Session Chair Dean Price, University of Durham 40. Dean G. Price- Identification of a new class of bicarbonate transporter from the marine cyanobacterium, Synechococcus PCC7002 41. Louis A. Sherman- Pleiotropic regulation of carbohydrate metabolism by Hik8 (a SasA orthologue) in Synechocystis 6803 42. Aaron Kaplan- Towards resolving the Glucose sensing in Synechocystis PCC 6803 43. Ben M. Long-A proteomic study of carboxysomes from -cyanobacteria 44. Robert L. Burnap - Global patterns of gene expression in Synechocystis sp. PCC 6803 in response to inorganic carbon limitation and the inactivation of ccmR, a LysR family regulator Oral Presentation Abstracts 13 Abstracts for oral presentations Oral Presentation Abstracts 14 Keynote Talk
Heterocyst differentiation in Anabaena: old wine, new bottles ROBERT HASELKORN Department of Molecular Genetics & Cell Biology, University of Chicago, 920 East 58 Street, Chicago IL 60637 USA Our first foray into biology, as opposed to the biochemistry of nucleic acids, was a study of the plant virus Turnip Yellow Mosaic Virus. After moving to Chicago, we took up bacterial viruses, whose great virtue was the ability of single particles to infect. When cyanophages were discovered in 1963, they were added to the mix because their hosts, the cyanobacteria, did plantlike photosynthesis and looked gorgeous on plates. Numerous students (Ron Luftig, Lou Sherman, Jim Mackenzie and Ken Adolph) did their theses on cyanophages. When Honoree Fleming came along, she was encouraged to work on cyanophage development too. Instead, she studied cellular development, namely the differentiation of heterocysts in Anabaena in response to starvation for a fixed source of nitrogen. She used the newly introduced method of polyacrylamide gel electrophoresis of proteins to show that nitrogenase was made chiefly in the differentiating heterocysts and that many other proteins appeared in the differentiating cells according to a program not unlike that of a viral infection of bacteria. We subsequently determined to study that program from the point of view of the regulated transcription of sets of genes. Gene cloning came into the lab in the late 1970s, introduced by Doug Rice and Barbara Mazur, and exploited first by Moshe Mevarech, Pete Lammers, Rich Fisher, Steve Robinson, Jim Golden, Nilgun Tumer, Stephanie Curtis, Sandy Nierzwicki-Bauer, Bill Belknap, Jean Lang, George Schneider, R. Nagaraja and later by Bill Buikema, Martin Mulligan, Dulal Borthakur, Herbert Boehme, Chris Bauer, Kristin Bergsland, Jihong Liang, Bianca Brahamsha, Brian Palenik and Kristin Black. The most recent people to join the program were Kathryn Jones and Sean Callahan. Most of the individually cloned and sequenced genes were used for two purposes: to see when and where they were transcribed during heterocyst differentiation and to try to identify promoter elements governing the program. Specific efforts were made to characterize modification of the transcription machinery during differentiation but nothing striking was found beyond the unusual structure of the RNA polymerase core. Subsequently, around 1990, it became possible to isolate mutants that were defective in heterocyst differentiation and to isolate the genes that complement these mutations, using a plasmid complementation system introduced by Wolk and Elhai and then optimized by Bill Buikema. The latter program revealed the master regulator HetR, whose amazing properties were elucidated later by Zhaos group in Beijing. Buikema also introduced a method for controlling gene expression with a Cu++-regulated promoter, making it possible to turn essential or potentially lethal genes on or off at will. These genetic tools, together with the complete genome sequence from the group at Kazusa and the global transcription profiles of gene expression during heterocyst differentiation by Ehira and Sato, make it reasonable to expect a complete molecular description of cellular differentiation in Anabaena in the near future. Session II Oral Presentation Abstracts 15 Session I: Physiology, Metabolism and Global Responses (I) Session Chair: Gnter Peschek, University of Vienna Session II Oral Presentation Abstracts 16 NblC, a novel modulator of pigment level during nutrient limitation in Synechococcus elongates PCC 7942 ELEONORA SENDERSKY, ROXANE LAHMI, JUDITH SHALTIEL, ALEXANDER PERELMAN AND RAKEFET SCHWARZ*. Faculty of Life Sciences, Bar-Ilan University, Ramat-Gan, Israel
Modulation of pigment level in response to environmental cues is an essential process that allows photosynthetic organisms to adjust light harvesting to the metabolic needs of the cell and minimizes the photo-oxidative damage resulting from surplus excitation. Mutants that, unlike wild type cells, do not degrade their light harvesting pigments under sulfur and nitrogen starvation have been used to identify components of the degradation pathway. Starved mutant cultures appear blue green rather than yellowish or bleached as starved wild type cultures, and therefore the phenotype was termed non-bleaching (nbl). Four components of the nbl-pathway have been previously identified: NblS and NblR were assigned a regulatory function whereas NblA and NblB appear to be involved in the degradation process. The specific role of the latter components is not clear, neither the mechanism of pigment degradation or its regulation by nutrient availability. It was therefore desirable to isolate novel non-bleaching mutants to further elucidate the mechanism underlying modulation of pigment level. We have developed an efficient screening method, which employs Fluorescence Activated Cell Sorter (FACS) and isolated novel non-bleaching mutants. Characterization of one of these mutants uncovered a new component of the degradation pathway designated NblC. Inactivation of nblC resulted in a nonbleaching phenotype during nitrogen, sulfur or phosphorus starvation. Therefore, NblC, similarly to NblR, belongs to a cascade of events resulting in a general acclimation response. Over expression of NblC by a foreign promoter resulted in pigment degradation under the inducing conditions. Interestingly, a strain of nblR-mutant in which NblC was over expressed retained its pigmentation, suggesting dependence of NblC on NblR or on a gene product modulated by the latter. Transcription of nblC is induced during sulfur, nitrogen and phosphorous starvation. Furthermore, the NblC-mutant exhibited reduced viability under nutrient limitation as compared to wild type cells. The role of NblC during nutrient starvation will be discussed in light of transcription analysis of nblA and cpc operon (encoding for the subunits of phycocyanin) in the wild type, in nblC-mutant and in wild type and mutant strains over expressing NblC or NblR. * Corresponding author: schwarr2@mail.biu.ac.il Session II Oral Presentation Abstracts 17 A small transcriptional regulator, Ssl0564, is involved in a novel mechanism of redox regulation in a cyanobacterium Synechocystis sp. PCC 6803. KINU NAKAMURA and YUKAKO HIHARA* Department of Biochemistry and Molecular Biology, Saitama University, 255 Shimo-okubo, Saitama 338-8570, Japan ssl0564, a small ORF of a cyanobacterium Synechocystis sp. PCC 6803, encodes one of the smallest protein belonging to the LuxR family of transcriptional regulators. Its 89-amino-acid sequence is similar over its entire length to the DNA binding domain of this protein family, including a putative helix-turn-helix motif. We found that purified Ssl0564 protein formed a dimer structure that could be disrupted to yield monomers by the addition of DTT or mercaptoethanol. Three cysteine residues at the amino-terminal domain are well-conserved among cyanobacterial species and therefore seemed to be involved in dimerization through the formation of intermolecular disulfide bonds. In order to identify the target genes for Ssl0564, DNA microarray analysis of ssl0564-disrupted mutant was performed. It was revealed that chlL, chlN and chlB genes encoding subunits of light-independent protochlorophyllide reductase, katG encoding catalase-peroxidase and slr1957 were up-regulated and ssl0564-sll0296 operon, ndhD2 encoding a subunit of NADPH dehydrogenase and rpe encoding pentose-5-phosphate-3epimerase were down-regulated by Ssl0564 under normal growth conditions. Furthermore, by northern blot analysis, we verified that the transcript levels of ndhD2 and rpe were regulated by Ssl0564 under different growth conditions. In the wild type cells, transcripts of these genes accumulated within 15 min after the shift to high light conditions and this up-regulation was
suppressed by addition of DCMU, methyl viologen or hydrogen peroxide. On the other hand, in ssl0564-disrupted mutant, these transcript levels were less affected by the environmental changes and always higher than those in the wild type. This suggests that Ssl0564 is a transcriptional regulator that can perceive the redox state of the acceptor side of photosystem I. When generation of the reducing power by photosynthetic electron transport chain was slowed down and redox components located downstream of photosystem I became oxidized, Ssl0564 may form the intermolecular disulfide bonds to become active dimeric form. * Corresponding author Session II Oral Presentation Abstracts 18 Functional complementation of the cytochrome c oxidase deletion mutant by transposon mutagenesis in Synechocystis sp. PCC6803 GALYNA KUFRYK* and WIM VERMAAS School of Life Sciences, and Center for the Study of Early Events in Photosynthesis, Arizona State University, P.O. Box 874501, Tempe, AZ 85287-4501 Cyanobacteria represent an interesting system for studies of photosynthesis and respiration. Components of these two electron transport systems are located in cytoplasmic membrane, and some of them, such as plastoquinone (PQ) and the cytochrome b6/f complex, are used in both respiration and photosynthesis. Cytochrome c oxidase catalyses reduction of the final electron acceptor (molecular oxygen) in Synechocystis sp. PCC6803. Deletion of the gene coding for subunit I of this enzyme (slr1137) impacts the ability of the organism to grow at low light intensity (less than 5 mol photons m-2 s-1). This probably is a result of overreduction of the plastoquinone pool that cannot be alleviated by the photosynthetic activity of photosysem I. Therefore, the cytochrome c oxidase deletion mutant (Cta- strain) is a good model to study regulation of redox state of the PQ pool in this cyanobacterium. Transformation of this strain with the interruption library of Synechocystis sp. PCC6803 obtained by transposon mutagenesis resulted in several mutants that retained the original deletion of cytochrome c oxidase but were able to grow at low light intensity. Interruption mutation in one of them was mapped to 71 bp upstream of the ssl3342 coding region. This open-reading frame is the first gene of a possible operon that contains three other genes, sll1749, sll1750, and sll1751. The ssl3342 gene codes for a 84-residue protein of unknown function that has two predicted transmembrane domains. A homologue of this gene can be found in Arabidopsis thaliana. The next gene of the possible operon, sll1749, also codes for an unknown protein, whereas the product of the third gene, sll1750, has been annotated to be the urease alpha subunit. The function of Sll1751 remains unknown. Absorption spectra and low temperature fluorescence spectra showed that the photosystem II complexes in this mutant were fully assembled with normal antenna size. The phenotype of the mutant strains is being investigated. * Corresponding author. Session II Oral Presentation Abstracts 19 The myriad lifestyles of Nostoc punctiforme: an array of possibilities MIRIAM MARTIN* and JACK MEEKS Section of Microbiology, University of California-Davis, One Shields Ave Davis, CA, 95616 The filamentous cyanobacterium Nostoc punctiforme inhabits diverse ecological niches and its vegetative cells can differentiate into an unusually wide range of cell types: nitrogen-fixing heterocysts, motile hormogonia, and perrenating akinetes. The phenotypic plasticity of N. punctiforme is reflected in its relatively large ~9 MB genome with more than 7300 genes. While a number of heterocyst determinants and biosynthetic components have been defined through
traditional genetics, the bulk of the regulatory proteins remain elusive. Similarly, the proteins that signal and implement the differentiation of vegetative cells into hormogonia and akinetes are largely unknown. To accelerate our studies of N. punctiforme differentiation, we are constructing a DNA array with which we will compare the transcriptional complement of all four cell types over the course of development. The array will consist of ~7000 PCR products, representing all ORFs with similarity in the database and all ORFs over 240 bp in length encoding hypothetical proteins. Only one member of families of nearly identical ORFs will be amplified for printing and 311 highly similar transposase genes will not be arrayed. Each PCR product contains terminal adaptamers that allow further amplification of the entire genome with minimal effort and expense. Following the printing of the array, dual hybridizations with fluorescently-labeled cDNA will be employed to quantitatively compare the transcript level of each gene in ammonium grown vegetative cells with mRNA from cultures possessing heterocysts, akinetes or hormogonia. Genes that are preferentially expressed in non-vegetative cells will be targeted for disruption by insertional mutagenesis to explore a possible role for that protein in the differentiation or function of that particular cell type(s). Genomic approaches are also being complemented by mutational and reporter gene analysis of several known regulatory elements of heterocyst development, patS, patN and hetR, to determine the epistatic relationships between these elements in coordinating the initation of patterned heterocyst differentiation. *Corresponding author Session II Oral Presentation Abstracts 20 Photoreduction of O2, mediated by two A-type flavoproteins, may consume large fraction of the electrons produced by water cleavage in cyanobacteria but does not produce H2O2. YAEL HELMAN1, DAN TCHERNOV4, LEONORA REINHOLD1, MARI SHIBATA2, TERUO OGAWA2, RAKEFET SCHWARZ3, ITZHAK OHAD1, BOAZ LUZ1, AARON KAPLAN1* 1 Minerva Centre for Photosynthesis under Stress, The Hebrew University of Jerusalem, Israel 2 Bioscience Center, Nagoya University, Chikusa, Nagoya 464-8601, Japan 3 Faculty of Life Sciences, Bar-Ilan University, Ramat-Gan, Israel 4 Interuniversity Institute for Marine Science, Eilat, Israel Photoreduction of O2 by photosynthetic electron transfer, the Mehler reaction, is observed in all groups of oxygenic photosynthetic organisms. Although reported over 50 years ago the electron transport chain that mediates this reaction has not yet been identified. Our study provides the first evidence for the involvement of A-type flavoproteins. Mutants of Synechocystis sp. strain PCC 6803 defective in genes encoding A-type flavoproteins, flv1 and flv3, failed to exhibit O2 photoreduction but performed normal photosynthesis and respiration. We show that the light-enhanced O2 uptake was not due to respiration or photorespiration. After dark acclimation, photooxidation of P700 was severely depressed in mutants flv1 and flv3 (confirmed by steady state fluorescence measurements) but recovered following light activation of CO2 fixation, which provides P700 with an additional electron acceptor. Inhibition of CO2 fixation prevented recovery but scarcely affected P700 oxidation in the wild type where the Mehler reaction serves as an alternative route for electrons. We conclude that the source of electrons for photoreduction of O2 is PSI; and that A-type flavoproteins Flv1 and Flv3 are essential for this process in vivo (1). Isolated Flv3 protein, expressed in E. coli, showed typical absorbance of an A-type flavoprotein
and consumed O2 when supplied with NADPH, in vitro. We propose that, in contrast to the case in eukaryotes, the Mehler reaction in cyanobacteria, reduces O2 directly to water in vitro, does not produce reactive oxygen species and that it may be evolutionarily related to the response of anaerobic bacteria to O2. Application of the three stable O2 isotope methodology (2) showed that photoreduction of O2 can be distinguished from other O2 consuming reactions and that, depending on the environmental conditions, this reaction may consume as much as 40 % of the electrons leaving PSII. 1. Helman, Y., Tchernov, D., Reinhold, L., Shibata, M., Ogawa, T., Schwarz, R., Ohad, I. and A. Kaplan (2003) Genes encoding A-type flavoproteins are essential for photoreduction of O2 in cyanobacteria Current Biology 13: 230-235. 2. Luz, B and B. Barkan (2000) Assessment of oceanic productivity with the triple-isotope composition of dissolved O2. Science 288: 2028-2031. * Corresponding author Session II Oral Presentation Abstracts 21 Cyclic nucleotides and response to a UV-B stress in Synechocystis PCC 6803 CADORET J.-C.1, PEREWOSKA I.1, ROUSSEAU B.1, ETIENNE, A.-L.1, VASS I.2 and HOUMARD J.1* 1 Organismes Photosynthtiques et Environnement, Ecole Normale Suprieure, FRE2433, 46 rue d'Ulm, 75230 Paris cedex 05, France. 2 Institute of Plant Biology, Biological Research Center, P.O. Box 521, 6701 Szeged, Hungary. Cyclic nucleotides (cAMP and cGMP) are ubiquitous signalling molecules from prokaryotes to higher eukaryotes that mediate adaptative responses of cells. They act as second messengers, and regulate gene expression, enzyme or channel activity, for example. Among prokaryotic organisms, cyanobacteria present the peculiarity of having the two types of cyclic nucleotides, and their levels vary with environmental changes (1). A strict control of cAMP and cGMP homeostasis is achieved by cyclases (for the synthesis) and phosphodiesterases (PDEs, for their degradation). In Synechocystis PCC 6803, cya1 codes for an adenylyl cyclase (1), cya2 for a guanylyl cyclase (2), and two ORFs (sll1624 and slr2100) were found by in silico analysis to exhibit similarities with eukaryotic PDEs (3). His-tagged Slr2100 was constructed and purified. In vitro it possesses a cGMP phosphodiesterase activity. In parallel, fully segregated slr2100 and sll1624 mutants were obtained by interposition. Under standard conditions, both have wild type growth rates. By measuring O2 evolution and performing fluorescence relaxation experiments on cells subjected to a UV-B stress, we found that slr2100 but not sll1624 was more sensitive to UV-B than the wild type. UV-B radiations are known to cause important damages to the photosynthetic apparatus, in particular to PSII, leading to a decreased O2 evolution. More specifically we found that slr2100 is impaired in PSII repair when illuminated with UV-B, and that the wild type behaves similarly to slr2100 upon addition of dipyridamol, a specific inhibitor of cGMP phosphodiesterases. Comparative macroarray analyses and quantitative PCRs were performed to monitor changes in gene expression. Altogether, the data show that, during a UV-B stress, cGMP play an important role in signal transduction, and that in Synechocystis PCC 6803 photoacclimation mechanisms are linked to the intracellular levels of cyclic nucleotides. References
1. Cann, M. (2003) New Phytologist 161: 2334. 2. Terauchi, K. & Ohmori, M. (1999) Plant Cell Physiol. 40: 248-251. 3. Ochoa de Alda, J.A.G., Ajlani, G. & Houmard, J. (2000) J. Bacteriol. 182: 3839-3842. 4.Ochoa de Alda, J.A.G.. & Houmard, J. (2000) Microbiology 146: 3183-3194. * Author for correspondence; email: jhoumard@biologie.ens.fr Session II Oral Presentation Abstracts 22 A cool twist on RNA helicase expression J.M. BROWN, D. CHAMOT, and G.W. OWTTRIM* Department of Biological Sciences, University of Alberta, Edmonton, Alberta, Canada, T6G 2E9 Cyanobacterial survival in a wide array of ecosystems depends on their ability to rapidly and specifically sense and respond to prevailing conditions. Our lab studies a cyanobacterial DEAD-box RNA helicase, CrhC, whose expression is specifically regulated by temperature. RNA helicases are key players in many diverse cellular processes involving all aspects of RNA metabolism. Previously, we have proposed that CrhC performs a role in adaptation to reduced temperature in Anabaena sp. strain PCC 7120, as both transcript and protein accumulate at growth temperatures below 30oC. The regulatory mechanism(s) providing temperature dependent expression of CrhC is not known. At the transcriptional level, characterization of protein binding to the crhC promoter revealed a binding site for a putative 60 kDa repressor, phosphorylation of which represses crhC promoter activity above 30oC. An AT-rich region within the binding site is essential for temperature-dependent regulation of crhC expression at both the transcript and protein levels. At the post-transcriptional level, crhC expression from a constitutive promoter indicates that the 5 UTR confers temperature-dependent transcript stability below 30oC. Thus, CrhC expression is regulated through a combination of transcriptional and post-transcriptional temperature-dependent processes. The data are discussed with respect to potential functional role(s) performed by CrhC in cyanobacterial adaptation to environmental change. Session II Oral Presentation Abstracts 23 Dissection and reassembly of a cyanobacterial respiratory chain using recombinant electron transport proteins from Synechocystis sp. PCC6803 throughout. M. Paumann1, R. Duran2, C. Obinger3 and G. A. Peschek1 1 Molecular Bioenergetics Group, Institute of Physical Chemistry, University of Vienna, Althanstrasse 14, A-1090 Wien, Austria. 2 Instituto de Bioquimica Vegetal y Fotosintesis, Universidad de Sevilla, Americo Vespucio s/n, SP-41092 Sevilla, Spain. 3 Institute of Chemistry, University of Agricultural Sciences, Muthgasse 18, A-1190 Wien, Austria. E-mail: guenter.peschek@univie.ac.at The genes encoding cytochrome- c6 and plastocyanin (PC) in Synechocystis 6803 (petJ and petE) as well as the part of the ctaC gene that encodes the soluble, bimetallic CuA.CuA-binding domain of subunit II of the cytochrome-c oxidase, were overexpressed (either with or without his tag) in E. coli. After purification, the recombinant proteins were thoroughly characterized physicochemically and spectroscopically. All their properties were identical to published values obtained from corresponding native proteins. Of special interest were the thermodynamic and kinetic parameters of electron transfer reactions from reduced cytochrome-c6 and PC to the bimetallic CuA-centre which mimick the native situation of the terminal respiratory electron
transport in the membranes (both cytoplasmic and thylakoid membranes, CM and ICM, both of which are known as potential sites of RET). Conforming to previous observations, both cytochrome-c6 and PC proved to be efficient and alternatively indispensable electron donors not only to P700 (in photosynthesis) but also to the cytochrome -c oxidase in respiration, and the dependence of the reactions on the ambient ionic strength as reflected by Brnsted plots (using different cyt-c and PC species of different IEPs) were in perfect agreement with the Marcus theory. The results will be discussed in detail and in view of the close relationship and partial identity of RET and PET in cyanobacteria. (Literature: G. A. Peschek, C. Obinger and M. Paumann: Physiol. Plant. 120:358-369 (2004).) Session II Oral Presentation Abstracts 24 Session II: Heterocysts and nitrogen metabolism Session Chair: Karl Forchammer, Justus-Liebig Universitt Giessen Keynote speaker: James Golden, Texas A&M University, Regulation of heterocyst development and pattern formation Session II Oral Presentation Abstracts 25 Keynote Talk Regulation of heterocyst development and pattern formation JAMES W. GOLDEN Department of Biology, Texas A&M University, College Station, Texas 77843-3258 USA Anabaena (Nostoc) sp. strain PCC 7120 is a filamentous cyanobacterium that reduces atmospheric dinitrogen to ammonia in specialized differentiated cells called heterocysts. The differentiation of a photosynthetic vegetative cell into a nitrogen-fixing heterocyst requires extensive changes in gene expression that result in substantial morphological and physiological changes. As a postdoc in Robert Haselkorn's lab, I found that two DNA rearrangements affecting nitrogen fixation operons were programmed to occur during heterocyst differentiation. These rearrangements were found to result from the site-specific excision of 11,289-bp and 59,428-bp DNA elements from the open reading frames (ORFs) of the nifD and fdxN genes, respectively. The xisA gene on the nifD element encodes a phage integrase-family site-specific recombinase that is required for excision of the element. Excision of the fdxN element requires three genes present on the element: xisF, which encodes a resolvase-family sitespecific recombinase, and the nearby xisH and xisI genes. Later, a third programmed rearrangement was found to involve the excision of a 9,435-bp element from within the heterocyst-specific hupL gene. We have recently shown that the xisC gene on the hupL element is required for programmed excision of the element and that XisC and XisA are members of a distinct subclass of the phage integrase-family. During diazotrophic growth, filaments of Anabaena PCC 7120 produce a developmental pattern of single heterocysts separated by 10 to 15 vegetative cells. The patS gene encodes a 13 (or 17) amino acid peptide, which is thought to serve as a diffusible cell-to-cell signal that contributes to the regulation of heterocyst pattern by lateral inhibition. Overexpression of patS inhibits heterocysts, and a patS deletion mutant forms multiple contiguous heterocysts and abnormally short vegetative-cell intervals between heterocysts. Addition of sub-micromolar concentrations of a synthetic peptide representing the C-terminal 5 amino acids of PatS (PatS-5, RGSGR) to growth medium inhibits heterocyst development. The current data
support a model in which PatS signaling is important for resolution of pairs and clusters of differentiating cells. However, a variety of data indicate that factors other than PatS, such as the supply of nitrogen from heterocysts and signals requiring the hetN gene, also must be involved in heterocyst pattern formation. We are using several approaches to characterize the PatS signaling pathway. A set of patS minigenes encoding only the last 4, 5, 6, 7, and 8 codons were constructed, and all except the smallest suppressed heterocyst development. A GFP-PatS-5 fusion protein, a PatS-6His fusion, and two ORFs (other than patS and hetN) that encode an internal RGSGR sequence all suppress heterocysts when overexpressed in vegetative cells. These data are consistent with a PatS receptor located in the cytoplasm rather than on the plasma membrane. Genetic screens for bypass suppressors of the patS overexpression phenotype have identified several genes potentially involved in PatS signaling or the control of heterocyst development. For example, strains containing a hetR R223W allele fail to respond to PatS or other pattern formation signals, and overexpression of the R223W allele results in a lethal phenotype because all cells differentiate within a few days after nitrogen step-down. Recent work from Zhou's lab indicates that HetR binds DNA and that this activity is inhibited by PatS-5 pentapeptide, indicating that HetR is the PatS receptor, which is consistent with our studies. The continued analysis of heterocyst development will provide a better understanding of how a prokaryotic multicellular organism can perform both photosynthetic carbon fixation and nitrogen fixation simultaneously. Session II Oral Presentation Abstracts 26 The role of NtcA in heterocyst development and function. ALICIA M. MURO-PASTOR*, ELVIRA OLMEDO-VERD, ANA VALLADARES, ANTONIA HERRERO, and ENRIQUE FLORES Instituto de Bioqumica Vegetal y Fotosntesis, CSIC-Universidad de Sevilla, Avda. Amrico Vespucio 49, E-41092, Seville, Spain. Global nitrogen regulation is operated in cyanobacteria by the CRP family transcriptional regulator NtcA, which activates or represses expression of genes whose products are involved in nitrogen assimilation (1). In heterocyst-forming cyanobacteria, such as Anabaena sp. PCC 7120, NtcA is also required for heterocyst development and diazotrophic growth (2, 3), thus linking the process of heterocyst differentiation to nitrogen deprivation. NtcA is required for induction of hetR, wich encodes one of the earliest-acting proteins that are required during the sequence of events that leads to heterocyst differentiation (4, 5). In addition, because HetR is also required for induction of ntcA during heterocyst development, expression of hetR and NtcA exhibits a mutual dependency (6). Several genes whose expression is activated by NtcA during heterocyst differentiation are also dependent on HetR. In order to investigate whether this double dependence is actually operated at the transcriptional level via NtcA, with HetR being required to increase NtcA levels, we constructed strains that over-express NtcA both in the wild-type and hetR backgrounds. Increased levels of NtcA did not promote expression of heterocyst specific genes in the presence of combined nitrogen, corroborating that the activity of the NtcA protein is subjected to regulation in response to N availability (7). However, when the cells were subjected to nitrogen deficiency, although mature heterocysts were not developed in the hetR background, expression of the NtcA- and HetR-dependent devBCA operon (8) took place in both NtcA overexpressing strains. Additionally, NtcA-overexpressing strains did not exhibit a requirement for HetR for the excision of the nifD-intervening11-kb element. Thus, for the expression of some
genes, the requirement for HetR can be bypassed by increased levels of NtcA. The promoters of some NtcA-activated genes involved in heterocyst differentiation or function, e.g., those of hetC, devB or glnA, perfectly match the Class II canonical promoter defined for NtcA-activated genes (9). However, as the NtcA regulon becomes larger, different promoter architectures are being identified. Thus, the promoters of the coxBAC2 and coxBAC3 gene clusters, which encode two different cytochrome oxidases required for diazotrophic growth and are expressed in an NtcAdependent manner (10), contain NtcA binding sites that are located further upstream than in canonical NtcA-activated promoters. We are currently investigating whether the different features found in NtcA-dependent promoters, together with the cellular level of active NtcA protein, have a role in the determination of the hierarchy of gene activation during the process of heterocyst differentiation. (1) Herrero, A., A. M. Muro-Pastor, and E. Flores. 2001. J. Bacteriol. 183:411-425. (2) Fras, J. E., E. Flores, and A. Herrero. 1994. Mol. Microbiol. 14:823-832. (3) Wei, T.-F., T. S. Ramasubramanian, and J. W. Golden. 1994. J. Bacteriol. 176:4473-4482. (4) Buikema, W. J., and R. Haselkorn. 1991. Genes Dev. 5:321-330. (5) Black, T. A., Y. Cai, and C. P. Wolk. 1993. Mol. Microbiol. 9:77-84. (6) Muro-Pastor, A. M., A. Valladares, E. Flores, and A. Herrero. 2002. Mol. Microbiol. 44:1377-1385. (7) Luque, I., M. F. Vzquez-Bermdez, J. Paz-Yepes, E. Flores, and A. Herrero. 2004. FEMS Microbiol. Lett. in press. (8) Fiedler, G., A. M. Muro-Pastor, E. Flores, and I. Maldener. 2001. J. Bacteriol. 183:3795-3799. (9) Herrero, A., A. M. Muro-Pastor, A. Valladares, and E. Flores. 2004. FEMS Microbiol. Rev. in press. (10) Valladares, A., A. Herrero, D. Pils, G. Schmetterer, and E. Flores. 2003. Mol. Microbiol. 47:12391249. Session II Oral Presentation Abstracts 27 Arginine biosynthesis in Cyanobacteria is subjected to global nitrogen control via PII signal transduction. MANI MAHESWARAN, ANNETTE HEINRICH, ULRIKE RUPPERT and KARL FORCHHAMMER* Institut fr Mikrobiologie und Molekularbiologie; Justus-Liebig Universitt Giessen; IFZ Heinrich-Buff-Ring 26-32; D 35392 Giessen The first receptor protein for signal perception from the PII signal transduction protein in the cyanobacterium Synechococcus elongatus PCC 7942 is described. To identify proteins that interact with the PII signalling protein, a yeast two hybrid screening was conducted with glnB encoding PII as bait against a S .elongatus PCC 7942 genomic library. Among the positive clones, we found the argB product, encoding N-acetyl L-glutamate kinase (NAGK), the key enzyme of the arginine biosynthetic pathway. The interaction between PII and NAGK was confirmed by pull-down assays. To investigate complex formation between PII and NAGK in more detail, gel-filtration experiments were conducted. PII and NAGK form a tight complex in the absence of effector molecules and the unmodified seryl-residue 49 (the site of PII phosphorylation) is critical for complex formation. Binding of PII to NAGK strongly affects the catalytic activity of NAGK: The KM for N-acetylglutamate decreases and Vmax increases considerably. Furthermore, feedback inhibition of NAGK activity by arginine was reduced Titration of NAGK activity with PII and analytical ultracentrifugation experiments revealed that one PII trimer binds to one hexameric NAGK. The role of metabolite effector on PII and NAGK complex formation was studied using BIAcore and pull down experiments. The substantial effects that could be observed by ATP, ADP, 2-oxoglutarate and divalent cations will be reported.
In accord with the data that complex formation was impaired in PII mutants of Ser49, NAG kinase activity in S. elongatus extracts correlated with the phosphorylation state of PII, with high NAG kinase activities corresponding to non-phosphorylated PII (nitrogen-excess condition) and low activities to increased levels of PII phosphorylation (nitrogen poor condition), thus subjecting the key enzyme of arginine biosynthesis to global nitrogen control. 1) Heinrich, A., Maheswaran, M. Ruppert,U and Forchhammer, K (2004) Mol.Microbiology.52:1303-1314 *corresponding author Session II Oral Presentation Abstracts 28 Developmental and metal regulation of the modA gene of Anabaena variabilis ATCC 29413 BRENDA PRATTE and TERESA THIEL* Department of Biology, University of Missouri-St. Louis, One University Drive, St. Louis MO 63121 Molybdenum (Mo) is a trace element required for the function of many important enzymes including nitrogenase and nitrate reductase. Hence, many organisms have high-affinity Mo transport systems to scavenge Mo when it becomes scarce. The high-affinity molybdate transport system is an ABC-type transport system comprising four known genes: modA, modBC (fused into one ORF in A. variabilis), and modE. ModA binds molybdate in the periplasm, ModBC channels the molybdate into the cytoplasm of the cell using ATP, and ModE represses transcription of modA and modBC in the presence of molybdate. Although the structural components of the Mo-uptake system in A. variabilis closely resemble those found in E. coli, the regulation of this system is more complex. In a modE mutant, the rate of 99Mo-uptake is 10-fold higher in the presence of Mo than it is in the wild-type strain. However, in the modE mutant, the rate of molybdate transport is only about 20% of the rate measured for mutant cells starved for molybdate; therefore, other unknown factors also contribute to Mo-dependent repression of molybdate transport. In order to better understand the transcriptional control of this transport system, we constructed various size modA promoter::lacZ fusions to determine the specific regions that are necessary for transcription and for repression by molybdate. -galactosidase assays demonstrated a fragment spanning from 40 from the transcription start site to the start of modA was required for modA expression. The smallest fragment capable of transcription showed incomplete repression of -galactosidase activity in cells grown with either molybdate or tungstate, indicting that the region most critical for repression by molybdate is downstream of the 40 region. Complete repression of the modA transcription, however, required the region 125 to 225 from the transcription start site. In situ fluorescence localization of -galactosidase activity in filaments of A. variabilis has shown that the transcription of modA is also developmentally controlled. The modA gene appears to be controlled by both a vegetative cell promoter and heterocyst-specific promoter. Molybdate represses transcription of both promoters. Session II Oral Presentation Abstracts 29 Identification of Anabaena sp. strain PCC 7120 genes required specifically for heterocyst formation and function QING FAN1, GUOCUN HUANG1, SIGAL LECHNO-YOSSEF1, ELIZABETH WOJCIUCH1, YI LI1, C. PETER WOLK*1, SATOSHI TABATA2, AND TAKAKAZU KANEKO2, 1MSU-DOE Plant Research Laboratory, Michigan State University, E. Lansing, MI 48824, U.S.A. and 2 Kazusa DNA Research Institute, 2-6-7 Kazusa-kamatari, Kisarazu, Chiba, 292-0818, Japan
Anabaena sp. strain PCC 7120 (hereinafter, Anabaena) has been used extensively for genetic studies of cell differentiation to form heterocysts, cells specialized for the fixation of N2 under aerobic conditions. To facilitate the elucidation of mechanisms underlying Anabaena differentiation, we seek to identify the complement of genes required specifically for heterocyst formation and N2 fixation. We mutated Anabaena with transposon Tn5-1063 [1], which confers resistance to neomycin and other antibiotics. Mutant colonies presumptively unable to fix dinitrogen in the presence of oxygen (denoted the Fox- phenotype) were identified by their persistent change of color from blue-green to yellow, and lack of protracted growth, in response to nitrogen-deprivation. Such colonies were grown with nitrate supplemented with neomycin for selection, and their DNA was extracted. DNA contiguous with the transposons was amplified by inverse PCR, the PCR products were sequenced, and the sequences were localized within the genome of Anabaena. We isolated 1652 such mutants and identified the chromosomal positions of 1079 of them. In addition to known Fox genes, we identified many candidates for such genes. We are using complementation and insertional mutagenesis to test for which of these mutants the Fox-phenotype is really due to the transposon insertion. With few exceptions, complementation experiments were carried out initially with BAC (bacterial artificial chromosome) clones (conferring resistance to chloramphenicol and erythromycin) whose position was mapped as part of the Anabaena sequencing project [2]. Conjugative plasmid pRL443 [3] and a mobilizable methylating plasmid derived from pRL1124 [3] were introduced into Escherichia coli strain DH10B bearing a BAC. The resulting strain was mated di-parentally with a corresponding mutant, with selection for resistance to neomycin and erythromycin. To date, 76 mutated ORFs not previously shown to be Fox genes have been complemented by the introduced clones. The 76 include 10 ORFs, each, in the Hep and Hgl islands [4], and 56 ORFs elsewhere in the genome. Few ORFs that showed only a single transposon insertion were found to be Fox genes. Further experiments are being carried out with potentially complementing, mobilizable plasmids, based on RSF1010 or pDU1, that each carries only a single complete ORF. To date, we have finished complementation tests of 62 ORFs with such single-gene constructs. Of these ORFs, 47 were complemented, perhaps in some instances as a result of recombination. The other 15 are being tested for complementation by downstream ORFs, and by a combination of the mutated ORFs and their downstream ORFs. Presumptively regulatory genes identified as Fox genes include alr0117 (recently reported [5]), all0187, alr1086, alll1711 and all2760, although not all possible polar effects have been excluded. 1. Wolk, C.P., et al., Proc. Natl. Acad. Sci. U.S.A. 88: 5355-5359 (1991). 2. Kaneko, T., et al., DNA Res. 8: 205-213 (2001). 3. Elhai, J., et al., J. Bacteriol. 179: 1998-2005 (1997). 4. Ehira, S., et al., DNA Res. 10: 97-113 (2003). 5. Ning, D., and X. Xu, Microbiology. 150: 447-453 (2004). Session II Oral Presentation Abstracts 30 Calcium is required for heterocyst differentiation in Anabaena sp. PCC7120 I. TORRECILLA, F. LEGANS, I. BONILLA, J.C. FERNNDEZ-MORALES & *F. FERNNDEZ-PIAS Departamento de Biologa, Facultad de Ciencias, Universidad Autnoma de Madrid, Madrid 28049, Spain The impact of calcium signals in virtually all cells has lead to the study of its implication in prokaryotic organisms as a stress response modulator. Cell differentiation in adverse conditions is a common Ca2+- requiring response. Nitrogen starvation induces the differentiation of N2fixing heterocysts in the filamentous cyanobacterium Anabaena sp. PCC7120. Here we used a recombinant strain of this organism, expressing the photoprotein aequorin (1), to monitor the
intracellular free calcium concentration during the course of heterocyst differentiation. A specific calcium signature that is triggered exclusively when cells are deprived of combined nitrogen and generated by intracellular calcium stores was identified. We manipulated the intracellular calcium signal by treatment with specific calcium drugs, and subsequently assessed the effect of such manipulation on the process of heterocyst differentiation. Suppression, magnification or poor regulation of this signal prevented the process of heterocyst differentiation, thereby suggesting that a calcium signal with a defined set of kinetic parameters may be required for differentiation. Calcium transients in response to nitrogen stepdowns in the non differentiating hetR and hetP mutant strains expressing apoaequorin are also under analysis. 1. Torrecilla, I., Legans, F., Bonilla, I. and Fernndez-Pias, F. 2000. Use of recombinant aequorin to study calcium homeostasis and monitor calcium transients in response to heat and cold shock in cyanobacteria. Plant Physiology 123:161-175. * Author for correspondence; email: francisca.pina@uam.es Session III Oral Presentation Abstracts 31 Session III: Physiology, Metabolism and Global Responses (II) Session Chair: Francis X. Cunningham, Jr., University of Maryland Session III Oral Presentation Abstracts 32 Study on the transcription of genes encoding for putative peptide synthetases in Anabaena PCC7120. R. J JEANJEAN, C.-C. ZHANG LCB-CNRS, 31 Chemin Joseph Aiguier, 13402 Marseille Cedex 20, France. The genome of Anabaena PCC 7120 has been sequenced, showing the presence of several clusters of genes encoding microcytin synthetases, peptide synthetases and polyketide synthases (for example: all2643, all1649 etc). Nethertheless, Anabaena is known as a non-toxic strain which raises some question about the function of these genes and their expression. We have undertaken a study on the environmental conditions that activates the transcription of these genes. Semi-quantitative RT-PCR allowed us to estimate the level of transcription of the genes of the different clusters in total RNA extracted from cells having undergone several stress (starvation for iron, growth with molecular nitrogen, high light, salt stress, heat shock etc..). The trancripts were generally at a very low basal level under usual growth conditions and they were significantly increased when cells were grown in a medium depleted of iron. Session III Oral Presentation Abstracts 33 Characterisation of three adenylate cyclase Nostoc punctiforme ATCC 29133 mutants shows phenotypic disparity K.E.CHAPMAN1*, P.S.DUGGAN1, N.A.JOSEPH2 & D.G.ADAMS1 1) School of Biochemistry & Microbiology, University of Leeds, Mount Preston Street, Leeds, LS2 9JT, UK. 2) Tecan UK, Theale Court, 11-13 High Street, Theale, RG7 5AH, UK. Adenylate cyclase (AC), encoded by the cya gene, is an enzyme that catalyses the formation of the cyclic nucleotide, adenosine 3,5,-cyclic monophosphate (cAMP) from ATP (1). This cyclic nucleotide is an important molecular messenger in both prokaryotic and eukaryotic
organisms, mediating signals from outside the cell to target proteins that regulate gene expression, cell division and / or enzyme activity (2). cAMP is widely distributed in bacteria and although large amounts of the nucleotide have been detected in cyanobacteria, in particular those with filamentous morphology, physiological roles have yet to be confirmed (2). Six potential ACs have been identified in Anabaena PCC 7120, five (cyaA, cyaB1, cyaB2, cyaC & cyaD) through complementation analysis (3) & most recently, cyaE by searching the Anabaena genome project (4 & 5). All have catalytic domains near the C-terminal region with significant structural similarity to the catalytic domains of eukaryotic ACs but have different regulatory components from each other upstream of the catalytic domain (3). It is apparent that, like Anabaena PCC 7120, Nostoc punctiforme has several putative adenylate cyclase genes, including cyaA, cyaB, cyaC & cyaD. cyaC encodes somewhat of a novel protein, consisting of a number of distinct Nterminal domains including two response regulator domains & one histidine kinase domain (3). Work conducted at the University of Leeds (6), whereby a N. punctiforme cyaC mutant (H1) was generated through transposon mutagenesis, suggests a possible role for CyaC in the control of cellular differentiation, as well as in the formation of plant-cyanobacterial symbiotic associations. Subsequently, a site-directed mutant (KC1) was created by inserting a kanamycin resistance gene into cyaC close to the N-terminus. Unlike H1, which infected the liverwort Blasia pusilla at a significantly higher rate than WT 29133, KC1 infected the plant auricles at low frequency. The domain disrupted by the transposon Tn5 in H1 was the proposed catalytic domain of cyaC and so a second mutant (KC2) was created, whereby the kanamycin resistance gene was inserted towards the C-terminus within the putative catalytic domain. Physiological analysis unveiled similarities between KC2 and H1, both infecting Blasia at a significantly higher frequency than wild-type or KC1. cAMP assays, complementation analysis and cyaC expression studies are being carried out in order to investigate these phenotypes further, with the ultimate aim of elucidating possible explanations behind this phenotypic disparity. 1) Botsford, J.L. & Harman, J.G. (1992). Cyclic AMP in prokaryotes. Microbiol Revs; 56: 100-22 2) Ohmori, K. & Ohmori, M. (1993). J Gen Appl Microbiol; 39: 247-50 3) Katayama, M. & Ohmori, M. (1997). J Bacteriol; 179: 3588-93 4) Kasahara et al. (2001). J Biol Chem; 276: 10564-10569 5) Ohmori et al (2001). DNA Res; 8: 271-284 6) Joseph, N.A. (2001). PhD Thesis, University of Leeds Session III Oral Presentation Abstracts 34 Pervasive cyanophage in a Laurentian Great Lakes: applications of molecular techniques to gain insight on their distribution and ecology MATHEW J. CARBERRY and STEVEN W. WILHELM* Department of Microbiology, The University of Tennessee, Knoxville, TN 37996 Viruses play important roles in aquatic microbial communities. Although marine viruses have received significant attention in recent years, freshwater viruses have received comparatively little attention, despite the importance of our freshwater resources. Invasive species have also received significant attention from the scientific community, but the focus has been on macrofaunal invasions, with virtually no attention paid to microbial invaders. During recent studies of the viral community in Lake Erie, we have discerned the presence of viruses capable of infecting marine cyanobacteria of the genus Synechococcus. These viruses appear to be well distributed throughout the lake. Preliminary sequence analysis suggests a relationship between this new virus group and previously characterized marine cyanomyoviridae. Applications of quantitative polymerase chain reaction (qPCR) to this system allow researchers to quantify the copies of specific genes in a sample and infer the abundance of these viruses in the absence of
cumbersome infection assays. Data obtained from these experiments will be presented in comparison with classical enumeration techniques to assess the effectiveness of qPCR for enumeration of active cyanobacterial viruses. Session III Oral Presentation Abstracts 35 Evidences for two novel phycobilisome linkers in the marine cyanobacterium Synechococcus sp. WH8102, impact of high light and ultraviolet radiations on the phycobilisome structure and composition. 1* Christophe SIX, 2Jean-Claude THOMAS, 3Brian PALENIK, 4Yves LEMOINE, 1Frederic PARTENSKY 1 Station Biologique, UMR 7127 CNRS and University Paris 6, 29682 Roscoff, France. 2 Ecole Normale Superieure, UMR 8543, Laboratoire Organismes Photosynthetiques et Environnement. 75230 Paris, France. 3 Marine Biology Research Division, Scripps Institution of Oceanography, University of California, La Jolla, CA 92093-0202, USA. 4 Equipe de Phycologie et Production Primaire, UMR CNRS-USTLille 8013 ELICO Villeneuve d'Ascq France. The recent release by the Joint Genome Institute of the whole genome sequence of Synechococcus sp. WH8102 provides unprecedented insights into the structure of a marine Synechococcus phycobilisome (PBS). Genome analyses showed that PBS rods of WH8102 are constituted by one type of phycocyanin (R-PCII) and two types of phycoerythrins (C-PEI and CPEII) which is a unique feature of marine Synechococcus. Absence of cpcC and cpcD genes further suggests that there is only one disc of R-PCII per rod. Genome analyses alsoreveal the presence of 9 genes encoding putative linker polypeptides. Five of these linkers (including two novel ones) are likely phycoerythrin (PE)-associated. Biochemical analyses showed that at least 8 predicted linkers were present and that four of them were chromophorylated, including the two new ones. The first one (SYNW2000) is unusually long (548 residues) and apparently results from the fusion of homologues of MpeC, a phycoerythrin-II linker, and of CpeD, a phycoerythrin-I linker, therefore suggesting that SYNW2000 may coordinate the junction between PEI and PEII hexamers. The second one (SYNW1989) has a more classical size (300 residues) and is also a MpeC homologue. The effect of growth irradiance on the structure and pigmentation of these PBSs was also investigated. Besides evidences of a decrease of PE in the PBS with increasing culture irradiances, we also observed a weak but significative decrease of the phycoerythrobilin (PEB) to phycourobilin (PUB) ratio at high light which can be interpreted as a decrease in the PEII to PEI ratio. This indicates that PBS acclimation to high light involves a partial degradation of PEII, the most distal part of PBS, as confirmed by observation of a decrease in the relative proportion of MpeC with regard to all other linkers. Effects of UV radiations on the PBS structure and composition have also been investigated. Corresponding author : Christophe SIX. Session III Oral Presentation Abstracts 36 Evidences for two novel phycobilisome linkers in the marine cyanobacterium Synechococcus sp. WH8102, impact of high light and ultraviolet radiations on the phycobilisome structure and composition.
1* Christophe SIX, 2Jean-Claude THOMAS, 3Brian PALENIK, 4Yves LEMOINE, 1Frederic PARTENSKY 1 Station Biologique, UMR 7127 CNRS and University Paris 6, 29682 Roscoff, France. 2 Ecole Normale Superieure, UMR 8543, Laboratoire Organismes Photosynthetiques et Environnement. 75230 Paris, France. 3 Marine Biology Research Division, Scripps Institution of Oceanography, University of California, La Jolla, CA 92093-0202, USA. 4 Equipe de Phycologie et Production Primaire, UMR CNRS-USTLille 8013 ELICO Villeneuve d'Ascq France. The recent release by the Joint Genome Institute of the whole genome sequence of Synechococcus sp. WH8102 provides unprecedented insights into the structure of a marine Synechococcus phycobilisome (PBS). Genome analyses showed that PBS rods of WH8102 are constituted by one type of phycocyanin (R-PCII) and two types of phycoerythrins (C-PEI and CPEII) which is a unique feature of marine Synechococcus. Absence of cpcC and cpcD genes further suggests that there is only one disc of R-PCII per rod. Genome analyses alsoreveal the presence of 9 genes encoding putative linker polypeptides. Five of these linkers (including two novel ones) are likely phycoerythrin (PE)-associated. Biochemical analyses showed that at least 8 predicted linkers were present and that four of them were chromophorylated, including the two new ones. The first one (SYNW2000) is unusually long (548 residues) and apparently results from the fusion of homologues of MpeC, a phycoerythrin-II linker, and of CpeD, a phycoerythrin-I linker, therefore suggesting that SYNW2000 may coordinate the junction between PEI and PEII hexamers. The second one (SYNW1989) has a more classical size (300 residues) and is also a MpeC homologue. The effect of growth irradiance on the structure and pigmentation of these PBSs was also investigated. Besides evidences of a decrease of PE in the PBS with increasing culture irradiances, we also observed a weak but significative decrease of the phycoerythrobilin (PEB) to phycourobilin (PUB) ratio at high light which can be interpreted as a decrease in the PEII to PEI ratio. This indicates that PBS acclimation to high light involves a partial degradation of PEII, the most distal part of PBS, as confirmed by observation of a decrease in the relative proportion of MpeC with regard to all other linkers. Effects of UV radiations on the PBS structure and composition have also been investigated. Corresponding author : Christophe SIX. Session III Oral Presentation Abstracts 37 Acid stress response in two strains of Synechocystis species K.M. SHEA, T.N. NGUYGEN, C.Z. YANONNI, J.J. HUANG and M.M. ALLEN Department of Biological Sciences, Wellesley College, Wellesley, MA 02481, U. S. A. The aim of this research is to characterize and compare the acid stress response in Synechocystis sp. strains PCC 6803 and 6308. Exponentially growing cells were transferred to either buffered or unbuffered BG-ll media ranging in pH, and growth and external pH were monitored over time. Both strains are incapable of growing in media with a pH of less than six, and they have a cell density-dependent ability to increase the external pH when placed at pH 4 or above. Measurement of ammonium concentration in unbuffered medium after acid shock shows that ammonia is excreted by cells, causing an increase in external pH. Neither strain appears to have an acid tolerance response since growth at mildly acidic pH does not increase the ability of
cells to later grow in media with a pH lower than 4. Protein synthesis during acid stress, in medium buffered at pH 5.5, was studied using one-dimensional and two-dimensional gel electrophoresis, as well as autoradiography. One-dimensional autoradiography showed that many proteins, including phycocyanin, were differentially expressed. Data analysis of 2D gels, using Compugen Z3 software, identified approximately 100 proteins that exhibit differential expression in Synechocystis sp. strain 6803. MALDI-TOF-MS analysis indicated that the expression of the protein synthesis elongation factor Tu increases with acid stress while DnaK shows variable expression. Additional differentially expressed proteins are being identified by mass spectrometry. * M.M. Allen Session III Oral Presentation Abstracts 38 Characterization of mrpA, a gene with roles in pH adaptation and resistance to Na+ in the cyanobacterium Anabaena sp. PCC7120. A. BLANCO-RIVERO, F. FERNNDEZ-PIAS, E. FERNNDEZ-VALIENTE & *F. LEGANS Departamento de Biologa, Facultad de Ciencias, Universidad Autnoma de Madrid, Madrid 28049, Spain Transposon mutagenesis of Anabaena sp. PCC7120 led to the isolation of a mutant strain, PHB11, that grew poorly at external pH values above 10. The mutant strain was also sensitive to increasing Na+ concentrations and this sensitivity was higher under basic conditions. Mutant strain PHB11 also showed a significant inhibition of both photosynthesis and respiration, independently of the external pH, although the inhibition became more pronounced under alkaline pH. Interestingly; the mutant was also unable to fix N2 both under aerobic and anaerobic conditions, differentiating immature heterocysts. Reconstruction of the transposon mutation of PHB11 in the wild type strain reproduced the phenotype of the original mutant. The wild type version of the mutated gene was cloned and the mutation complemented. In vivo expression studies indicated that mrpA is induced with increasing external Na+ concentrations and alkaline pH. In mutant strain PHB11, the transposon had inserted within an ORF that is part of a seven ORFs operon with significant homology to a family of bacterial operons that are believed to code a novel multiprotein cation/proton antiporter involved in pH adaptation and resistance to salt stress. The Anabaena operon was denoted mrp (multiple resistance and pH adaptation) following the nomenclature of the Bacillus subtilis operon; based on the highest homology with the Bacillus mrp genes, the ORF mutated in PHB11 was denoted mrpA. The mrp operon is also present in the genome of the unicellular Synechocystis sp. PCC6803, Thermosynechococcus elongatus BP1 and Synechococcus sp. PCC7942 , the marine filamentous Trichodesmium erythraeum and the heterocystous Anabaena variabilis but is absent from the marine unicellular Prochlorococcus marinus strains MED4 and MIT91313, Synechococcus WH-8102, the thylakoid-less Gloeobacter violaceus and the heterocystous Nostoc punctiforme. The cyanobacterial operons differ from the bacterial ones in that gene arrangement within the operon is mrpCDEFGAB instead of mrpABCDEFG; also mrpA is fourfold shorter than its bacterial homologues. Computer analysis suggested that all seven predicted Anabaena Mrp proteins were highly hydrophobic with several transmembrane domains; in fact, the predicted protein sequences coded by mrpA, mrpB and mrpC show a clear homology to hydrophobic subunits of the proton pumping NADH:ubiquinone oxidoreductase (Complex I). The Synechocystis sp PCC6803 mrp operon consists of 9 ORFs instead of 7 probably due to duplication of ORFs C and D. Interestingly; Wang and coworkers (1) found in Synechocystis that two ORFs of a large transcriptional units were upregulated in response to a CO2 downshift. We have identified the
two ORFs as mrpD and its probable duplicate and have found that Anabaena mrpA is also induced twofold under Ci limitation. We propose, as it has been postulated in heterotrophic bacteria, that the cyanobacterial Mrp complex may be an unusual multicomponent cation/proton antiporter energized (al least partially) by electron transport through the subunits that resemble the hydrophobic core of complex I. Finally, the Na gradient created may drive nutrient uptake i.e. HCO3-, as suggested in Synechocystis (1). 1. Wang H-L., Postier B. L. and Burnap R.L. 2004. The Journal of Biological Chemistry 279:57395751. * Author for correspondence; email: francisco.leganes@uam.es Session III Oral Presentation Abstracts 39 Special Workshop BioLingua, a knowledge-base and programming environment for the analysis of cyanobacterial genes and genomes JEFF ELHAI,1*, JP MASSAR,2 JEFF SHRAGER,3 MIKE TRAVERS,4 AUSTIN HESS,5 JAMES MASTROS,1 SARAH COUSINS,1 MATTHEW BERGINSKI6 1 Center for the Study of Biological Complexity, Virginia Commonwealth University, Richmond VA 23284; 2massar@alum.mit.edu; 3Dept. of Plant Biology, Carnegie Institute of Washington, Stanford CA 94305; 4MDL Information Systems, San Leandro CA 94577; 5Dept. of Biology, Virginia Polytechnic Institute and State University, Blacksburg, VA 24061; 6School of Biology, Georgia Institute of Technnology, Atlanta GA 30332 BioLingua (1) puts in one place, behind one interface, all information we can gather concerning cyanobacteria whose genomes have been at least partially sequenced. This includes genomic information and annotation, of course, but also knowledge about metabolism and mass experimental results. Just as important, it provides a simple language that enables you to access and analyze the information in a way that (unless you're an expert programmer) would not have been possible to you before. The workshop will illustrate the simplicity of the language and power to answer important biological questions through several examples. Examples include: (a) What are the characteristics of genes that are found in heterocystous cyanobacteria but not other cyanobacteria? (b) What cyanobacterial proteins are induced under conditions of high intensity light that are within a given size class? (c) Can upstream sequence motifs be identified that are unusually common amongst those genes upregulated by nitrogen starvation? Other examples will be taken from the interests of the participants. BioLingua is freely available online (2) to the cyanobacteriological community, along with an extensive description of its capabilities and its use (3). 1. Massar JP, Travers M, Elhai J, Shrager J (2004). BioLingua: A Biologist's Computational `Workbench. Submitted to Bioinformatics. 2. BioLingua Server, Cyanobacterial Edition. http://nostoc.stanford.edu:8002/biologin 3. BioLingua Help. http://ramsites.net/~biolingua/help/ * Jeff Elhai, Center for the Study of Biological Complexity, 1000 W. Cary St., Virginia Commonwealth University, Richmond VA 23284. E-mail: ElhaiJ@VCU.Edu; Tel: 1-804-828-0794 Session IV Oral Presentation Abstracts
40 Session IV: Photosynthesis and responses to light Session Chair: John Cobley, University of San Francisco Session IV Oral Presentation Abstracts 41 Promoter analysis of genes encoding subunits of photosystem I in Synechocystis sp. PCC 6803 1 MURAMATSU, M., 1 SONOIKE, K. and 2Y. HIHARA* 1 Department of Integrated Biosciences, The University of Tokyo, Japan, 2 Department of Biochemistry and Molecular Biology, Saitama University, Japan, In cyanobacteria, the amount of photosystem (PS) I complex decreases under high-light conditions. This decrease seemed to be mainly achieved by the coordinate down-regulation of promoter activities of PS I genes in Synechocystis sp. PCC 6803. Namely, upon the shift of the cells to high-light conditions, transcript levels and promoter activities of PSI genes were downregulated to 5-10% of the level of low-light conditions (1). On the other hand, when cells were returned to low-light conditions, transcript levels and promoter activities of PSI genes rapidly recovered. However, the mechanism by which PS I promoter activities are modulated is totally unknown. In this study, we investigated promoter architectures of psaAB genes encoding reaction center subunits and psaD gene encoding a small subunit of PS I. As a first step, the transcriptional start points of psaAB and psaD genes were determined. There existed two major transcriptional start points in psaA gene, -45 and 144 relative to the translational start point (+1), and a single major transcriptional start point at 35 in psaD. Next, to identify cis-regulatory elements, various fragments of upstream region of psaAB and psaD were fused to luxAB reporter gene, and luminescence levels from each construct were compared. It was found that psaAB had two promoters (P1, P2) corresponding to each of the two transcriptional start points, and each promoter possessed positive and negative cis-elements. psaD gene also had two promoters (P1, P2), although we could not identify transcriptional start point corresponding to P1. DNA mobility shift assay showed that both promoters of psaAB bound protein factor(s) but we could not detect any specific protein binding in psaD promoters so far. Furthermore, we found at least three light-responsive elements in psaAB promoter region. The molecular mechanism of light response of PSI genes will be discussed. (1) Muramatsu and Hihara, Planta 216: 446-453, 2003 * Corresponding author Session IV Oral Presentation Abstracts 42 Identification of a cis-acting element involved in negative control of the hliA gene of cyanobacteria in response to high light ANTHONY D. KAPPELL and *LORRAINE G. VAN WAASBERGEN. Department of Biology, University of Texas at Arlington, Arlington, TX 76019 The high-light-inducible proteins (HLIPs) of cyanobacteria are involved in protecting the cells from high-intensity light (HL). The hli genes encoding the HLIPs are expressed in response to HL or low-intensity blue/UV-A light (a response that appears to be related to the HL response). We undertook an analysis of the region upstream of hliA from Synechococcus elongatus PCC 7942 for cis-acting elements involved in regulation of the gene. Expression of hliA was monitored following various deletions and mutations made to the upstream region of
gene fused translationally to a GUS reporter gene on a plasmid that replicates autonomously in the cyanobacterium. Constructs with deletions to -134 (relative to the transcriptional start site) showed no significant difference in expression from the undeleted construct in low light (LL), HL, or UV-A light. However, a deletion to 25 (on the plasmid pHG-del) or an 18-bp Pho box inserted (originally for other purposes) between -30 and 28 resulted in 8-9 fold higher expression of the gene in LL and 2-3 fold higher expression in HL and UV-A light, suggesting that these changes interrupted the binding of a repressor protein that is most active in LL. A substitution at -26 and -27 from TT to CG (on the plasmid pHG-stu) practically abolished expression under all light conditions, suggesting that the change resulted in increased affinity for binding of the putative repressor (or decreased ability for RNA polymerase to bind to the promoter). Partial deletion by interposon mutagenesis of the apparently essential NblS sensor kinase known to control hliA expression resulted in enhanced expression of the gene in LL, HL and UV-A light, further suggesting that hliA is under negative control (and that NblS is involved in that control). Gel mobility shift assays were done to identify the activity of DNA-binding proteins using the sequence from -34 to -17 of the hliA gene (and equivalent 18-bp regions of the altered sequences present in pHG-del and pHG-stu) and crude protein extracts from cells grown in LL and HL. The assays showed a commonly shifted band in each case, with the shifted complex being more abundant in LL than in HL. The abundance of the complex was much less in both LL and HL using the pHG-del sequence than using the wild-type sequence and much greater in LL using the pHG-stu sequence. These results support the hypotheses regarding the binding of a repressor protein to the sequences based on the GUS assays. Similar mobility shift assay results were obtained using Synechocystis sp. strain PCC 6803 extracts and a significantly similar 18-bp sequence located in the regions upstream of several hli genes from Synechocystis, indicating the conserved nature of this HL-responsive element. We are currently involved in attempts to identify the putative repressor protein that binds to this site. *Author for correspondence; email: lorivw@uta.edu Session IV Oral Presentation Abstracts 43 PsoR is a regulator of phycobilisome abundance in the cyanobacterium, Fremyella diplosiphon. JOHN COBLEY*, QIAN WANG, KATRINA SHIEH, JENNIFER SEKI & JEFFREY ODA. Dept. of Chemistry, University of San Francisco, 2130, Fulton St., San Francisco, CA 94117, USA. In Fremyella diplosiphon green light induces the synthesis of phycoerythrin (PE) and represses the synthesis of phycocyanin (PC). This acclimation to the color of ambient light results in maximum light absorption for photosynthesis, and has been shown to involve the green-lightregulated transcription of four operons. Members of a class of mutants of F. diplosiphon ("blue" mutants) overproduce phycobilisomes (PBSs). Strain F. diplosiphon SF2412-15 is a characteristic "blue" mutant, and was generated by transposon mutagenesis (1). Recovery of the transposon from F. diplosiphon SF2412-15, followed by sequencing of the DNA flanking the transposon has led to the identification of an ORF which we have called psoR (phycobilisome abundance regulator). Clones with the characteristic "blue" phenotype could be recreated when a frameshifted allele of psoR was exchanged into the wild-type genome by homologous recombination (2). PCR analysis of genomic DNA from the recreated "blue" clones has demonstrated that, in these strains, allelic segregation is complete. Fluorescence emission spectra at 77K show that the transposon mutant and the engineered psoR - strains all overproduce PBSs to a similar extent. Conversely, overexpression of psoR+ from a shuttle plasmid replicating in F. diplosiphon + resulted a dramatic 10-20 fold decrease in the PBS/chlorophyll a ratio. Collectively these data suggest that PsoR is an important negative regulator of PBS abundance. Considerable genetic information has already been obtained about the regulation of
PBS degradation (3). psoR is the first gene implicated the regulation of PBS abundance. Genes highly similar to psoR are found in the genomes of all PBS-containing cyanobacteria for which a genome sequence is available, with two exceptions; Gloeobacter violaceus PCC 7421 and Synechococcus sp. WH8102. No gene similar to psoR is present in any of the three Prochlorococcus species for which a genome sequence is available. An NCBI Conserved Domain Search predicts PsoR from F. diplosiphon (554 amino acids) to be "an exonuclease of the beta-lactamase fold involved in RNA processing" (COG1236, with random expectation of 2 x 10-57). Our data strongly suggest that PsoR plays a crucial a role in a post-transcriptional step in the regulation of phycobilisome synthesis. Pleiotropy can be especially valuable in helping to understand relationships between different regulatory processes. The psoR - mutants of F. diplosiphon discussed above show two changes in phenotype; not only do these mutants overproduce phycobilisomes (PBSs), but they are also strongly impaired in the synthesis of PE in response to green light. This pleiotropy of psoR mutants suggests that, in F. diplosiphon, the regulation of phycobilisome abundance and the regulation of phycobilisome composition (by the color of available light) are integrated responses, and that a step which is key for both responses occurs at the level of RNA metabolism. (1) Cobley, J.G., Seneviratne, L., Drong, L., Thounaojam, M., Oda ,J.F., and Carrol, J. (1999) Transposition of Tn5 derivatives in the chromatically adapting cyanobacterium, F. diplosiphon. In The Phototrophic Prokaryotes. Peschek, G., Lffelhardt, W., and Schmetterer, G. (eds). New York: Kluwer Academic/Plenum, pp. 443-451. (2) Cobley, J.G., Clark, A.C., Weerasurya, S., Queseda, F.A., Xiao, J.Y., Bandrapali, N., D'Silva, I., Thounaojam, M., Oda, J.F., Sumiyoshi, T., and Chu, M.-H. (2002) CpeR is an activator required for expression of the phycoerythrin operon (cpeBA) in the cyanobacterium, Fremyella diplosiphon, and is encoded in the phycoerythrin linker-polypeptide operon (cpeCDESTR). Mol Microbiol 44: 1517-1532. (3) Grossman, A.R., Bhaya, D., and He, Q. (2001) Tracking the light environment by cyanobacteria and the dynamic nature of light harvesting. J Biol Chem 276: 11449-11452. Session IV Oral Presentation Abstracts 44 LdpA: a component of the circadian clock senses redox state of the cell NATALIA B. IVLEVA1, MATT R. BRAMLETT2, PAUL A. LINDAHL2 and SUSAN S. GOLDEN1* 1 Department of Biology and 2Department of Biochemistry and Biophysics, Texas A&M University, College Station, Texas 77843, USA Cyanobacteria are the only bacteria that have been shown to have circadian rhythmicity, an endogenously controlled oscillation of physiological activities with a period of roughly 24 hours. The circadian rhythms in the cyanobacterium Synechococcus elongatus PCC 7942 and other organisms are entrained by a variety of environmental factors. In cyanobacteria the mechanism of transduction of environmental input signals to the central oscillator of the clock is not known. Our earlier study identified ldpA as a gene involved in light-dependent modulation of the circadian period. Here we show that the LdpA protein contains two 4Fe-4S clusters and is redox sensitive. Affinity purification demonstrated that LdpA copurifies with proteins previously shown to be a part of circadian control. The data suggest that LdpA is able to sense the redox
state of a cell and is an intrinsic component of the clockosome complex. These findings reveal a novel input pathway to the circadian oscillator. * Corresponding author Session IV Oral Presentation Abstracts 45 Global functional analysis of circadian clock genes in Synechococcus elongatus PCC 7942: strategy and progress C. KAY HOLTMAN, YOU CHEN, PAMELA SANDOVAL, ALEJANDRA GONZALES, MARK S. NALTY, PHILIP A. YOUDERAIN, and SUSAN S. GOLDEN* Department of Biology, Texas A&M University, College Station, TX 77843-3258, USA The cyanobacteria are the first prokaryotes shown to possess a circadian clock, an internal timing system that anticipates daily environmental changes, thereby allowing the organism to adjust physiological activities for better performance. Most studies of cyanobacterial circadian rhythms have employed Synechococcus elongatus PCC 7942, a unicellular fresh water obligate photoautotroph. Several genes necessary for clock function were initially identified in PCC 7942 and subsequently found to be widespread among cyanobacteria, including kaiABC, a locus that encodes the components of the central oscillator. However, the molecular mechanism of the clock is still not clear. We aim to identify all genes required for clock function in cyanobacteria to ascertain how the clock ticks at the molecular level, and to understand the physiological significance of circadian rhythms. We have undertaken a transposon-mediated mutagenesis and sequencing strategy to isolate insertional mutants of essentially every PCC 7942 gene. By identifying sequence surrounding transposon insertions in a cosmid library of PCC 7942 we have identified positions of insertions in 28 cosmids, which cover roughly 920 kb, or 34%, of the genome. Integration of these data with the complete genome sequence, recently closed and finished by the Joint Genome Institute, has allowed us to annotate the locations of all insertions and identify specific clones for mutagenesis to complete the project. Transposon insertions have been crossed into the PCC 7942 genome for inactivation of approximately 500 genes and the resulting mutants have been screened for circadian phenotypes. Insertions in genes clpP2 and clpX resulted in merodiploid cells with long circadian period phenotypes. We also identified several other loci that show changes in circadian rhythm properties. At the end of the project, archived mutagenesis templates will be available for nearly every locus. These functional data, paired with the genome sequence and opportunities for cyanobacterial comparative genomics, provide a valuable resource for understanding cyanobacterial physiology. *Author for correspondence; email: sgolden@tamu.edu Session IV Oral Presentation Abstracts 46 The mechanism of circadian regulation of gene expression in cyanobacterium Synechococcus elongates PCC 7942. MASATO NAKAJIMA, ALI AZAM TALUKDER, TAEKO NISHIWAKI, HIDEO IWASAKI, *TAKAO KONDO Division of Biological Science, Graduate School of Science, Nagoya University, Core Research for Evolutional Science and Technology (CREST), Circadian rhythms, biological oscillations with a period length of about 24 h, are found ubiquitously among eukaryotes. In prokaryotes, only Cyanobacteria are known to have the circadian clock. A gene cluster composed of kaiA, kaiB and kaiC has been cloned as central components of cyanobacterial clock in the unicellular cyanobacterium Synechococcus elongatus strain PCC 7942 (1). KaiC and KaiA likely act as negative and positive elements in the molecular feedback loop of kaiBC expression, respectively. In eukaryotic models, cis-acting elements and trans-acting factors are thought to be clock specific components. However, the
mechanism by which Kai proteins generate circadian rhythm still remains unknown. It was recently reported that almost all of gene expressions in cyanobacteria showed circadian rhythm, suggesting that the cyanobacterial clock system was genome-wide (2). Indeed, re-examination of locations of Kai proteins clarified the association of Kai proteins with nucleoid, which was a complex of genomic DNA with proteins. These associations were weak to release by washing with low salt. Moreover, we could not detect associations of Kai proteins with DNA. Hence, the mechanism of cyanobacterial circadian clock may be different from that of eukaryotic clock. We will discuss, based on genetic and biochemical results, the mechanism of genome-wide circadian gene expression. (1) Ishiura, M., Kutsuna, S., Aoki, S., Iwasaki, H., Andersson, C.R., Tanabe, A., Golden, S.S., Johonson, C.H. and Kondo, T. (1998) Science, 281, 1519-1523 (2) Nakahira, Y., Katayama, M., Miyashita, H., Kutsuna, S., Iwasaki, H., Oyama, T. and Kondo, T. (2004) Proc. Natl. Acad. Sci. USA, 101, 881-885 *corresponding author. E-mail: kondo@biol1.bio.nagoya-u.ac.jp Session IV Oral Presentation Abstracts 47 Circadian mechanisms in cyanobacteria Yao Xu, Tetsuya Mori, Mark.Woelfle, Carl H. Johnson Department. of Biological Sciences, Vanderbilt University, Nashville, TN 37235 USA Circadian (daily) rhythms are endogenous oscillations of biochemical, cellular, developmental, and behavioral activities found in a wide variety of organisms, including the prokaryotic cyanobacteria. The molecular machinery that permits the measurement of time is referred as the biological clock or circadian clock. The fundamental properties of circadian clocks in eukaryotes and in cyanobacteria are the same: surprisingly precise self-sustained oscillations with an approximately 24 h period that are temperature compensated and entrainable by environmental cycles. The ultimate explanation for the mechanism of these unusual oscillators will require characterizing the structures, functions, and interactions of the molecular components of circadian clocks. We have used the simplest model system, the cyanobacterium Synechococcus elongates, to elucidate common themes and mechanisms in circadian timekeeping systems. The circadian clock in cyanobacteria globally regulates the expression of essentially all promoters in the organism. A cluster of three circadian clock genes encodes the essential circadian clock components KaiA, KaiB and KaiC that interact each other and comprise of a feedback loop. The KaiB and KaiC protein levels display robust rhythms, whereas the KaiA protein abundance undergoes little circadian oscillation. KaiC appears to be the central protein and forms the core of the KaiABC clock protein complex. Induction of the kaiC gene at specific phases elicits phase resetting. KaiC can exist in both phosphorylated and non-phosphorylated forms in vivo, and its phosphorylation status and the degradation rate are correlated with clock speed in vivo. KaiC can auto-phosphorylate and auto-dephosphorylate in vitro. KaiA and KaiB modulate the phosphorylation status of KaiC in vitro and in vivo: KaiA enhances KaiC phosphorylation (and/or inhibits its dephosphorylation), while KaiB antagonizes the effects of KaiA. KaiC forms hexameric ring structures that are reminiscent of related proteins that act directly upon DNA; it can bind forked DNA substrates. The structure of KaiC reveals the functional insights toward ATP binding, Kai-protein complex formation, and autophosphorylation sites, etc. We also addressed the adaptive significance of circadian rhythmicity by testing the relative fitness under competition between various strains of cyanobacteria expressing different circadian periods. Strains that had a circadian period similar to that of the light/dark cycle were favored under competition. Arhythmic strains could not compete well
against wild-type strains in light/dark cycles, but they could compete effectively in constant light. Our studies on circadian programming in cyanobacteria will be interpreted in the context of a new model for the cyanobacterial clock in which circadian gene expression is orchestrated by rhythmic structural changes in the chromosome that are in turn mediated by rhythmic changes in the activity of a KaiC-containing complex. Session V Oral Presentation Abstracts 48 Session V: General Structural Aspects Session Chair: Cheryl Kerfeld, University of California at Los Angeles Keynote Speaker: Petra Fromme, Arizona State University: Structure and Function of Photosystem I and II" Session V Oral Presentation Abstracts 49 Keynote Talk Structure and Function of Photosystem I and II PETRA FROMME Department of Chemistry and Biochemistry Physical Science Building PS-C155 Arizona State University Tempe, AZ 85287-1604 USA Photosystem I is the most complex membrane protein, whose structure had been determined.It catalyzes the electron transfer from plastocyanin/cytochrome c6 at the lumenal side of the thylakoid membrane to ferredoxin/flavodoxin at the stromal side by a chain of electron carriers.. Photosystem I of (cyanobacteria) consists of 12 protein subunits, to which more than 100 cofactors are non-covalently bound: one functional unit of Photosystem I contains 96 Chlorophyll a molecules, 22 carotenoids, 3 Fe4S4-clusters and 2 phylloquinones that perform the complex function of light harvesting and charge separation. Photosystem I exists as a trimer in the cyanobacterial membrane, with a molecular mass of more than 1 000 000 Da. The X-ray structure of photosystem I at a resolution of 2.5 [Jordan 2001] shows the location of the individual subunits and cofactors and provides new information on the protein-cofactor interactions. In the talk, biochemical data and results of biophysical investigations are discussed with respect to the X-ray crystallographic structure in order to give an overview of the structure and function of Photosystem I with special focus on the electron transfer and excitation energy transfer in PS I. The discussion will include the interaction sites of PS I with its soluble elctron carriers plastocyanain/cytochrome c6 and ferredoxin as well as possible interaction sites with the peripheral antenna systems of PS I. The structure of the oxygen-evolving Photosystem II was determined at 3.8 resolution based on crystals of Photosystem II isolated from the thermophilic cyanobacterium Synechococcus elongatus [Zouni 2001]. The structure shows a field of 36 transmembrane -helices of which 22 were assigned to the major subunits of Photosystem II. Information is also obtained about location, size and shape of the electron transport chain, including the manganese cluster that catalyses water oxidation. Our structural information of PS II from Synecococcus elongatus based on a preliminary 3.6 model will be compared to the data published for PS II from Synechococcus vulcanus [Kamiya and Shen 2003] and the structure at 3.5 A resolution by [Barber and Iwata in press(2003)]. Similarities and differences will be pointed out and address in respect to the structure-function relationship in PS II. Zouni,A ., Witt,H.T., Kern,J., Fromme,P.., Krau,N., Saenger,W. and Orth,P. (2001) Nature, 409, 739743 Crystal Structure of oxygen evolving Photosystem II from Synechococcus elongatus at 3.8 Resolution.
Jordan,P., Fromme,P.., Witt,H.T., O. Klukas , Saenger,W. and Krau,N. (2001) Nature 411, 909-917 Threedimensional structure of cyanobacterial Photosystem I at 2.5 resolution.\ Kamiya N, Shen JR (2003) Proc Natl Acad Sci U S A 100: 98-103 Crystal structure of oxygen-evolving photosystem II from Thermosynechococcus vulcanus at 3.7-A resolution. Session V Oral Presentation Abstracts 50 Supramolecular organization and dual function of the IsiA chlorophyllbinding protein in cyanobacteria NATALIYA YEREMENKO*1, ROMAN KOURIL2, JANNE A. IHALAINEN3, SANDRINE DHAENE3, NIELS VAN OOSTERWIJK2, ELENA G. ANDRIZHIYEVSKAYA3, WILKO KEEGSTRA2, HENK L. DEKKER4, MARTIN HAGEMANN5, EGBERT J. BOEKEMA2, HANS C.P. MATTHIJS1 AND JAN P. DEKKER3 1 Aquatic Microbiology, Institute of Biodiversity and Ecosystem Dynamics, Faculty of Science, Universiteit van Amsterdam, Nieuwe Achtergracht 127, 1018 WS Amsterdam, The Netherlands; 2 Department of Biophysical Chemistry, Groningen Biomolecular Sciences and Biotechnology Institute, University of Groningen, Nijenborgh 4, 9747 AG Groningen, The Netherlands; 3 Division of Physics and Astronomy, Faculty of Sciences, Vrije Universiteit, De Boelelaan 1081, 1081 HV Amsterdam, The Netherlands; 4 Swammerdam Institute for Life Sciences, Mass Spectrometry Group, University of Amsterdam, Nieuwe Achtergracht 166, 1018 WV Amsterdam, The Netherlands; 5 Universitt Rostock, Fachbereich Biowissenschaften, Pflanzenphysiologie, AlbertEinstein-Strasse 3a, 18051, Rostock, Germany A significant part of global primary productivity is provided by cyanobacteria, which are abundant in most marine- and fresh-water habitats. In many oceanographic regions, however, the concentration of iron may be so low that it will limit growth (1). Cyanobacteria respond to this condition by expressing a number of iron-stress-inducible genes, of which the isiA gene encodes a chlorophyll-binding protein known as IsiA or CP43 (2). It was recently shown that 18 IsiA proteins encircle trimeric photosystem I (PSI) under iron-deficient growth conditions (3, 4). We report here that after prolonged growth of Synechocystis sp. PCC 6803 in an iron-deficient medium, the number of bound IsiA proteins can be much higher than known thus far. The largest complexes bind 12-14 units in an inner ring and 19-21 units in an outer ring around a PSI monomer. Fluorescence excitation spectra indicate an efficient light-harvesting function for all PSI-bound chlorophylls. We also find that cyanobacteria accumulate IsiA in excess of what is needed for functional light harvesting by PSI, and that a significant part of IsiA builds supercomplexes without PSI. Because the further decline of PSI makes photosystem II (PSII) increasingly vulnerable to photooxidation, we postulate that the surplus synthesis of IsiA shields PSII from excess light. We conclude that IsiA plays a surprisingly versatile role in cyanobacteria, by significantly increasing the light harvesting ability of PSI and providing light shielding for PSII. 1. Martin, J. H., Coale, K. H., Johnson, K. S., Fitzwater, S. E., Gordon, R. M., Tanner, S. J., Hunter, C. N., Elrod, V. A., Nowicki, J. L., Coley, T. L. et al. (1994) Nature 371, 123-129. 2. Burnap, R. L., Troyan, T., & Sherman, L. A. (1993) Plant Physiol. 103, 893-902.
3. Bibby, T. S., Nield, J., & Barber, J. (2001) Nature 412, 743-745. 4. Boekema, E. J., Hifney, A., Yakushevska, A. E., Piotrowski, M., Keegstra, W., Berry, S., Michel, K. P., Pistorius, E. K., & Kruip, J. (2001) Nature 412, 745-748. *Corresponding author: Nataliya Yeremenko Session V Oral Presentation Abstracts 51 Identification of a new family of phycobiliprotein lyases in cyanobacteria: characterization of a -phycocyanin lyase. 1 G. SHEN, 2N. A. SAUNE, 2E. GALLO, 2Z. BEGOVIC, 2W. M. SCHLUCHTER*, AND 1D. A. BRYANT. 1 Department of Biochemistry and Molecular Biology, The Pennsylvania State University, University Park, PA 16802 USA. 2Department of Biological Sciences, University of New Orleans, New Orleans, LA 70148-2960, USA. *wschluch@uno.edu We have identified a new family of proteins that are involved in phycobiliprotein biosynthesis in Synechococcus sp. PCC 7002. This gene family, which was first identified in Fremyella diplosiphon as cpeS and cpeT (1), is not related to the cpcE and cpcF genes that encode the -phycocyanin lyase. There are three cpeS-like genes and one cpeT-like gene within the genome of Synechococcus sp. PCC 7002, an organism that does not synthesize phycoerythrin. We created a cpeS1 knockout mutant that accumulates very low amounts of phycocyanin (PC). The majority of the PC produced in this mutant is not incorporated within phycobilisomes and can be recovered at the top of sucrose density gradients. This fraction of PC has a blue-shifted absorbance maximum (600 nm) compared to WT PC (623 nm). When either the phycobilisomes (PBS) or proteins isolated from the top of the sucrose gradient are separated by SDS-PAGE followed by immunoblot analysis using anti- -PC antibodies, we find that the mutant contains two species of -PC. One has the same electrophoretic mobility as WT phycocyanin, and the other has slightly higher mobility on SDS-PAGE. Mass spectrometric analysis of purified PBS from the mutant also showed that there were two types of -PC present and that one had the mass expected for the WT -PC subunit. The other species present within mutant PBS was 586.8 Da smaller than WT -phycocyanin. Free phycocyanobilin with a mass of 587.5 Da was also observed, indicating that this second species of PC has a non-covalently bound phycocyanobilin in one of the two bilin-binding pockets. SDS-PAGE of formic acid cleavage products from the mutant phycocyanin, with detection of bilin fluorescence after Znstaining, showed that the aberrant -PC in the mutant lacks the phycocyanobilin at the -82 site but that the -153 site is apparently unaffected. Therefore, we conclude that CpeS1 is a component of a lyase that attaches phycocyanobilin to the -82 site on phycocyanin. We also demonstrate that recombinant CpeS1 copurifies with His-tagged apo- -PC (HT-CpcB) but is unable to attach phycocyanobilin to the HT-CpcB in vitro. Therefore, it is likely that one or more additional subunits are required for the activity of this putative lyase. We are currently testing whether one of the other two CpeS proteins, the CpeT protein, or some combination of these proteins is required to form an active -PC lyase. In addition we have generated knockout mutants for the other cpeS and cpeT genes. The results from these studies will be presented. 1. Cobley, J. G., A. C. Clark, S. Weerasurya, F. A. Queseda, J. Y. Xiao, N. Bandrapali, I. D'Silva, M. Thounaojam, J. F. Oda, T. Sumiyoshi, and M. H. Chu. 2002. CpeR is an activator required for expression of the phycoerythrin operon (cpeBA) in the cyanobacterium Fremyella diplosiphon and is encoded in the phycoerythrin linker- polypeptide operon (cpeCDESTR). Molecular Microbiology 44:1517-
1531. Session V Oral Presentation Abstracts 52 Synechococcus sp. PCC 7002 PetB arginine 214: a key residue for quinonereductase (Qi) function and possible oxygen radical production in the cytochrome bf complex 1 DARRYL HORN, 1MATTHEW NELSON, 2GIOVANNI FINAZZI, 3 QINGJUN WANG, 4JOHN WHITMARSH AND 1TOIVO KALLAS. 1 Department of Biology & Microbiology, University of Wisconsin-Oshkosh, Oshkosh, WI 54901, 2 CNRS UPR 1261, Institut de Biologie Physico-Chimique, 75005 Paris, FRANCE, and 3 Center of Biophysics and Computational Biology, University of Illinois, Urbana, IL 61801, and 4 NIH NIGMS, Bethesda MD USA 20892. The cytochrome bf complex catalyzes the rate-limiting plastoquinol-oxidation step of photosynthesis. Quinol oxidation involves bifurcated transfer of one electron to a high potential chain (> Riekse protein > cytochrome f) and another to a transmembrane, low potential chain (> heme bL > heme bH > quinone-reductase (Qi) site). Qi domains of cytochrome bf and mitochondrial-type bc complexes differ markedly in structure and inhibitor specificity. To investigate the bf Qi domain, we constructed mutation R214H in the Synechococcus 7002 petB (cytochrome b6) gene, which makes the cytochrome bf complex more like the bc complex. The converse H217R mutation in the bc complex alters the redox properties and function of the Qi site (1). At high light intensity, the mutant grew ~2.5 fold slower than the wild type. Slower growth arose from slower turnover of the bf complex. Specifically, the R214H mutation partially blocked electron transfer to the Qi site (mimicking the effect of the Qi-site inhibitor NQNO, 2-nnonyl-4-hydroquinoline N-oxide) as shown by an increased amplitude of b-heme reduction and a lower rate of b-heme oxidation following single flash turnovers. The wild type showed a significant isotope effect on b-heme reduction/oxidation kinetics but D2O had little effect in the mutant. This indicates that proton transfer events limited b-heme oxidation in the wild type, whereas electron flow became limiting in the mutant. Redox titrations of membranes revealed midpoint potentials (Em 7) of ~30 mV and 120 mV for the two b hemes in the mutant similar to those in the wild type (2). Events that impede electron flow to the Qi site may prolong the reactive semiquinone at the quinol-oxidation (Qo) site leading to production of reactive oxygen species (ROS). Preliminary data support this. The R214H mutant showed increased ROS production relative to the wild type as measured by formation of formazan from XTT (2,3bis[Methoxy-4-nitro-5sulfo-phenyl]-2H-tetrazolium-5-carboxanilide) which reacts specifically with superoxide. Our analysis defines cytochrome b6 arginine 214 as a key residue for quinonereducatse (Qi) site function and turnover of the cytochrome bf complex. In the recent cytochrome bf structures (3, 4), R207 (Synechococcus R214) lies near the Qi pocket and the newly discovered c (or x) heme. Our data suggest that arginine 214 may bind plastoquinone at the Qi site and may have roles in modulating the redox potential of heme c' (x) and in proton translocation. These findings will be discussed in light of the bf structures. (Supported by NSF MCB 0091415) 1. Gray, K. A., Dutton, P. L. and F. Daldal. 1994. Biochemistry 33, 723-733. 2. Baymann, F., Rappaport, F., Joliot, P. and T. Kallas. 2001. Biochemistry 40, 10570-10577.
3. Kurisu, G., Zhang, H., Smith, J. L. and W. A. Cramer. 2003. Science 302, 1009-1014. 4. Stroebel, D., Choquet, Y., Popot, J.-L. and D. Picot. 3002. Nature 426, 413-418. Session V Oral Presentation Abstracts 53 Structure and Functional Studies of Protein Complexes in Photoprotection and Carbon Fixation: The Orange Carotenoid Protein and the Carboxysome CHERYL A. KERFELD1, MICHAEL SAWAYA1, DAVID KROGMANN2 & TODD O. YEATES1 1 Molecular Biology Institute, UCLA, Los Angeles, CA and 2 Department of Biochemistry, Purdue University, West Lafayette, IN Our structural studies focus on the structural basis of photosynthetic function. The structure of the uniquely water-soluble orange carotenoid-binding protein (OCP) isolated from the cyanobacterium Arthrospira maxima has been determined at a resolution of 2.1. The OCP is presumably involved in photoprotection. The structure reveals the protein-pigment interactions that influence the spectral properties of the carotenoid. A proteolytic product of OCP has been isolated that appears red instead of orange. The OCP can also be converted into a red protein by exposure to low pH. Circular dichroism data suggest that low pH changes the structure of the protein. Results of experiments directed toward understanding the functional role of the OCP will be presented. We have also initiated structural studies of components of the carboxysome, a cage-like protein complex involved in optimizing carbon fixation. Progress in these structural studies will be described. Session V Oral Presentation Abstracts 54 Functional genomics of genes for biogenesis of Fe/S proteins in cyanobacteria Gaozhong Shen1, Ramakrishnan Balasubramanian1, Tao Wang1, Bhramara Tirupati1, J. Martin Bollinger1,2, John H. Golbeck1,2 and Donald A. Bryant1 1 Department of Biochemistry and Molecular Biology, The Pennsylvania State University, University Park, PA 16802, USA, 2Department of Chemistry, The Pennsylvania State University, University Park, PA 16802, USA Genomic sequencing of Synechococcus sp. PCC 7002 and other cyanobacteria has provided useful tools in identifying genes with possible functions in Fe/S cluster assembly. Indeed, genes for two different systems of Fe/S cluster biogenesis (named SUF and ISC) have been identified in the genomes of several sequenced cyanobacteria. SufS and SufE are thought to be responsible for sulfur mobilization. SufC functions as a versatile orphan ATPase and may work together with the SufB and SufD proteins in iron assimilation and Fe/S cluster insertion. In cyanobacteria, SufR functions in the regulation of expression of suf genes. We studied the functions of selected genes in the SUF and ISC systems in cyanobacteria by reverse genetics. Such as for iscS gene, no phenotype can be observed in the iscS1 mutant of Synechococcus sp. PCC 7002 and iscS mutants or fdx mutant Synechocystis sp. 6803. Even the double mutant of iscS1 and iscS2 genes can grow photoautotrophically. In contrast, we have not been able to fully segregate interruption mutants of the sufD and sufS genes in Synechococcus sp. PCC 7002 or the sufS gene in Synechocystis sp. PCC 6803. This demonstrates that these suf genes, unlike the isc genes, are essential in cyanobactera. Surprisingly, no phenotype could be observed in the sufA and iscA single or double interruption mutants of Synechococcus sp. PCC 7002. This result casts doubt on the function of the IscA and SufA proteins to function as essential scaffolds in Fe/S cluster biogenesis in photosynthetic organisms, as is the case in Azotobacter vinelandii. Components of
the SUF system found in cyanobacteria can be localized in the chloroplasts of higher plants. These results show that oxygenic photosynthetic organisms rely primarily on the SUF rather than the ISC system for biogenesis of Fe/S clusters for Photosystem I and/or other Fe/S proteins. Session V Oral Presentation Abstracts 55 Preliminary structural characterization of the 33-kDa protein (PsbO) in solution studied by site-directed mutagenesis and NMR spectroscopy MARC NOWACZYKa,CARSTEN BERGHAUSb, RAPHAEL STOLLb AND MATTHIAS RGNER*a a Plant Biochemistry, Faculty of Biology, and b Biomolecular NMR, Faculty of Chemistry, Ruhr-University Bochum, D-44780 Bochum, Germany Photosystem 2 (PS2) is located in the thylakoid membrane of chloroplasts and cyanobacteria and performs one of the key reactions on our planet - the light-driven oxidation of water to molecular oxygen. This process occurs in four one-electron oxidation steps (S-states) by the manganese containing water-oxidising complex (WOC). Recent advances in X-ray structure analysis of PS2 crystals (1,2) provide a detailed view of the structure and organisation of the WOC. At the lumen side of PS2, the WOC is shielded by several extrinsic proteins. One of them, the 33-kDa protein (PsbO), is of special interest, because it is ubiquitous in all photosynthetic organisms performing water-splitting and its removal results in a strong decrease of the oxygen evolving activity. Therefore, it is often referred to as manganese stabilizing protein (MSP). Site-directed mutagenesis experiments combined with 1D and 2D NMR spectra provide a preliminary insight into the structure and dynamics of the 33-kDa protein (PsbO) from T. elongatus free in solution. The NMR spectra suggest that PsbO rather than forming a molten globule state or being natively unfolded, contains both a well folded core and highly flexible regions. The PsbO protein shows a remarkable temperature-, pH-, and long-term-stability being stable for at least four weeks under the conditions tested in this study. Due to this extraordinary stability of PsbO, we characterized four cysteine mutants serving as local probes for structural and dynamic properties of PsbO. The results indicate sites of increased accessibility/flexibility which may be important for the docking to the PS2 core complex. 1. N. Kamiya and J.R. Shen, Proc Natl Acad Sci U S A, 2003, 100, 98. 2. K.N. Ferreira, T.M. Iverson, K. Maghlaoui, J. Barber, and S. Iwata, Science, 2004, 303, 1831. Session V Oral Presentation Abstracts 56 Identification of a low molecular weight protein tyrosine phosphatase and its potential substrates in Synechocystis sp. PCC 6803 ARCHANA MUKHOPADHYAY1 and PETER J. KENNELLY1* Department of Biochemistry, Virginia Polytechnic Institute and State University, 105 Engel Hall, Blacksburg, Virginia 240611 Abstract The predicted protein product of open reading frame slr0328 from Synechocystis sp. PCC 6803, SynPTP, possesses significant amino acid sequence identity with known low molecular weight protein tyrosine phosphatases (PTPs). To determine gross functional properties of this hypothetical protein, gene slr0328 was cloned, and its predicted protein product was expressed in E. coli. The recombinant protein, SynPTP, was purified by metal ion column chromatography. The catalytic activity of SynPTP was tested toward several exogenous protein substrates that had been phosphorylated on either tyrosine residues or serine residues. SynPTP exhibited
phosphatase activity toward tyrosine phosphorylated protein substrates (Vmax toward phosphotyrosyl 32P-casein was 1.5 nmole/min/mg). However, no phosphatase activity of SynPTP was detected toward serine phosphorylated protein substrates. SynPTP displayed phosphohydrolase activity toward several organophosphoesters including para-nitrophenyl phosphate (p-NPP), beta-napthyl phosphate and phosphotyrosine but not toward alpha-napthyl phosphate, phosphoserine, or phosphothreonine. Kinetic analysis indicated that Km (0.6 mM) and Vmax (3.2 mole/min/mg) values for SynPTP toward pNPP are similar to those of other known bacterial low molecular weight PTPs. The protein phosphatase activity of SynPTP was inhibited by sodium orthovanadate, a potent inhibitor for tyrosine phosphatases, but not by okadaic acid, an inhibitor for many serine/threonine phosphatases. Mutagenic alteration of the predicted catalytic cysteine, Cys7, of SynPTP to serine abolished enzyme activity. Several phosphotyrosine containing proteins were detected from the cell extracts of Synechocystis sp. PCC 6803 through immunoreactions using anti-pTyr antibody. SynPTP was observed to dephosphorylate three of these proteins in vitro. Further studies will be performed to identify these potential substrates of SynPTP by peptide-mass fingerprinting analysis. *Corresponding author. E-mail: pjkennel@vt.edu Phone: (540) 231-4317 Session VI Oral Presentation Abstracts 57 Session VI: Carbon metabolism Session Chair: Dean Price, Australian National University Keynote Speaker: Murray Badger, Australian National University; Cyanobacterial photosynthetic CO2 concentrating mechanisms: Session VI Oral Presentation Abstracts 58 Signal transduction molecules directly regulated by bicarbonate and sodium ions. ARNE HAMMER, MARTIN CANN*. Department of Biological and Biomedical Sciences, University of Durham, South Road, Durham, DH1 3LE, United Kingdom. The ability to respond and adapt to abiotic stress is fundamental to the biology of all organisms. Two key abiotic stressors that impact upon cyanobacteria are inorganic carbon availability and environmental sodium concentration. Despite the importance of mechanisms that enable an organism to act in response to salt and carbon stress, no directly sodium or carbon responsive signalling molecules have been described. The identification of such molecules is of paramount importance in delineating the mechanisms by which cyanobacteria respond to abiotic stress. Here we describe signal transduction molecules directly regulated by bicarbonate and sodium. 1) We present data for a novel class of bicarbonate stimulated adenylyl cyclase present in many eukaryotic and prokaryotic species (including the cyanobacteria) and propose that the cAMP signal transduction pathway mediates aspects of inorganic carbon detection among diverse organisms. 2) We present recent work detailing the identification of an evolutionarily widespread sodium responsive signalling domain and detail the role of this domain in the control of the salt stress response of cyanobacteria. * corresponding author Session VI Oral Presentation Abstracts
59 Response to low carbon dioxide in the glaucocystophyte alga, Cyanophora paradoxa A S. C. BUREY, BV. POROYKO, BN. OZTURK, AS. FATHI-NEJAD, AG. HAMMERSCHMIED, A C. SCHUELLER, AJ. M. STEINER, BH. J. BOHNERT AND A*W. LOEFFELHARDT 1A Max F. Perutz Laboratories University Departments at the Vienna Biocenter Department of Biochemistry and Molecular Cell Biology and Ludwig Boltzmann Research Unit of Biochemistry, 1030 Vienna, Austria and 1B Departments of Plant Biology and Crop Sciences University of Illinois, Urbana, IL 61801, USA Cyanophora paradoxa is the best investigated member of the glaucocystophyte algae, the most primitive phototrophic eukaryotes whose plastids (cyanelles) are surrounded by a peptidoglycan layer, a clear indication of their descent from endosymbiotic cyanobacteria. As many aquatic microorganisms which as a group contribute about 50% to global CO2 fixation, C. paradoxa possesses an inorganic carbon concentration mechanism (CCM). Increase of the CO2 level in CCM microcompartments harboring Rubisco increases the efficiency of photosynthetic carbon fixation. Operation of the CCM is triggered by growth at ambient (0.04%) CO2 concentrations with concomitant induction of CO2 and bicarbonate transporters and components of these microcompartments. These electron-dense structures are carboxysomes in prokaryotes and pyrenoids in eukaryotic algae. We postulate that the cyanelles of C. paradoxa did retain another prokaryotic feature in addition to the peptidoglycan wall: the unique case of an eukaryotic carboxysome. An isolation procedure for carboxysomes was developed enabling a proteomics approach and the identification of carboxysome proteins other than Rubisco. Rubisco activase was imported into isolated cyanelles and was shown to integrate into carboxysomes. Two cDNA libraries of cells grown under ambient and high CO2 grown cells were constructed. Around 450 genes were differentially expressed under high and ambient CO2. The potential involvement of the corresponding gene products in the CCM of C. paradoxa will be discussed. *for correspondence: e-mail wolfgang.loeffelhardt@univie.ac.at Session VI Oral Presentation Abstracts 60 Identification and analysis of akinete specific genes in Nostoc punctiforme M.L. Summers, C. Argueta, and K. Yuksek California State University Northridge, Northridge, CA 91330-8303 The filamentous cyanobacteria Nostoc punctiforme is capable of dark heterotrophy and cellular differentiation into nitrogen-fixing heterocysts, motile hormogonia, or spore-like akinetes. The study of akinete differentiation at the molecular level has been limited by the asynchronous development and limited number of akinetes formed within a filament. A system in which to study the development and gene regulation of akinetes was investigated using a zwf mutant lacking the initial enzyme of the oxidative pentose phosphate pathway. Following dark incubation in the presence of fructose, the zwf- strain ceased growth and differentiated into akinete-like cells where as the wild-type strain was capable of heterotrophic growth. Darkinduced zwf akinetes had increased resistant to the environmental stresses of desiccation, cold, or
treatment with lysozyme relative to vegetative cells of both strains. Dark-induced zwf akinetes also exhibited PAS staining characteristics identical to that observed for wild-type akinetes, and indicated that synchronous induction akinetes occurred in treated cultures. Transcription of the avaK akinete marker gene was found to be fructose-induced in both wild-type and zwf strains, but was increased strongly in zwf dark-induced akinetes two days after induction. This model system was used in conjunction with the differential display technique to identify akinetespecific genes. Following screening of identified candidate genes by reverse transcriptase realtime Q-PCR, the promoter regions for several putative akinete-expressed genes were cloned into GFP reporter vectors developed for this purpose. Four genes were confirmed to exhibit akinetespecific GFP expression, and one of these was strongly expressed in developing hormogonia. Phenotypic analysis of insertional mutants will be presented. The phenotypic and genetic evidence showing synchronous induction of dark-induced zwf akinetes coupled with the identification of akinete-specific genes indicates this system will provide a valuable tool for the continued study of akinete development in N. punctiforme. Session VI Oral Presentation Abstracts 61 Regulation of the cyanobacterial CO2 concentrating mechanism 1 WOODGER, F.J., 1BADGER, M.R. AND 1*PRICE, G.D. 1. Molecular Plant Physiology, Research School of Biological Sciences, Australian National University, ACT, 0200. Approximately 50% of global CO 2-based productivity is now attributed to the activity of phytoplankton including ocean-dwelling cyanobacteria. In response to inherent restrictions on the rate of CO2 supply in the aquatic environment, cyanobacteria have evolved a very efficient means of capturing inorganic carbon (Ci), as either CO2 or HCO3-, for photosynthetic carbon fixation. This capturing mechanism, known as a CO2 concentrating mechanism (CCM), involves the operation of active CO2 and HCO3- transporters and results in the concentration of CO2 around Rubisco in a unique microcompartment called the carboxysome. The CCM exhibits two basic physiological states a constitutive, low affinity state and a high affinity state that is induced in response to Ci limitation. Many of the genetic components of the CCM, including genes encoding Ci transporters, have been identified. It is apparent that the expression of genes encoding the inducible, high-affinity Ci transporters is particularly sensitive to Ci availability and we are now interested in defining how cyanobacterial cells sense and respond to Ci limitation at the transcriptional level. Current theories include direct sensing of external Ci, sensing of internal Ci-pool fluctuations or detection of changes in photorespiratory intermediates, carbon metabolites or redox potential. Presently there is no consensus view. We have investigated the physiological and transcriptional response of CCM mutants and wildtype strains to pharmacological treatments and various light, O2 and Ci regimes. Our data suggests that perception of Ci limitation by a cyanobacterial cell is either directly or indirectly related to the size of the internal Ci pool within the cell. *corresponding author Session VI Oral Presentation Abstracts 62 Regulation of sucrose metabolism in salt-treated cells of Nostoc sp. PCC 7120: towards the understanding of the role of sucrose in cyanobacteria 1A.C. CUMINO, 1L. CURATTI, 1W.A. VARGAS, 1L. GIARROCCO, 1C. MARCOZZI, 1* G.L. SALERNO. 1Centro de Investigaciones Biolgicas, FIBA, CONICET, Vieytes 3103, 7600 Mar
del Plata, Argentina One of the physiological responses for salt adaptation of cyanobacteria consists in the accumulation of organic osmoprotectants, low-molecular mass solutes that do not interfere with cell metabolism. As no link has been found between the kind of osmotic protectant accumulated and taxonomic grouping or the habitats of origin, the strains have been grouped according to their tolerance to salt concentration. Most Nostoc spp. and Anabaena spp. strains are filamentous heterocystic cyanobacteria usually growing in fresh water habitats. This group of cyanobacteria is classified as low salt tolerant strains that accumulate sucrose (Suc) as a response to NaCl. Recently, it was elucidated that sucrose synthesis in these strains occurs through the sequential action of sucrose-phosphate synthase (SPS-A and SPS-B) and sucrose- phosphate phosphatase (SPP) activities, and its degradation can be catalyzed by either sucrose synthase (SuS-A) or alkaline-neutral invertases (Inv-A and Inv-B) [1]. When we investigated the effect of NaCl on the regulation of sucrose metabolizing enzymes in several Anabaena spp. or Nostoc spp. strains, we found that not only SPS but also SuS and Inv activities increased after salt addition. Additionally, an increase in polypeptide levels of SPS, SuS and Inv was shown by immnoanalysis after separating the polypeptides by SDS-PAGE. In Nostoc sp. PCC 7120, RTPCR and reporter-gene expression analyses showed a differential transcriptional regulation between the two sps genes, and between the two inv genes. Putative promoters, specifically activated by NaCl, were identified for some of these genes after primer extension analysis. These results indicate that in Nostoc spp. and Anabaena spp. strains, not only sucrose levels but sucrose turn-over, as well are stimulated by NaCl, suggesting that in these cyanobacteria sucrose metabolism may display a more complex function than the synthesis of an osmolite. A complex set of enzymes related to sucrose metabolism may be necessary to sensibly tune cellular sucrose levels according to additional roles of sucrose metabolism that may be coordinated. Supported by CONICET, ANPCyT, FIBA and UNMdP. (1) Salerno G., Curatti L. (2003) Origin of sucrose metabolism in higher plants: when, how and why? Trends Plant Sci. 8, 6369. Session VI Oral Presentation Abstracts 63 Keynote Talk Cyanobacterial photosynthetic CO2 concentrating mechanisms: solutions employing many Ci transporters, two carboxysomes types and diverse carbonic anhydrases MURRAY BADGER Molecular Plant Physiology Group, Research School of Biological Sciences, Australian National University, PO Box 475, Canberra City, ACT, Australia Photosynthetic CO2 concentrating mechanisms in cyanobacteria are essential for efficient photosynthesis in the diverse array of aquatic environments in which cyanobacteria are found. With the emergence of a diverse array of cyanobacterial genomes a wide array of genetic diversity has been uncovered in the manner in which different cyanobacteria are able to achieve a functional outcome. This diversity includes at least four bicarbonate transporters and two CO2 uptake mechanisms, two distinct types of carboxysomes and significant creativity in which carbonic anhydrases are employed. This talk will summarize our current understanding and research in this area. Session I Poster Presentation Abstracts 64 Poster Presentations Session I Physiology, Metabolism and Global Responses (I)
Session Chair: Gnter Peschek, University of Vienna Session I Poster Presentation Abstracts 65 Isolation and characterization of Nostoc punctiforme ATCC 29133 mutants unable to differentiate into hormogonia. AKIKO TOMITANI1,2,3*, PAULA S. DUGGAN2 and DAVID G. ADAMS2 1 The Kyoto University Museum, Kyoto University, Yoshida-hon-machi, Sakyo-ku, Kyoto 6068501, Japan 2 School of Biochemistry and Microbiology, University of Leeds, Leeds LS2 9JT. U.K. 3 Institute for Frontier Research on Earth Evolution, Japan Agency for Marine-Earth Science and Technology, 2-15 Natsushima-cho, Yokosuka 237-0061, Japan Cyanobacteria form a morphologically diversified group. Particularly in filamentous cyanobacteria of subgroups Nostocales and Stigonematales, vegetative cells can mature in four developmental directions (vegetative cells, heterocysts, akinetes, and hormogonia), in response to environmental conditions. Hormogonia are transiently differentiated, small-celled filaments lacking heterocysts and are often capable of gliding and/or buoyant motility1. The function of hormogonia is to provide immotile strains with a means of dispersal in response to environmental triggers2. They also play an important role as infective units in the establishment of symbiotic association with various plant hosts. In hormogonia formation, cell division occurs rapidly and synchronously in all cells without cell growth and DNA replication3. To identify the genes involved in hormogonia differentiation, transposon mutants of Nostoc sp. ATCC 291334 were prepared and screened. About a thousand mutant clones were induced to form hormogonia by plant exudates, and then transferred to the dark in the presence of penicillin. Mutants unable to differentiate into hormogonia do not divide in the dark and are expected to survive the penicillin treatment. Following several rounds of penicillin selection in the dark, the transposon and flanking DNAs were recovered from surviving mutants, cloned and sequenced. The predicted proteins encoded by the identified genes include a membrane protein, and proteins involved in sugar transport and signaling pathways (Histidine kinase, Serine/Threonine kinase). The transposon mutants of those genes neither produce hormogonia, nor establish a symbiotic association when co-cultured with the host plant Blasia pusilla. Most mutants show similar growth rate to wild type, while a mutant of a two component regulatory pathway does not grow at all in medium without combined nitrogen. Isolation of multiple genes involved in hormogonia formation and their detailed characterization will provide us with a novel insight into the mechanisms that control bacterial cell division. 1 Rippka, R., Deruelles, J., Waterbury, J. B., Herdman, M. & Stanier, R. Y. (1979) J. Gen. Microbiol. 111:1-61. 2 Adams, D. G. (2000). In Prokaryotic Development, (eds. Y. V. Brun and L. J. Shimkets. ASM Press, Washington,) pp 51-81. 3 Tandeau de Marsac. N., Mazel, D., Bryant, D. A. & Houmard, J. (1988) Photosynth. Res. 18:99-132. 4 Cohen, M. F., Wallis, J. G., Campbell, E. L. and Meeks, J. C. (1994) Microbiol. 140:3233-3240. Session I Poster Presentation Abstracts 66 Identification of a cis-acting antisense RNA potentially regulating furA expression in Anabaena sp. PCC 7120. 1 J.A. HERNNDEZ, 2A.M. MURO-PASTOR, 2E. FLORES, 1M.T. BES, M.L. 1PELEATO AND 1 M.F. FILLAT. (1) Departamento de Bioqumica y Biologa Molecular y Celular, Facultad de Ciencias, Universidad
de Zaragoza, Pedro Cerbuna, 12. 50009-Zaragoza, Spain. (2) Instituto de Bioqumica Vegetal y Fotosntesis, Consejo Superior de Investigaciones CientficasUniversidad de Sevilla, Sevilla, Spain. Ferric uptake regulation (Fur) proteins are prokaryotic transcriptional regulators that integrate iron metabolism with several environmental stress responses. In the cyanobacterium Anabaena sp. PCC 7120 three open reading frames (all1691, all2473 and alr0957) containing the histidine-rich region characteristic of the Fur (ferric uptake regulation) protein family have been identified (1). FurA is the product of open reading frame all1691 that is located between sigC and alr1690, the latter encoding a putative cell wall-binding protein. Anabaena FurA is a constitutive, moderately autoregulated protein that controls the transcription of flavodoxin, the product of the isiB gene (2). Northern blot analysis of furA showed an unexpected transcription pattern that consists of two hybridization bands of approximately 1.8 and 0.7 kb. Iron depletion caused a similar effect on the abundance of both RNAs, whose amount increased, after 48 h, about 1.9- and 1.7-fold, respectively. Hybridization of Anabaena RNA samples with dsDNA probes corresponding to the furA homologues all2473 and alr0957, as well as with the furA flanking genes, all1691 (sigC) and alr1690, showed that the short transcript corresponded to the furA mRNA, whereas the longer transcript contained the alr1690 mRNA and a large region that overlaps the furA gene. RT-PCR assays using RNA from Anabaena sp. PCC 7120 and insertional mutant strains containing the C.S3 cassette in different points of the furA genomic region indicated that the 1.8-kb transcript is complementary to the furA mRNA. Derepression of FurA in an alr1690 null mutant suggests that this transcript acts as a cis-acting antisense RNA ( -furA RNA) interfering with furA transcript translation thus contributing to determine cellular levels of the FurA protein. These results state the importance of post-transcriptional control in Fur proteins and describe a new mechanism of modulation of these regulators. (1) http://www.kazusa.or.jp/cyano/link.html (2) Hernndez, J. A., Bes, M. T., Fillat, M. F., Neira, J. L. and Peleato, M. L. (2002) Biochem J 366, 315-22. Session I Poster Presentation Abstracts 67 Differential circadian regulation of psbA gene expression in Synechococcus elongatus PCC 7942 SHANNON R. CANALES and SUSAN S. GOLDEN* Department of Biology, Texas A&M University, College Station, TX 77843 The psbA gene family in Synechococcus elongatus PCC 7942 encodes two forms of the D1 protein, which is an essential component of the photosystem II reaction center. Form I is encoded by the psbAI gene and Form II is encoded by both the psbAII and psbAIII genes. To examine the circadian transcriptional patterns of these photosynthesis genes, the upstream promoter regions (PpsbA) were fused to luxAB and the levels of bioluminescence were measured over time. In constant light conditions (LL), expression of bioluminescence from PpsbAII peaks 12 h out of phase from both PpsbAI and PpsbAIII. Interestingly, when cultures are maintained in a cycle of 12 h light/12 h dark (LD), conditions that mimic daily external cues, peak transcription from PpsbAII occurs 4 h before the other two genes experience their highest level of expression; the latter occurs at the light to dark transition. To further examine the circadian regulation of these promoters, expression patterns are being tested in the absence of the other two psbA genes. The functional components of the promoters, previously defined in the context of light-responsive regulation, are being tested to identify the region through which the circadian clock affects transcriptonal patterning. Of particular interest are the enhancers of the upstream untranslated regions of psbAII and psbAIII, which have been shown by others to bind the LysR-type regulatorCmpR, and the negative regulator in the upstream untranslated region of psbAI. *
Corresponding author Session I Poster Presentation Abstracts 68 Novel expression regulation and biochemical activities of a redox-regulated RNA helicase L.M. PATTERSON-FORTIN, D. CHAMOT, and G.W. OWTTRIM* Department of Biological Sciences, University of Alberta, Edmonton, Alberta, Canada, T6G 2E9 Photosynthetic organisms must sense and respond to changes in their light environment. Our lab has previously shown that light regulated expression of the cyanobacterial DEAD-box RNA helicase, CrhR, is mediated through light-driven electron flow. Specifically the reduced redox poise of plastoquinone induces crhR expression in Synechocystis sp. strain PCC 6803. The mechanism by which crhR transcription is differentially regulated in response to redox potential is not known. DNA affinity chromatography and mass spectrometry identified the protein responsible for regulating crhR expression as a LexA-related regulator. Northern analysis of lexA and crhR transcript levels indicates LexA functions as a repressor of crhR expression in the dark. Association of LexA with the E. coli SOS response warranted analysis of recA, lexA, and crhR expression under UV-induced DNA damaging conditions. While Synechocystis recA is DNA damage inducible, lexA and crhR expression is not affected. Furthermore, although Synechocystis LexA lacks two of the three conserved residues required for the E. coli LexA selfcleavage reaction it is cleaved in E. coli in the absence of DNA damage. The results suggest LexA represses expression of redox-responsive genes in Synechocystis rather than those required for DNA repair with the potential for derepression by LexA cleavage. Biochemical analysis of recombinant CrhR in vitro indicates that it is a bona fide RNA helicase possessing RNAdependent ATPase and ATP-dependant RNA unwinding activities. CrhR also performs ATPdependant RNA annealing, an activity which is unique among RNA helicases. The biochemical properties provide the potential for CrhR to effect RNA secondary structure rearrangements via a coupling of RNA unwinding and annealing. The data are discussed in a functional context with respect to a role for CrhR in cyanobacterial gene expression in response to alterations in redox potential. Session I Poster Presentation Abstracts 69 RNA Structural Rearrangements by the Synechocystis RNA Helicase, CrhR G.W. OWTTRIM AND D. CHAMOT Department of Biological Sciences, University of Alberta, Edmonton, Alberta, Canada, T6G 2E9 Rearrangement of RNA secondary structure is crucial for numerous biological processes. RNA helicases participate in these rearrangements through the unwinding of duplex RNA. We report here that the redox-regulated cyanobacterial RNA helicase, CrhR, is a bona fide RNA helicase possessing bidirectional ATP-dependent RNA helicase activity. We have also found that CrhR catalyzes the ATP-dependent annealing of complementary RNAs into both intra- and inter-molecular duplexes. Uniquely, and in contrast to other proteins that perform RNA annealing, the CrhR catalyzed reaction requires ATP hydrolysis. Through a combination of the unwinding and annealing activities, CrhR also catalyzes RNA strand exchange reactions resulting in the formation of RNA secondary structures which are too stable to be resolved by the helicase activity. RNA strand exchange most likely occurs through the CrhR-dependent formation and resolution of an RNA branch migration structure. Demonstration that a second cyanobacterial RNA helicase, CrhC, does not catalyze annealing supports the suggestion that this activity is not a biochemical characteristic universally possessed by RNA helicases. Biochemically, CrhR is therefore similar to RecA and related proteins that catalyze strand
exchange and branch migration on DNA substrates, a characteristic which is reflected in the recently reported structural similarities between these proteins. The data indicates the potential for dynamic RNA secondary structure rearrangements via CrhR through a combination of RNA helicase and annealing activities. Session I Poster Presentation Abstracts 70 Transcriptional regulation of the bidirectional NiFe-hydrogenase in Synechocystis sp. PCC 6803 KIRSTIN GUTEKUNST*, SARANYA PHUNPRUCH, RDIGER SCHULZ-FRIEDRICH, and, JENS APPEL Botanical Institute, Christian-Albrechts-University, Am Botanischen Garten 1-9, D-24118 Kiel, Germany e-mail:kirstingutekunst@yahoo.com The bidirectional NiFe-hydrogenase of Synechocystis sp. PCC 6803 is encoded by five genes (hoxEFUYH) that are organized in one gene cluster. It was shown through RT-PCR that all hox genes are transcribed as one unit. A mutant with a deletion in the supposed promotor region upstream of hoxE exhibits as expected a decreased hydrogenase activity. Several DNA fragments from this region were ligated into a promotor probe vector carrying the reporter genes luxAB. The corresponding mutants were measured to further characterize the promoter. The luciferase measurements as well as a band-shift-assay revealed a region binding a protein which is thought to be an transcription factor. Further characterizations of the protein and the binding site are in progress. Session I Poster Presentation Abstracts 71 Novel Interaction between Two CheA-like Molecules Involved in Gliding Motility of Cyanobacterium Synechocystis sp. PCC 6803 SOO YOUN KIM, YOUNG HYE KIM, JONG-SOON CHOI, YOUNG-HO CHUNG AND YOUNG MOK PARK Proteome Analysis Team, Korea Basic Science Institute, Daejeon 305-333, Korea The unicellular cyanobacterium Synechocystis sp. PCC 6803 displays gliding motility that depends on the type IV-like thick pili. All disruptants of chemotaxis-like gene locus (slr1041slr1044, called Tax3 by Bhaya et al) did not show gliding motility. Predicted proteins of slr1041, slr1042, slr1043 and slr1044 are homologous to PatA, CheY, CheW and MCP, respectively. The missing cheA-like gene in this cluster was identified, as novel split genes, slr0073 and slr0322. The two disruptants of cheA-like genes did not show gliding motility on the agar surface. To elucidate functional relationship between two CheA-like molecules, we examined possible phosphorelay cascade between histidine kinase domain of Slr0322 and Hpt domain of Slr0073 using yeast two-hybrid and co-immunoprecipitation analyses. We detected the strong and specific interactions between Slr0322 and Slr0073. These results suggest that the phosphorelay signal of Slr0322-HK to Slr0073-Hpt exists in Synechocystis sp. PCC 6803. Also, we detected the interactions between each of two CheAs (Slr0322 & Slr0073) and a CheW (Slr1043) and a CheY (Slr1042). We will discuss the possible working model for a signal transduction pathway of the gliding motility. Session II Poster Presentation Abstracts 72 Poster Presentations Session II Heterocysts and nitrogen metabolism Session Chair: Karl Forchammer, Justus-Liebig Universitt Giessen
Session II Poster Presentation Abstracts 73 Characterization of Anabaena sp. strain PCC 7120 genes alr4311 and all4312 REBECCA E. THAYER AND STEPHANIE E. CURTIS* Department of Genetics, Box 7614, North Carolina State University, Raleigh, NC 27695-7614 A screen to identify sequences up-regulated at the transcript level during heterocyst development in Anabaena sp. strain PCC 7120 identified adjacent loci alr4311 and all4312 (1). The transcripts of these genes are expressed at very low levels in vegetative cells, and increase in abundance after nitrogen starvation and the induction of heterocyst development. The sequence of alr4311 suggests it encodes the ATP-binding protein of an ABC transporter complex, while that of all4312 suggests it encodes the response regulator of a two-component regulatory system. A preliminary inactivation of each of the genes by interruption with plasmid sequences resulted in strains that are inviable in the absence of fixed nitrogen. Characterization of the expression profiles of the genes after nitrogen starvation is being conducted, as well as more detailed phenotypic analyses of the alr4311 and all4312 mutant strains. (1) Curtis, S. E. and P. B. Hebbar. 2001. A screen for sequences up-regulated during heterocyst development in Anabaena sp. strain PCC 7120. Arch. Micrbiol. 175:313-322. Session II Poster Presentation Abstracts 74 Nitrogen control of the glutamyl-tRNA synthetase in Tolypothrix sp. PCC 7601 IGNACIO LUQUE1,2,3,*, LIN JIA3, GRALD ZABULON2, NICOLE TANDEAU DE MARSAC3, ENRIQUE FLORES4 AND JEAN HOUMARD2. (1) Dpto Fisiologa, Gentica y Microbiologa, Facultad de Ciencias, Universidad de Alicante, Campus de San Vicente, Alicante 03080 Spain. (2) Unit des organismes photosynthetiques et environnementCNRS/Ecole Normale superieure, 46 rue dUlm, 75230 Paris Cedex 05, France. (3) Unit des cyanobacteries, Intitut Pasteur, 28 rue du Dr. Roux F-75724 Paris France. (4) Intituto de Bioqumica Vegetal y Fotosntesis. C.S.I.C.-Universidad de Sevilla, E41092 Seville, Spain. Aminoacyl-tRNA synthetases are the enzymes responsible for charging the tRNAs with their cognate amino acid (1). Although it has long been assumed that every cell should contain an aminoacyl-tRNA synthetase for each amino acid this has recently been shown not to be universal. Thus, the archaea, most bacteria and the eukaryotic organelles do not have a complete set of aminoacyl-tRNA synthetases. In most bacteria, including the cyanobacteria, the glutamyltRNA synthetase (GltX or GluRS) is the enzyme that charges both tRNAglu and tRNAgln with glutamic acid (2). The misacylated glu-tRNAgln is subsequently transformed to gln-tRNAgln in a transamidation reaction in which glutamine acts as the amido donor. The main route for nitrogen assimilation in cyanobacteria is the glutamine synthetase/glutamate synthase cycle (GS/GOGAT) where both amino acids, glutamate and glutamine, are involved. We have estimated the intracellular concentration of glu and gln in the cyanobacterium Tolypothrix sp. PCC 7601 (also known as Calothrix sp. PCC 7601 or Fremyella diplosyphon) and observed that they experimented dramatic alterations upon changes in the nitrogen source supplied to cells. In order get some information on how GltX can adapt to these changes in the concentration of glu and gln, we have analyzed the expression of the gltX gene under different nitrogen regimes. The gltX transcript levels exhibited drastic transient alterations following changes in the nitrogen source
made available to cells. Strikingly the regulatory pattern significantly differed from that reported for gltX from the unicellular cyanobacterium Synechococcus sp. PCC 7942 (3). We have also analyzed the post-translational modifications of GltX in Tolypothrix under changing nitrogen conditions to observe that the electrophoretic mobility of this protein in native acrylamide gels varies concomitantly to changes in the nitrogen regime. Some of the mobility alterations seem to result from interactions with other proteins. Thus, we have observed that the apparent molecular mass of GltX varies under the conditions tested, and we have identified a 20 kDa protein that specifically interacts with GltX. Our present efforts are focused to elucidate the effects of such interactions on the function of GltX and to check if this protein also suffers some covalent posttranslational modifications. (1) Ibba M, Decker HD, Sthatopoulos C, Tumbula DL & Sll D (2000) Trends Biochem Sci 25:311316 (2) Freist W, Gauss DH, Sll D & Lapointe J (1997) Biol. Chem. 378:1313-1329. (3) Luque I, Contreras A, Zabulon G, Herrero A and Houmard J (2002).Mol. Microbiol. 46: 1157-1167. *Corresponding author Session II Poster Presentation Abstracts 75 Nitrogen regulation in cyanobacteria: new insights in responses mediated by the PII signal transduction protein KARL FORCHHAMMER*, M. FADI AL-DEHNI, ANNETTE HEINRICH, NICOLE KLOFT, MANI MAHESWARAN and ULRIKE RUPPERT Institut fr Mikrobiologie und Molekularbiologie der Justus-Liebig Universitt Giessen, Heinrich-BuffRing 26-32; D-35392 Giessen, Germany PII signal transduction plays pervasive roles in microbial nitrogen control. Among all of the various bacterial PII signalling systems, that in cyanobacteria is so far unique: in unicellular strains, the mode of covalent modification is by serine phosphorylation and the interpretation of the cellular nitrogen status occurs by measuring the cellular 2-oxoglutarate levels (1). Recent advances have been the identification of the phospho-PII phosphatase (2), the resolution of the crystal structure of PII proteins from Synechococcus and Synechocystis strains (3) and the identification of novel functions of PII regulation. PII is required for the control of nitrate/nitrite uptake as well as for the induction of NtcA-dependent gene expression under conditions of nitrogen deprivation(4). Phosphorylated PII signals nitrogen deficiency towards NtcA thereby greatly enhancing its activity under conditions of nitrogen deprivation. Dephosphorylation of PII-P (upon nitrogen-excess or carbon-limited conditions) is specifically catalysed by a protein phosphatase of the 2C family (PphA) (2). Phenotypic analysis of the PphA-deficient mutant demonstrated a requirement for PphA-dependent PII dephosphorylation to optimise the utilization of nitrate as N-source. In the absence of non-phosphorylated PII (corresponding to the high phosphorylation state of PII in the PphA deficient mutant), the cells are unable to adjust the activities of nitrate- and nitrite reductases: under conditions of limiting PSI-reduced ferredoxin, the activity of nitrate reduction exceeds that of nitrite reduction, leading to excess formation and excretion of nitrite. In agreement with its requirement for nitrate utilization, the levels of the PphA increase with the nitrate and nitrite concentration in the medium. An additional role of non-phosphorylated PII could be identified recently by yeast-two hybrid screening: N-acetyl glutamate kinase (NAGK), the key enzyme of the arginine biosynthesis pathway, forms a tight complex with PII (5). Upon complex formation, the catalytic activity of NAGK is greatly enhanced and arginine feedback control is alleviated (details of PII-NAGK complex formation will be shown in the presentation by M. Maheswaran). In vivo NAGK activity is controlled by the phosphorylation status of PII and therefore, arginine synthesis is the
first amino acid biosynthetic pathway, which is under global carbon/nitrogen control. These findings highlight the role of PII to coordinate a concerted cellular response of key steps of nitrogen metabolism according to the physiological needs of the cells. (1)Forchhammer, K. (2004) FEMS Microbiol. Rev. 28: 319-333. (2) Ruppert, U., Irmler, A., Kloft, N. und Forchhammer, K. 2002. Mol. Microbiol. 44: 855-864 (3) Xu, Y., Carr, P.D., Clancy, P., Garcia-Dominguez, M., Forchhammer, K., Florencio, F., Tandeau de Marsac, N., Vasudevan, S. and Ollis, D. (2003) Acta Cryst.D 59: 2183-2190. (4) Aldehni, M.F., Sauer, J., Spielhaupter, C. Schmid, R. und Forchhammer, K. (2003) J. Bacteriol. 185: 2582-2591 (5) Heinrich, A., Maheswaran, M. Ruppert, U. and Forchhammer, K. (2004) Mol. Microbiol.52:13031314. * corresponding author Session II Poster Presentation Abstracts 76 Possible role of a noncoding RNA in the initiation of heterocyst differentiation ANDREY V MATVEYEV, YUE ZHAO, JEN FETTWEIS, and JEFF ELHAI* Dept. of Biology, Virginia Commonwealth University, Richmond VA 23284 From the onset of nitrogen starvation of Anabaena PCC 7120, a series of events unfold culminating about 18 hours later in the appearance of mature, N2-fixing heterocysts. Hundreds of genes are induced at different times over the course of differentiation (1). Several specific genes important to the process have been identified, most notably hetR (2), whose expression is necessary and (in some circumstances) sufficient to trigger heterocyst differentiation. However, despite much effort, no global genetic circuitry has been elucidated of comparable explanatory power to the cascade of sigma factors governing the temporal and spatial expression of genes in during sporulation by Bacillus subtilis (3). Whatever circuitry is eventually found promises to represent something new to biology. Serendipity may work where a rational search has failed. In an attempt to understand the role of DNA methyltransferases in the control of cell cycle and heterocyst differentiation, we cloned and inactivated dmtB, encoding a GGCCspecific methyltransferase. Surprisingly, the resulting mutant was unable to initiate heterocyst differentiation. Loss of the methyltransferase itself, however, was not responsible for this remarkable phenotype, as complementation of the mutant with intact dmtB restored DNA methylation but not the ability to differentiate. Moreover, when the interrupting C.K3 cassette (4) was inserted in the opposite orientation (antiparallel to dmtB), methylation was lost but heterocyst differentiation was normal. These results pointed to activation by the strong PpsbA promoter of C.K3 of a downstream gene, perhaps trpD2, highly similar to genes encoding anthranilate phosphoribosyltransferase (Anabaena possesses another similar gene in its trp operon). Activation of trpD2 with the PpsbA promoter had no effect on differentiation, nor did inactivation of the gene by C.K3 placed in parallel to trpD2. However, C.K3 placed antiparallel to the gene produced the same Het- phenotype as did the original dmtB knockout. Taken together, these results indicated that expression of some element in or near the small intergenic region blocked heterocyst differentiation. The intergenic sequence is quite interesting. A 17-bp segment flanked by inverted repeats matches almost exactly a segment immediately upstream from hetRI, the transcriptional start site closest to hetR (5). Furthermore, while the corresponding 17-bp segment
in the dmtB/trpD2 intergenic region of Nostoc punctiforme differs in three nucleotides, but two of these differences are found also in Nostoc's hetRI region. These and other findings are most readily explained by the existence of a noncoding RNA transcribed from the intergenic region that regulates the expression of hetR. 1. Ehira S, Ohmori M, Sato N (2003). DNA Research 10: 97113. 2. Buikema WJ, Haselkorn R (1991). Genes Develop 5:321-330. 3. Errington J (2003). Nat Rev Microbiol 1:117-26. 4. Elhai J, Wolk CP (1988). Gene 68:119-138. 5. Buikema WJ, Haselkorn R (2001). Proc Natl Acad Sci USA 98:2729-2734. * Jeff Elhai, Dept. of Biology, 1000 W. Cary St., Virginia Commonwealth University, Richmond VA 23284. E-mail:ElhaiJ@VCU.Edu; Tel: 1-804-828-0794 Session II Poster Presentation Abstracts 77 Construction of a nitrate responsive Synechocystis sp. strain PCC 6803 bioreporter for estimating nitrate bioavailability in freshwater NATALIA V. IVANIKOVA*, R. MICHAEL L. McKAY AND GEORGE S. BULLERJAHN, Department of Biological Sciences, Bowling Green State University, BOWLING GREEN OH 43403 A recently developed approach for the quantification of nutrient bioavailability in aquatic ecosystems is the use of cyanobacterial whole-cell bioreporters (eg. 1). Indeed, previous studies have successfully employed recombinant bioluminescent cyanobacterial strains to monitor Fe and P availability in freshwater. In this study, we constructed a Synechocystis sp. PCC 6803 bioluminescent reporter for the assessment of nitrate bioavailability. Specifically, a 380 base pair DNA fragment containing the NtcA/B-dependent nitrate-activated nirA promoter was fused to the bacterial luciferase genes, luxAB, and introduced into Synechocystis by genetic transformation (2). Characterization of this strain yielded dose-dependent increased bioluminescence as nitrate increased in the medium from 1100 micromolar. This biosensor will be deployed in Summer 2004 in an effort to determine the factors limiting nitrate drawdown in Lake Superior, an ecosystem whose nitrate levels have increased 6-fold in the last century to approximately 30 M. Pilot experiments performed on pelagic Lake Superior water samples suggest that the bioreporter luminescent response is attenuated, indicating nutrient and/or light limitation constraining nitrate utlilization, Indeed, amendment of water samples with Fe and P together yielded luminescence appropriate for the nitrate levels detected by chemical means (3). These data suggest that picophytoplankton are co-limited by P and Fe in the lake. Supported by NSF grants OCE0327738 and 0352274 awarded to R.M.L.M. and G.S.B. 1. Porta, D., G.S. Bullerjahn, K.A. Durham, S.W. Wilhelm, M.R. Twiss and R.M.L. McKay. 2003. Physiological characterization of a Synechococcus sp. (Cyanophyceae) strain PCC 7942 iron-dependent bioreporter for freshwater environments. J. Phycol. 39: 64-73. 2. Kunert, A., M. Hagemann and N. Erdmann. 2000. Construction of promoter-probe vectors for Synechocystis sp. PCC 6803 using the light-emitting reporter systems Gfp and LuxAB. J. Microbiol. Methods 41: 185-194. 3. Ivanikova, N.V., R.M.L. McKay and G.S. Bullerjahn. 2004. Construction and characterization of a freshwater nitrate-sensing bioreporter. Limnol. Oceanogr: Methods, submitted. *corresponding author, natalii@bgnet.bgsu.edu
Session II Poster Presentation Abstracts 78 Characterization of the DNA-binding activity of Anabaena 7120 devH protein MARTHA E. RAMIREZ AND STEPHANIE E. CURTIS* Department of Genetics, Box 7614, North Carolina State University, Raleigh, NC 27695-7614 The Anabaena sp. strain PCC 7120 devH gene is essential for heterocyst function (1). A devH mutant is capable of nitrogen fixation but only under anaerobic conditions, due in part to reduced glycolipid gene expression and absence of the heterocyst glycolipid layer (2). The precise role of DevH in heterocyst development and function is unknown, but the structure of the protein suggests it is a transcriptional regulator. A recently identified DevH target is the promoter of the devH gene. DevH binds a region of the devH promoter that contains two adjacent 12-bp palindromes. An in vitro binding-site selection (SELEX) study identified 46 related sequences that bind DevH with high affinity and are similar to the binding sites identified in the devH promoter. The consensus DevH binding sequence is very similar to that of the cyanobacterial transcriptional activator NtcA. (1) Hebbar, P. B., and S. E. Curtis. 2000. Characterization of devH, a gene encoding a putative DNA binding protein required for heterocyst function in Anabaena sp. strain PCC 7120. J. Bacteriol. 182:3572-3581. (2) Ramirez, M. E., Hebbar, P. B., Zhou, R., Wolk, C. P. and S. E. Curtis. Anabaena sp. strain PCC 7120 gene devH is required for synthesis of the heterocyst glycolipid layer. Submitted. Session II Poster Presentation Abstracts 79 Testing whether insertion sequences within putative regulatory genes affect the phenotype of Anabaena sp. strain PCC 7120 SIGAL LECHNO-YOSSEF1, KARIN JGER1, C. PETER WOLK1* SATOSHI TABATA2, AND TAKAKAZU KANEKO2, 1MSU-DOE Plant Research Laboratory, Michigan State University, E. Lansing, MI 48824, U.S.A. and 2Kazusa DNA Research Institute, 2-6-7 Kazusakamatari, Kisarazu, Chiba, 292-0818, Japan Regulatory protein kinases in eukaryotes normally phosphorylate hydroxyl amino acids such as serine, threonine and tyrosine, whereas those in bacteria more commonly phosphorylate histidine residues. Histidine kinases are involved in such different signaling processes as host recognition in symbiosis and pathogenesis, sensing of the availability of carbon and nitrogen, chemotaxis, and differentiation, including sporulation. Insertion sequences (ISs) are transposable elements 0.8 to 2.5 kb in size that normally bear genes required for their transposition. Active ISs are present in Anabaena 7120 (1-4). Analysis of the Anabaena 7120 genome showed three instances in which presumptively encoded kinases may have been interrupted by IS891: chromosomally encoded His kinases All3985 (extended) and Alr4105 (extended) and _ megaplasmid-encoded Ser/Thr kinase Alr7232 (extended). Gliding motility and the formation of gas vesicles and akinetes are common in other members of the Nostocaceae, and orthologs of requisite genes are present in Anabaena 7120. Perhaps these processes do not occur in Anabaena 7120 because of IS-transposition. To test this idea, we cured the ISs from the genomic sequences by PCR and introduced the cured sequences back into Anabaena 7120. First, the portions of each IS-interrupted ORF to either side of the IS were amplified separately by PCR with pairs of primers, one outer and one ORF-internal. Each ORF-internal primer was comprised of sequences contiguous with both ends of the IS. The resulting, PCR-amplified fragments were then used as templates with the two original external primers to amplify the gene without the IS. The cured form of the gene was introduced into an appropriate, pUC-based sequencing clone from the Anabaena sequencing project, and the insert from the modified clone was transferred into
derivative pRL2833b (5) of Nostoc replicon pDU1. The pDU1 construct was then introduced into Anabaena 7120 to generate a strain bearing both the IS-interrupted, chromosomal ORF and the pDU1-borne, cured form of the ORF with its native promoter. To date, when grown under nitrogen-replete, nitrogen-deficient, or nitrogen- and phosphorus-deficient conditions, no derivative strain bearing any of the cured genes has shown a phenotype observable by light microscopy that differs from that of the original Anabaena. In addition, RT-PCR of alr4105 (extended) showed no transcription of that gene. Plasmids were recovered from exconjugants to which the three pDU1-derivatives had been transferred. Those from two resembled what had been transferred. However, three plasmids recovered from the strain to which uninterrupted (extended) alr7232 had been transferred provided evidence suggestive of IS891 having been reintroduced into the pDU1 derivative in its original position, consistent with double recombination having taken place. 1. Cai, Y. and C.P. Wolk, J. Bacteriol., 1990. 172: 3138-3145. 2. Bancroft, I. and C.P. Wolk, J. Bacteriol., 1989. 171: 5949-5954. 3. Kaneko, T., et al., DNA Res., 2001. 8: 205-213. 4. Alam, J., et al., J. Bacteriol., 1991. 173: 57785783. 5. Huang, G., and C.P. Wolk, unpubl. Session II Poster Presentation Abstracts 80 The response of Synechocystis sp. PCC 6803 to nitrogen starvation: transcriptomics versus proteomics VLADIMIR KRASIKOV 1*, HENK L. DEKKER 2, and HANS C. P. MATTHIJS 1 1 Aquatic Microbiology, Institute of Biodiversity and Ecosystem Dynamics, Universiteit van Amsterdam, Nieuwe Achtergracht 127, 1018 WS Amsterdam, The Netherlands 2 Mass Spectrometry Group, Swammerdam Institute for Life Sciences, University of Amsterdam, Nieuwe Achtergracht 166, 1018 WV Amsterdam, The Netherlands Nitrogen is one of the nutrients that is playing an essential role in metabolism and ultimately is needed for the growth of cyanobacteria. To survive in nutrient limited conditions, cells should mobilise systems for high affinity uptake of limiting nutrients, adapt physiological processes to enable more economic usage of the nutrient concerned, and strive to be able to utilise nontraditional resources. Recently, an effective technique called DNA microarray has been developed and used to monitor gene expression in cyanobacteria. Classical proteomics including two-dimensional gel electrophoresis for separation and mass spectrometry for qualitative analysis of proteins in complex mixtures has been successfully applied to evaluate stress responses in cyanobacteria. However, overlaying of DNA array results with proved expression of proteins has not been reported so far. Protein expression profiles in Synechocystis sp. PCC 6803 cells, in response to relatively short nitrogen starvation, were determined using the cleavable isotope-coded affinity tag (cICAT) labeling strategy. The analysis included separation of the mixed protein samples by SDS-PAGE (total proteins isolated from cells growing 12 hours in nitrogen free medium were mixed in proportion 1:1 with proteins isolated from normally grown culture), followed by excision of regions from an entire gel lane. Proteins were subjected to ingel digestion, biotin affinity chromatography, and analysis by nano-scale microcapillary liquid chromatography coupled to tandem mass spectrometry. The comparison of the global transcriptome analysis with qualitative and quantitative proteomics of cyanobacterial cells exposed to nitrogen starvation will be discussed. This work was supported by a Dutch Science Foundation Pioneer grant to Prof. dr. J. Huisman, and by a NWO grant.
* Corresponding author: Vladimir Krasikov Aquatic Microbiology, Institute of Biodiversity and Ecosystem Dynamics, Universiteit van Amsterdam, Nieuwe Achtergracht 127, 1018 WS Amsterdam, The Netherlands E-mail: krasikov@science.uva.nl Tel.: +31205257070, Fax: +31205257064 Session III Poster Presentation Abstracts 81 Poster Presentations Session III Physiology, Metabolism and Global Responses (II) Session Chair: Francis X. Cunningham, Jr., University of Maryland Session III Poster Presentation Abstracts 82 Genetic analysis of nonribosomal peptide synthetase genes in cyanobacteria AKITO NISHIZAWA1, TAKAKAZU MIURA1, ARIZAL BIN ARSHAD1, TOMOYASU NISHIZAWA1, MUNEHIKO ASAYAMA1, TOMOYO NAKANO2, KIYONAGA FUJII2, KENICHI HARADA2 AND MAKOTO SHIRAI1 1 College of Agriculture, Ibaraki University, Inashiki Ibaraki 300-0393, Japan 2 Faculty of Pharmacy, Meijo University, Tempaku, Nagoya 468-8503, Japan Cyanobacteria are known to produce a wide rage of secondary metabolites, including nonribosomal peptides. Toxic cyanobacterial waterblooms are found worldwide in eutrophic lakes, ponds and dams. Microcystis species are some of the most common waterbloom-forming species of caynobacteria. Microcystis aeruginosa K-139, which was isolated from Lake Kasumigaura, produces nonribosomal peptides, hepatotoxic microcystin and neurotoxin micropeptin. We have identified the complete synthetase gene structures for microcystin and micropeptin. The mcirocystin synthetase gene (mcy) cluster of M. aeruginosa K-139, is composed of two nonribosomal peptide synthetase (NRPS)-polyketide synthase hybride genes, three NRPS genes, one polyketide synthase (PKS) gene, and four genes for modification of Mcy proteins. The micropeptin synthetase gene (mip) was consisted of seven NRPS genes. Furthermore, we identified two non-ribosomal peptide synthetase genes, psm3 and psm4, from a strain K-139. The psm3 gene was a cluster spanning 30kb, including 14 bidiretionally transcribed open reading frame arranged in two operon. Primer extension and QRT-PCR analyses revealed the transcriptional expression of psm3. Alignment analysis in the binding pocket of adenylation domains in NRPS suggested that Psm3C activate Asp. ATP-PPi exchange experiment revealed that Psm3B activate Tyr. Partial DNA sequence analysis revealed that the psm4 gene is involved in nonribosomal peptide synthesis. In addition to microcystin and micropeptin, we isolated two nonribosomal peptides, aeruginosin and microviridin, from M. aeruginosa K-139. Disruption of psm3 did not revealed disappearance both of aeruginosin and microviridin production. These results indicated that a strain K-139 produces at least five nonribosomal peptides. To understand a molecular mechanism of non-ribosomal peptide synthesis and perform genetic engineering, we attempt to produce nonribosomal peptides of Cyanobacteria in heterologous hosts. Session III Poster Presentation Abstracts 83
Ribonucleotide reduction in the cyanobacteria FLORENCE K. GLEASON, Dept. of Plant Biology, 250 Biological Sciences Center, University of Minnesota, St. Paul, MN 55108 USA. Ribonucleotide reductase reduces ribonucleotides to the corresponding deoxyribonucleotides and supplies the precursors for DNA synthesis and repair. Unlike most essential enzymes, the amino acid sequence of ribonucleotide reductases is not conserved among different organisms except for a few critical residues in the active site required for thiyl radical formation during catalysis. Ribonucleotide reductases are divided into three classes based mainly on the mechanism used to generate the catalytically important thiyl radical. Class I reductases utilize a separate protein cofactor containing an iron stabilized free radical that is transferred to the active site during turnover. This is the most wide-spread type of reductase found in some bacteria and most eukaryotic organisms. Class II enzymes utilize coenzyme B12 to generate the enzyme radical and are found in a variety of bacteria and archaea. Class III enzymes also require an iron cofactor protein and are active only under strictly anaerobic conditions (1). Cyanobacteria seem to be unique in that most of these organisms have a class II enzyme. We have cloned the gene for the ribonucleotide reductase from Anabaena sp. PCC7120. The gene codes for a 1,172 amino acid protein that contains a 407 amino acid intein. The gene has been expressed in E. coli and the intein removes itself, yielding an active reductase. The protein reduces all four common ribonucleoside triphosphates and is absolutely dependent on the presence of coenzyme B12 (2). An external reducing agent is also required, either the artificial reductant, dithiothreitol, or the disulfide-containing redox protein, thioredoxin. The enzyme is relatively inactive but can be stimulated by adding deoxynucleotide triphosphates or high concentrations of ATP. Sequence comparisons to other reductases suggest that the cyanobacterial proteins are all related to the Anabaena enzyme, showing 75-90% sequence similarity. However, the cyanobacterial reductases show only modest similarity to class II enzymes from other bacteria such as Lactobacillus or Geobacter. The cyanobacterial enzymes show almost no sequence conservation with Class II enzymes found in photosynthetic bacteria. Also in contrast to many other groups of bacteria, the cyanobacteria do not have genes for other classes of reductases. It is suggested that their occupation of iron-poor environments provides a strong selection for the maintaining only the B12-dependent ribonucleotide reductase in the cyanobacteria. 1. Jordan, A., and Reichard, P. (1998) Ribonucleotide reductases. Annu. Rev. Biochem. 67:71-98. 2. Gleason, F.K. and Olszewski, N. (2002) Isolation of the gene for the B12-dependent ribonucleotide reductase from Anabaena sp. Strain PCC7120 and expression in Escherichia coli, J. Bacteriol. 184:6544-6550. Session III Poster Presentation Abstracts 84 Protein trans-splicing of the -subunit of the DNA-polymerase III of Synechocystis sp. PCC 6803: does it exert a regulatory role? Monika Klissenbauer, Rdiger Schulz-Friedrich and Jens Appel* Botanisches Institut, Christian-Albrechts-Universitt, Am Botanischen Garten 1-9, D-24118 Kiel, Germany *e-mail: jappel@bot.uni-kiel.de Inteins are peptide sequences that self splice out of completely translated proteins by joining the flanking sequences to yield a new peptide bond between the so called exteins (1). Since these events are reminiscent of introns splicing themselves out of transcribed RNAs and linking the exons to a complete translatable ORF these names were given accordingly. Recent years saw the rapid development of many protein modifying
techniques using inteins and much effort has been placed on the elucidation of the underlying mechanisms (2). In contrast the functional significance of inteins has been studied only rarely. Up to now protein trans-splicing is known only from the cyanobacterial DnaE protein that forms the -subunit of the DNA-polymerase III (3). The split DnaE was first found in the complete genome sequence of Synechocystis sp. PCC 6803. It is encoded in two different ORFs that are separated more than 745 kb on the chromosome. In contrast to other bacteria, cyanobacteria are known to contain several genome equivalents per cell. It also has been shown that the number of chromosomes varies with culture age, cell type and other conditions (4). The regulatory mechanisms underlying these variations have not yet been characterized. We therefore set out to investigate the split dnaE of Synechocystis by eliminating the intein sequences and joining the two separate dnaE genes to one continuous ORF. Several independent clones of this mutant strain were tested for their growth characteristics and genome equivalents under different conditions in comparison to the wild type. The results are discussed concerning a regulatory role of DnaE trans-splicing on cell division and the copy number of chromosomes. 1. Paulus, H (2000) Annu. Rev. Biochem. 69, 447-496. 2. Noren, CJ, Wang, J, Perler, FB (2000) Angew. Chem. Int. Ed. 39, 450-466. 3. Wu, H, Hu, Z, Liu, XQ (1998) Proc. Natl. Acad. Sci. USA 95, 9226-9231 4. Lee, MH, Scherer, M, Rigali, S, Golden JW (2003) J. Bacteriol. 185, 4315-4325 Session III Poster Presentation Abstracts 85 Characterization of group 2 sigma factors of RNA polymerase and their roles in the cyanobacterium Synechocystis sp. strain PCC 6803 SOUSUKE IMAMURA, MUNEHIKO ASAYAMA*, MAKOTO SHIRAI Ibaraki University, Laboratory of Molecular Genetics, Ami, Ibaraki 300-0393, Japan The RNA polymerase (RNAP) holoenzyme of eubacteria consists of a core enzyme and a sigma factor. The core enzyme catalyzes RNA synthesis and the sigma factor is required for the initiation of transcription from a specific promoter sequence. A unicellular cyanobacterium Synechocystis sp. strain PCC 6803 possesses nine sigma factors, group 1, SigA; group 2, SigB to SigE; and group 3, SigF to SigI, by its whole genome sequence information (1). However, the clear functions and roles of individual sigma factors remain to be resolved. Here we present the functions of group 2 sigma factors in PCC 6803. We identified dark-/light-induced sigma factor SigB/SigD, of which expression was accelerated under opposite redox (oxidation/reduction) states in an electron transport chain of photosynthesis. Furthermore, expression of the darkinduced lrtA and light-induced psbA2/3 transcript was significantly reduced in the sigB and sigD knockout strains, respectively. These findings clearly showed that SigB/SigD contribute to transcription for a subset of dark-/light-responsive genes in the cyanobacterium (2). On the other hand, autoregulated sigB transcription, a dramatically increased SigB expression upon the exposure of cells to heat-shock, and specific promoter recognition by SigB on the heat-shock hspA promoter were observed. These findings clearly indicated that SigB is also a heat-shock
responsive sigma factor (1). In analyses of transcript and protein levels using the sigC knockout strain, it was revealed that the glnB, which encodes for a nitrogen regulatory protein PII, nitrogen promoter (P2) was specifically recognized by SigC in the stationary phase under conditions of nitrogen deprivation. In vitro studies with purified enzymes also indicated effective transcription from P2 by RNAP-SigC with NtcA, a global nitrogen regulator that belongs to the Crp family. These results clearly suggested that SigC is a sigma factor that regulates nitrogen related gene expressions in the stationary phase (3). (1) Imamura, S. et al. (2003) J Mol Biol 325, 857-872. (2) Imamura, S. et al. (2003) FEBS Lett 554, 357-362. (3) Asayama, M. et al. (2004) Biosci Biotechnol Biochem 68, 477-487. Session III Poster Presentation Abstracts 86 The composition and dynamics of the phytoplankton assemblage in Lake Kinneret is strongly affected by cyanobacterium - dinoflagellate communication 1 SCHATZ DANIELLA, 1VARDI ASSAF, 2SUKENIK ASSAF, 1LEVINE ALEX and AARON KAPLAN1* 1 Institute of Life Sciences, The Hebrew University of Jerusalem, Israel. 2 Oceanographic & Limnological Research, P.O.Box 447, Migdal 14950 Israel. The reasons for annual variability in composition of phytoplankton assemblages and toxic cyanobacterial blooms are poorly understood but may include allelopathic interactions. We show that a bloom of a toxic cyanobacterium, Microcystis sp. or alternatively domination by the dinoflagellate, Peridinium gatunense, in Lake Kinneret, may be accounted for by mutual density-dependent allelopathic interactions. Over the last 30 years the abundance of these species in the lake displayed strong negative correlation. Laboratory experiments showed reciprocal, density-dependent but nutrient-independent inhibition of growth (1). Application of spent P. gatunense medium induced sedimentation and subsequently massive lysis of Microcystis cells, within 24 hr, concomitantly with a large rise in the level of McyB, which is involved in microcystin biosynthesis. The older was the culture of Peridinium the more effective was its spent media in promoting the level of McyB in Microcystis. We show that the induction of expression of mcyB was mediated by a factor released from Microcystis cells during their lysis. Spent media from Microcystis inhibited internal carbonic anhydrase in Peridinium which than became CO2-limited. The consequent accumulation of reactive O2 species resulted in activation of a MAPK cascade which led to apoptosis-like process, mediated by specific proteases, in some of the Peridinium cells and cell division of others. We propose that a crosstalk via allelochemicals may explain the composition of the phytoplankton assemblage in Lake Kinneret in the spring, including presence or absence of Peridinium or Microcystis blooms. 1. Vardi, A., Schatz, D., Beeri, K., Motro, U., Sukenik, A., Levine, A. and A. Kaplan (2002) Dinoflagellatecyanobacterium communication may determine the composition of phytoplankton assemblage in a mesotrophic lake. Current Biology 12: 1767-1772 * Corresponding author Session III Poster Presentation Abstracts 87 Investigation of carbon and light on cyanobacterial toxin production Douglas Graham School of life sciences, The Robert Gordon University, St. Andrews street, Aberdeen, UK, AB25 1HG
Linda A. Lawton* School of life sciences, The Robert Gordon University, St. Andrews street, Aberdeen, UK, AB25 1HG Cyanobacteria (blue green algae) are a widely distributed and diverse group of unicellular and multicellular photosynthetic prokaryotes. They are known to produce toxic secondary metabolites that fall into two main classes, hepatotoxins and neurotoxins the function of which is still unclear. Globally the most commonly occurring toxins are hepatotoxins, microcystin and nodularin often found in the bloom forming genera Microcystis, Anabeana, Nostoc and Oscillatoria. Typically found in eutrophic water bodies and slow moving rivers, they pose a significant hazard to both human and animal health following ingestion of contaminated water. The implication of toxic bloom formation is a major concern for water management; therefore understanding the natural function of these secondary metabolites may help in treatment. Research has primarily focused on the effect of environmental factors like light, temperature, pH, limited nutrients and micronutrients, but all the findings have produced no clear indication of these factors being responsible for the regulation of toxin production. Our research into the effects of increasing inorganic carbon and light intensity on hepatotoxin production in Microcystis aeruginosa, Microcystis sp. and Nodularia spumigenia, found significant changes in the levels of toxin produced. Increasing inorganic carbon reduced levels of biomass and cause significant reductions in the level of intracellular microcystin and nodularin. In the most profound case an 80% reduction in the intracellular level of microcystin was observed when grown in the presence of 40mM sodium bicarbonate. Also previous studies have suggested that toxins are only released after call lysis, but in the presence of increased inorganic carbon and light the extracellular toxin level exceeded the intracellular levels in cultures of N. spumigenia. * Corresponding author, e mail address l.lawton@rgu.ac.uk Session III Poster Presentation Abstracts 88 Chlorophyll Pasteur point, a critical atmospheric oxygen level for ancestral chlorophyll biosynthesis YUICHI FUJITA* and SHOJI YAMAZAKI Laboratory of Molecular Plant Physiology, Graduate School of Bioagricultural Sciences, Nagoya University, Nagoya 464-8601, JAPAN The advent of oxygenic photosynthesis in ancestral cyanobacteria led to the most important biologically driven change in the Earths environment. Cyanobacteria became ubiquitous in all environments containing water, an unlimited source of electron donors, and transformed the Earths atmosphere from anoxic to oxic. To survive in the oxidative environments they generated, however, the creation of an oxygen-tolerant enzyme in the penultimate step of the chlorophyll biosynthesis pathway appears to have been necessary. Here we provide evidence that the rise of atmospheric oxygen level in Proterozoic era may have been a major selective pressure to create an oxygen-tolerant protochlorophyllide (Pchlide) reductase (light-dependent Pchlide oxidoreductase; LPOR) that compensated for the existing oxygensensitive Pchlide reductase (dark-operative Pchlide oxidoreductase; DPOR). A mutant, YFP12, of an extant cyanobacterium Plectonema boryanum lacking LPOR could not grow photoautotrophically under aerobic conditions, but grew under anaerobic conditions. The maximal oxygen level in which YFP12 was able to grow was 3% (v/v). The contents of three subunits, ChlL, ChlN and ChlB, of DPOR were greatly increased in the YFP12 cells grown in the anaerobic conditions compared with the wild-type cells. These results suggest that 3% oxygen in the environment is the upper limit for protecting the DPOR activity from oxygen. The oxygen level 3% is coincident with a proposed atmospheric oxygen level at 2.2-2.0 gigayears ago (Gya), implying that the oxygen-tolerant Pchlide reductase, LPOR, evolved no later than 2.2-2.0 Gya from NAD(P)(H)-accepting oxidoreductases family. We propose to call
the critical oxygen level for the probable ancestral chlorophyll biosynthesis Chlorophyll Pasteur point. *Corresponding author Session III Poster Presentation Abstracts 89 Construction of cyanobacterial bioreporters for detecting nutrient deficiency in marine waters. R. BOYANAPALLI, G. S. BULLERJAHN, R. M. L. MCKAY* Department of Biological Sciences, Bowling Green State University, Bowling Green, Ohio, 43403 USA. Picoplankton (0.2 2 m) serve as the dominant phytoplankton assemblage in most oligotrophic waters. A long held paradigm in marine science is that phytoplankton are limited by nitrogen. However, numerous reports in recent years have demonstrated that both phosphorus and iron deficiency are widespread, particularly associated with oligotrophic oceanic gyres and high nutrient, low chlorophyll regions. Whereas concentrations of dissolved nutrients can serve as a first-order proxy for nutrient deficiency, chemical speciation can represent an obstacle in the application of this proxy. Nutrient bioavailability could be understood better if a biological system were to be used to estimate nutrient supply. We have been working on the development and characterization of cyanobacterial bioreporters to monitor bioavailable phosphorus and iron in marine waters. The cyanobacterium used in this study is the coastal isolate Synechococcus sp. PCC 7002. In developing these strains, we have used expression vectors capable of integrating into the cyanobacterial chromosome by homologous recombination. The iron bioreporter we are developing features the promoter element of the Synechococcus iron stress inducible gene isiAB fused to promoterless bacterial luciferase genes, luxAB, from Vibrio harveyi. The phosphate bioreporter we are constructing features the promoter for phoH, a gene up-regulated under phosphate stress. Both reporters feature chloramphenicol selectable markers. Expression of luciferase regulated by isiAB or phoH promoters will be quantified with a luminometer and the response calibrated using Aquil growth medium containing known additions of phosphate or iron. We plan to test the bioreporters on samples collected using clean sampling methods from the Southern Ocean (FeCycle cruise; January, 2003) and from the central North Pacific gyre region (RoMP III, August/September, 2003). For each of these cruises, we have complementary measures of phosphate (alkaline phosphatase activity) and iron bioavailability (ferredoxin index, cellular elemental stoichiometry) with which we can compare the bioreporter response. Supported by NSF grant OCE-0327738 awarded to R.M.L.M. and G.S.B. *corresponding author, rmmckay@bgnet.bgsu.edu Session IV Poster Presentation Abstracts 90 Poster Presentations Session IV Photosynthesis and responses to light Session Chair: John Cobley, University of San Francisco Session IV Poster Presentation Abstracts 91 Expression and mutagenesis of mapA, a Synechococcus sp. PCC 7942 iron responsive gene: evidence for oxidative stress protection ARMERIA VICOL1*, CHRISTEL S. HASSLER2 AND GEORGE S. BULLERJAHN1, 1Department of Biological
Sciences, Bowling Green State University, Bowling Green OH 43403, and 2Department of Biology, Clarkson University, Potsdam NY 13699 Our lab has recently focused on the construction of cyanobacterial bioreporters suitable for use as sensors for nutrient deficiency and stress in natural habitats (1,2). Previous work by Shermans group has identified a Synechococcus sp. PCC 7942 gene, mapA, expressed under low iron conditions (3), and more recent work has shown that mapA transcription is rapidly activated upon treatment of cultures with peroxide (4). We have constructed PmapA::luxAB fusions to identify both the elements of the promoter and Fe concentration yielding low iron-dependent transcription. Additionally, we have constructed a mapA mutant that expresses a truncated MapA protein that likely interferes with wild type mapA function. Our studies reveal that low Fe dependent expression occurs at Fe concentrations (pFe 18.9) over 10-fold higher than those triggering transcription from the Fur-regulated isiA promoter, and secondly, promoter fusion deletions suggest the involvement of multiple transcription factors responsible for mapA expression under conditions of low Fe growth, peroxide treatment and growth phase. Lastly, the mapA construct expressing the truncated MapA protein exhibits a high light lethal phenotype consistent with MapA playing a role in oxidative stress. Owing to the pattern of Low Fe expression, we are currently using the luxAB promoter fusions in concert with other promoter fusions to determine bioavailable Fe in fresh water environments (Lake Superior). Supported by NSF award 0327738. 1. Porta, D., G.S. Bullerjahn, K.A. Durham, S.W. Wilhelm, M.R. Twiss and R.M.L. McKay. 2003. Physiological characterization of a Synechococcus sp. (Cyanophyceae) strain PCC 7942 iron-dependent bioreporter for freshwater environments. J. Phycol. 39: 64-73. 2. Ivanikova, N.V., R.M.L. McKay and G.S. Bullerjahn. 2004. Construction and characterization of a freshwater nitrate-sensing bioreporter. Limnol. Oceanogr: Methods, submitted. 3. Webb, R., T. Troyan, D. Sherman and L.A. Sherman, 1994. MapA, an iron-regulated, cytoplasmic membrane protein in the cyanobacterium Synechococcus sp. PCC 7942. J. Bacteriol. 176: 4906-4913. 4. Yousef, N., E.K. Pistorius and K.-P. Michel. 2003. Comparative analysis of idiA and isiA transcription under iron starvation and oxidative stress in Synechococcus elongatus PCC 7942 wild type and selected mutants. Arch Microbiol. 180: 471-483. *corresponding author Session IV Poster Presentation Abstracts 92 Cyanobacterial respiratory terminal oxidases G. SCHMETTERER, D. PILS, C. TRAUTNER, C. WILKEN, B. WIESER Institute of Physical Chemistry, Vienna University, UZA2, Althanstrasse 14, A-1090 Vienna, Austria Respiratory terminal oxidases (RTO's) are the key enzymes of cyanobacterial respiration, since they are probably the only components of the cyanobacterial repiratory electron transport chain not directly involved in photosynthesis. Except for Gloeobacter violaceus PCC 7421 that contains no thylakoids, all cyanobacteria probably have two independent respiratory chains, one in the cytoplasmic membrane and one - linked to photosynthetic electron transport - in the thylakoids. All cyanobacterial RTO's belong to only two groups of enzymes, the relatives of the heme-copper enzymes and those related to cytochrome bd quinol oxidase (Qox) of Escherichia
coli. (Quite recently the existence of genes related to the cyanide-insensitive terminal oxidase of chloroplasts in a few cyanobacteria was discovered on the basis of sequence similarities; however, no biochemical or genetic evidence for their function in cyanobacteria is available so far, and their involvement in respiration must remain uncertain for the time being.) Heme-copper RTO's are either genuine cytochrome c oxidases (Cox) or related enzymes called ARTO (Alternate Respiratory Terminal Oxidase), whose electron donor is uncertain. A striking result of the total genomic sequences of a number of cyanobacteria is that the number of RTO's present in the different strains is by far not constant. Indeed, all strains contain at least one cytochrome c oxidase, but ARTO or Qox is not present in all strains. It is our aim to characterize the function of each set of genes encoding RTO's in cyanobacteria. Due to the difference of occurrence of such genes in different cyanobacteria, it is impossible to generalize results obtained in one strain to another one or cyanobacteria in general. Heterocyst forming strains appear to contain more RTO's than simpler cyanobacteria (possibly up to five). We have analyzed especially Synechocystis sp. PCC6803, Nostoc(Anabaena) sp. PCC7120 and Anabaena variabilis ATCC29413. PCC6803 and ATCC29413 are facultative heterotrophs and one and only one RTO (a Cox) is essential for heterotrophic growth in these strains. A highly related Cox exists in the obligate autotroph PCC7120, where its function remains uncertain. There is now good evidence that in PCC6803 the single ARTO probably functions as the terminal respiratory oxidase of the respiratory chain in the cytoplasmic membrane. In PCC7120, however, one of the Cox's and an ARTO are involved in protecting the heterocysts from the deleterious action of dioxygen on nitrogenase. Producing mutants lacking one or more of RTO'S in cyanobacteria invariably leads to a curious result: the total respiratory activity cannot be predicted in any mutant, and the respiratory rates of strains containing more than one RTO are highly non-additive when compared to the respiratory rates of those strains containing only a sinlge RTO. The possible reasons for this will be discussed. A detailed current model of the function of the at least four, possibly five RTO's in the complicated hetercyst forming strain ATCC29413 will also be presented. Session IV Poster Presentation Abstracts 93 Circadian rhythm of gene expression and cloning of clock genes in the facultative filamentous cyanobacterium Plectonema boryanum KAZUKI TERAUCHI 1* , MITSUNORI KATAYAMA 1 , YUICHI FUJITA 2 and TAKAO KONDO 1 1 Division of Biological Science, Graduate School of Science, Nagoya University, and CREST, JST, Nagoya 464-8602, Japan , 2 Laboratory of Molecular Plant Physiology, Graduate School of Bioagricultural Sciences, Nagoya University, Nagoya 464-8601, Japan Cyanobacteria are the simplest organisms known to exhibit circadian rhythms. We have studied the mechanisms of circadian rhythms using the cyanobacterium Synechococcus elongatus PCC 7942 and demonstrated that kaiABC gene cluster is essential for the clock functions (1). The obligate photoautotrophic organism S. elongatus PCC 7942 is not a suitable model to address the questions that photosynthesis is involved in sustaining the expression of circadian rhythms and that light is necessary for the oscillation of the circadian clock. In order to
focus on these aspects, we tried to monitor gene expression in the facultative cyanobacterium Plectonema boryanum. This organism exhibits heterotrophic growth using glucose in complete darkness and various genetic tools are also available (2). A promoterless segment of luciferase genes was introduced downstream of the promoter for the P. boryanum chlB gene, which encodes a subunit B of light-independent protochlorophyllide reductase, or petF gene encoding ferredoxin. These reporter constructions were introduced in P. boryanum. We monitored the bioluminescence of reporter strains by an automated monitoring system as promoter activity. Bioluminescence of the reporter strains oscillated with a period of about 24 h in continuous light. In addition, we cloned kaiABC genes from P. boryanum, showing that a circadian clock gene cluster kaiABC was conserved as well as other cyanobacteria. These data indicate that this organism has the same mechanism controlling circadian rhythms as S. elongatus PCC 7942. When bioluminescence was monitored in continuous dark, it oscillated with a period about 21 h. This observation suggests that photosynthetic metabolism is not necessary for the oscillation of the circadian clock to persist and that light signal is needed for the clock to cycle in circadian periodicity. Results of the effect of DCMU, an inhibitor of the photosystem II activity, on the oscillation of bioluminescence will be presented. 1) Ishiura et al. 1998, Science 281, 1519-1523. 2) Fujita et al. 1996, Plant Cell Physiol. 37, 313-323. *Corresponding author Session IV Poster Presentation Abstracts 94 Unveiling the presence of more than one oscillator in S. elongatus PCC7942 EUGENIA M. CLERICO1, JAYNA L. DITTY2 AND SUSAN S. GOLDEN1* 1 Department of Biology, Texas A&M University, College Station TX 77843-3258 USA 2 Department of Biology, University of St. Thomas, 2115 Summit Ave, St. Paul, MN 55105 USA Cyanobacteria possess intrinsic circadian clocks that allow cells to coordinate physiological processes with the Earths day-night cycles. The circadian oscillator of Synechococcus elongatus PCC 7942 (comprised of at least the KaiA, KaiB and KaiC proteins) generates daily rhythms of expression from genes throughout its genome. One of our goals is to understand how the cyanobacterial cell organizes its internal oscillator and transmits temporal information to clockcontrolled genes. We monitor the period, amplitude, and phasing of the circadian rhythm from any cyanobacterial promoter by using luciferase gene fusions (Vibrio harveyi "luxAB", or firefly "luc"), such that light production reports transcription. Inactivation of any of the group two sigma factors genes of S. elongatus PCC 7942 (rpoD2, rpoD2, rpoD4 and sigC) singly or pairwise alters circadian expression from the psbAI promoter, changing amplitude, phase angle, waveform or period. However, only the rpoD2 mutation and rpoD3rpoD4 and rpoD2rpoD3 double mutations affected expression from kaiB promoter. When sigC is inactivated we see a remarkable effect of a 2 h lengthening of circadian period of expression from the psbAI promoter, but not of that from kaiB or purF. These data suggest that searate timing circuits with different periods can be present in a cell. Both of the oscillations in a sigC strain are dependent on the period dictated by alleles of the kai genes. Taking advantage of different substrate specificities of the Luc and Lux luciferases, we have created dually-reporting strains in which the two reporters are driven by promoters that behave differently in the sigC mutant background. Bioluminescence from either Luc or Lux will depend on exogenous application of the appropriate substrate (luciferin or n-decanal, respectively). This way we have created S. elongatus strains AMC1114 and AMC1127, both bearing PkaiB::luc and PpsbAI::luxAB reporter systems, with sigC inactivated in AMC1127. Bioluminescence of these two strains was measured
by a cooled-CCD camera system from entrained cultures with the proper substrates added. The data collected show that it is possible to monitor two different periods simultaneously from the same strain, and that multiple timing circuits with different periods can be operating in S. elongatus cells. * Corresponding author Session IV Poster Presentation Abstracts 95 Role of kaiBC transcriptional timing in the circadian clock mechanism of Synechococcus elongatus PCC 7942 JAYNA L. DITTY1*, SHANNON R. CANALES2, and SUSAN S. GOLDEN2 Department of Biology, The University of St. Thomas, St. Paul, MN 55105 Department of Biology, Texas A&M University, College Station, TX 77843 Central to models for animal and fungal circadian clock timing is negative feedback loops involving clock genes that negatively regulate their own expression [1]. The single-celled cyanobacterium, Synechococcus elongatus PCC 7942, has a circadian pacemaker comprised of the products of at least three genes, kaiA, kaiB, and kaiC. The kai locus is expressed from two promoters, one upstream of kaiA (monocistronic message) and one upstream of kaiB (dicistronic kaiBC message), that are expressed in the same circadian phase in wild-type cells. Previous work has shown that KaiA is required for expression from the kaiBC promoter, and that overexpression of kaiA enhances expression from kaiBC, suggesting that KaiA is a positive activator of the kaiBC promoter. KaiC is required for normal levels of expression from its own promoter; however, overexpression of kaiC blocks expression from kaiBC, suggesting a role in negative autoregulation [2]. These data were interpreted to be consistent with the animal and fungal circadian timing models. However, mutants of S. elongatus have been identified that change the phase relationship between kaiA and kaiBC expression without disrupting circadian timing, suggesting that the relative transcriptional activity of expression from the kaiA and kaiBC promoters is not important for generating circadian rhythms [3, 4]. The role of transcriptional timing of the kaiBC gene locus for circadian timekeeping in S. elongatus was investigated. The natural transcriptional regulation of the kaiBC genes (peak expression at dusk) was by-passed by expressing the kaiBC dicistron from a heterologous promoter whose peak expression is 12 h out of phase from the norm (peak expression at dawn). Expressing kaiBC from this heterologous promoter showed no effect on the timing capabilities of the S. elongatus circadian clock, suggesting that the timing mechanism of the circadian clock in cyanobacteria may be based upon a post-transcriptional mechanism. 1. Harmer, S.L., S. Panda, and S.A. Kay, Molecular bases of circadian rhythms. Annu. Rev. Cell Dev. Biol., 2001. 17: p. 215-53. 2. Ishiura, M., et al., Expression of a gene cluster kaiABC as a circadian feedback process in cyanobacteria. Science, 1998. 281(5382): p. 1519-23. 3. Katayama, M., et al., cpmA, a gene involved in an output pathway of the cyanobacterial circadian system. J. Bacteriol., 1999. 181(11): p. 3516-24. 4. Nair, U., et al., Roles for sigma factors in global circadian regulation of the cyanobacterial genome. J. Bacteriol., 2002. 184(13): p. 3530-8. Session IV Poster Presentation Abstracts 96
Homotypic interactions of central oscillator components in the cyanobacterial circadian clock GUOGANG DONG, SUSAN S. GOLDEN* Department of Biology, Texas A&M University, College Station, TX 77843 The cyanobacteria are thus far the simplest organisms and the only prokaryote s known to sustain circadian rhythms. The unicellular strain Synechococcus elongatus PCC 7942 has been developed as a model organism in which to explore circadian mechanism. The products of three clustered genes kaiA, kaiB and kaiC are considered central oscillator components, as disruption of any of these genes abolishes the circadian rhythm. KaiA, KaiB and KaiC interact with one another in all possible combinations, as well as with themselves, to form higher order complexes. Both the heterotypic and homotypic interactions are believed to play critical roles in circadian timing. Interaction of KaiA with KaiC stimulates the autophosphorylation of KaiC, while the presence of KaiB antagonizes this effect. However, much less is known regarding the function of homotypic interactions of Kai proteins. In this study we employed a lambda repressor assay system that simplifies the identification and analysis of homotypic interactions. We made constructs by replacing the C-terminal (dimerization) domain of lambda repressor with either full-length or individual domains of Kai proteins and introduced them into Esherichia coli. Modified lambda phages that lack the repressor protein were cross-streaked over the recombinant E. coli. The phages will remain in the lysogenic state if the chimeric lambda repressor protein dimerizes and binds to the lambda operator; otherwise they will enter the lytic cycle and kill the recombinant E. coli cells. This technique provides both selection for homotypic interaction and counter-selection (with a different E. coli host) for conditional mutations that specifically disrupt such interactions. However, some proteins that are known to be involved in homotypic interactions, KaiA and KaiC, proved negative in the selection. Full-length KaiB, known to form homodimers and possibly tetramers, was positive in the selection. We are now developing the selection for temperature-sensitive mutations that specifically interrupt the homotypic interaction. KaiB is the smallest of the three Kai proteins, and its function is the least understood. This project will allow us to investigate how the circadian clock is affected when KaiB interactions are disrupted at different points in the circadian cycle. * Corresponding author. Email: sgolden@mail.bio.tamu.edu Session IV Poster Presentation Abstracts 97 Alterations in the gene expressions by the disruption of genes encoding phytochrome-related protein in Synechocystis sp. PCC 6803 MITSUNORI KATAYAMA1, MINORU KANEHISA2 and MASAHIKO IKEUCHI1 1 Department of Life Sciences (Biology), University of Tokyo, komaba 3-8-1, Meguro, Tokyo, 153-8902, Japan, 2Bioinformatics Center, Institute for Chemical Research, Kyoto University, Uji, Kyoto 611-0011, Japan As completion of the determination of genomic sequences, it has been revealed that genes encoding protein, which is structurally related to phytochrome of higher plant (phytochromerelated protein, Prp) widely distribute in various bacteria. Terrestrial cyanobacteria often possess multiple genes for Prp. For example, Synechocystis sp. PCC 6803 carries as many as nine candidates (sll0041, sll0821, sll1124, sll1473, slr0473, slr1212, slr1393, slr1805, slr1969). Among these, sll0041 and sll0821 are involved in phototactic motility. sll1124 is involved in growth under the blue light. In contrast to the phenotypic characterization, regulation of gene expression by Prp is largely unknown except RcaE of Fremyella diplosiphon, which is involved in the regulation of the transcription of cpcB2A2 and cpeBA during complementary chromatic
adaptation. To obtain information about regulation of gene expression by Prp in Synechocystis sp. PCC 6803, we compared gene expression patterns between wild type strain and prp disruptants using the technique of DNA microarray analysis. In consequence, we found out that inactivation of sll1473 and slr1212 caused prominent change in the expression level of several genes. Inactivation of sll1473 led to severe reduction of the expression of cpcG2 (sll1471) and the adjacent gene sll1472 under constant illumination. The transcript of cpcG2 was undetectable in the darkness and robustly induced by illumination of orange to red color of light. This induction was almost completely eliminated in the sll1473 disruptant suggesting that Slr1473 functions as a sensor that perceives light signal and activates the expression of cpcG2. Inactivation of slr1212 markedly reduced the accumulation of transcript of a series of genes including ftsH (slr0228 and slr1604), sds (slr0611) and hliA (ssl2542) in the darkness. Gene expression pattern in slr1212 disruptant was the same as wild type strain under constant illumination. It is suggested that Slr1212 is involved in the recognition of the absence of environmental light. On the other hand, some genes whose expression levels were altered by disruption of slr1212 have been also reported as high-light responsive gene. We are investigating the effect of disruption of slr1212 on gene expression patterns under high-light condition. Session IV Poster Presentation Abstracts 98 Activation of photosynthesis and resistance to photoinhibition in cyanobacteria within biological desert crust. YARIV HAREL, ITZHAK OHAD and AARON KAPLAN* Avron-Evenari Minerva Center of Photosynthesis Research, The Hebrew University of Jerusalem, Jerusalem, 91014, Israel. Filamentous cyanobacteria are the main primary producers in biological desert sand crusts. The cells are exposed to extreme environmental conditions including temperature, light and diurnal desiccation/rehydration cycles. We have studied the kinetics of activation of photosynthesis during rehydration of the cyanobacteria, primarily Microcoleus sp., within crust samples collected in the Negev desert, Israel. We also investigated their susceptibility to photoinhibition. Activation of the photosynthetic apparatus, measured by fluorescence kinetics, thermoluminescence and low temperature fluorescence emission spectra, did not require de novo protein synthesis. Over 50% of the PSII activity, assembled phycobilisomes and PSI antennae were detected within less than 5 min of rehydration. Energy transfer to PSII and PSI by the respective antennae was fully established within 10-20 min of rehydration. The activation of a fraction of PSII population (about 20-30%) was light and temperaturedependent but did not require electron flow to plastoquinone (was not inhibited by DCMU). The cyanobacteria within the crusts are remarkably resistant to photoinhibition in either the presence or absence of protein synthesis. The rate of PSII repair increased with light intensity and with time of exposure. Consequently, the rate of photosynthesis in high-light-exposed crusts reached a constant, relatively high, level. This is in contrast to model organisms such as Synechocystis sp. strain PCC 6803 where PSII activity declined continuously over the entire exposure to high illumination. Ability of the crusts organisms to rapidly activate photosynthesis upon rehydration and withstand photoinhibition under high light intensity may partly explain their ability to survive in this ecosystem. * Corresponding author Session V Poster Presentation Abstracts 99 Poster Presentations Session V Structural aspects
Session Chair: Cheryl Kerfeld, UCLA Session V Poster Presentation Abstracts 100 Photosystem I cyclic electron transfer pathways and function HANS C. P. MATTHIJS1*, NATALIYA YEREMENKO1, PEERADA PROMMEENATE2, WOLFGANG SCHIEFER3, ROBERT JEANJEAN4, PETER NIXON2 AND MICHEL HAVAUX5 1 Aquatic Microbiology, University of Amsterdam Institute for Biodiversity and Ecosystem Dynamics Nieuwe Achtergracht 127 Amsterdam 1018 WS the Netherlands 2 Dept. Biol. Sciences, Imperial College London Wolfson Laboratories South Kensington campus London United Kingdom 3 Lehrstuhl Biochemie der Pflanzen Gebude ND, Rm 3/133 Ruhr-Universitt Bochum Universittsstrae 150 Bochum D-44801 Germany 4 LCB-CNRS, 31 Chemin Joseph Aiguier Marseille Cedex 20 Marseille F-13402 France 5 CEA/Cadarache, DSV, DEVM Laboratoire dEcophysiologie de la Photosynthse UMR 163 CNRS CEA, Univ. Mditerrane-CEA 1000 Saint-Paul-lez-Durance 13108 France New results from gene array display prompted the design of a series of deletion mutants to clarify pathways and to evaluate the physiological significance of cyclic electron flow around Photosystem I in the cyanobacterium Synechocystis PCC 6803. Mutant characterization showed that products of the ORFs slr1208 and ssr 2016 (both till present known to encode so-called hypothetical proteins) were involved in cyclic electron flow in cyanobacteria and participate independently from the established constitutive NADH-dehydrogenase I, succinate dehydrogenease and the inducible ferredoxin:NADP+ mediated pathways. Both the slr1208 and ssr2016 knock-out mutants exhibited an antimycin A insensitive phenotype in Photosystem I (PS1) cyclic flow. This suggested the involvement of the gene products in the still poorly documented ferredoxin:quinone reductase mediated pathway. We studied a whole set of different knockout mutants with lesser pathways available and arrived at the conclusion that PSI cyclic electron flow attributed about 10% to the growth rate of cells incubated at optimal light intensity, and that the function of cyclic flow became more important at low light, with 20 to 30% reduction of the growth rate in the absence of PS1 cyclic flow and similar up to 70% at high light conditions. Mechanism and function of Photosystem I cyclic electron flow will be reviewed. * Corresponding author: E-mail: hansmatt@science.uva.nl Phone: +31205257070 Fax: +31205257064 Session V Poster Presentation Abstracts 101 In situ effects of mutations of the extrinsic cytochrome c550 of Photosystem II in Synechocystis sp. PCC6803 ZHAOLIANG LI1, HEATHER ANDREWS1, JULIAN J. EATON-RYE3 AND ROBERT L. BURNAP1* 1 Department of Microbiology and Molecular Genetics, Oklahoma State University, Stillwater, OK 74078; 3Department of Biochemistry, University of Otago, P.O. Box 56, Dunedin, New
Zealand The H2O oxidizing domain of the cyanobacterial photosystem II (PSII) complex contains a low potential, c-type cytochrome termed c550 that is essential for the in vivo stability of the PSII complex. A mutant lacking cytochrome c550 ( psbV) in Synechocystis sp. PCC 6803 has been further analyzed together with a construct in which the distal axial heme iron ligand, histidine 92, has been substituted with a methionine (C550-H92M). Heme staining of SDS-PAGE showed that the C550-H92M mutation did not disturb the accumulation and heme binding properties of the cytochrome. In psbV cells, the number of charge separating PSII centers was estimated to be 56% of the wild-type, but of the existing centers, 33% lacked photooxidizable Mn ions. C550-H92M did not discernibly affect the intrinsic PSII electron transfer kinetics compared to the wild type nor did it exhibit a significant fraction of centers lacking photooxidizable Mn, however, the number of charge separating PSII centers in mutant cells was 69% of the wild type. C550-H92M lost photoautotrophic growth ability in the absence of Ca2+, but its growth was not affected by depletion of Cl-, which differs from psbV. Taken together, the results suggest that in the absence of cytochrome c550, electron transfer on the donor side is retarded, perhaps at the level of Yz to P680+ transfer; the heme ligand, His92, is not absolutely required for assembly of functional PSII centers, however, replacement by methionine prevents normal accumulation of PSII centers in the thylakoid membranes and alters the Ca2+ requirement of PSII. The results are discussed in terms of current understanding of the Ca2+ site of PSII. Session V Poster Presentation Abstracts 102 Progress in sequencing, assembly and annotation of the genome of the marine unicellular cyanobacterium Synechococcus sp. PCC 7002 Tao Li1,4, Jrgen Marquardt1, Gaozhong Shen1, Christopher Nomura1, Sren Persson1, Chris Detter2, Christa Lanz3, Stephan Schuster3, Jindong Zhao4, and Donald A. Bryant1* 1 Department of Biochemistry and Molecular Biology, The Pennsylvania State University, University Park, PA 16802 USA; 2DOE Joint Genome Institute, 2800 Mitchell Drive, B400, Walnut Creek, CA 94598 USA; 3AG Genomics and Signal Transduction, Max-Planck-Institute for Developmental Biology, Spemannstrasse 35, 72076 Tbingen, Germany; 4College of Life Science, Peking University, Beijing, China The unicellular marine cyanobacterium Synechococcus sp. PCC 7002 has long served as a model organism for the genetic and biochemical characterization of genes involved in photosynthesis, respiration and biosynthetic pathways. The sequencing of the genome of this organism is now nearly complete. Primary sequence data were collected from a combination of 23,279 reads from whole-genome shotgun sequencing and about 1000 reads from targeted sequencing of cosmid and BAC libraries. After assembly, the connecting of >800 contigs was pursued through primer walking with templates from cosmid libraries and the sequencing of PCR products. Recently, paired-end sequencing of 1,536 fosmids with average inserts of 37.5 kb facilitated the scaffolding of the chromosome and the largest plasmids. The chromosome has been assembled into a single scaffold that contains one remaining physical gap and that presently includes ~3.0 Mb. Additionally, our data confirm the presence of five of the six plasmids identified by Roberts and Koths (1976): pAQ1 (4,809 bp), pAQ3 (16,073 bp), pAQ4 (32,035 bp), pAQ5 (38,516 bp), and pAQ6 (~115 kb). These sizes closely match the sizes measured by electron microscopy and gel electrophoresis: 4.6 kb, 15.9 kb, 31.0 kb. 38.6 kb, and 115.6 kb. We have shown that plasmid pAQ2 (~10 kb) is actually a dimer of pAQ1 and that trimers of pAQ1 also occur. Interestingly, our most recent assembly data suggest the existence of a sixth plasmid, which we have named pAQ7 (~125 kb). A preliminary annotation of the genome has been performed using TIGRs Annotation Engine for Prokaryotic Annotation and Analysis. The Synechococcus sp. PCC 7002
genome model encodes 3,498 ORFs; the coding percentage is 88% and the genome has a mol% G+C content of 49.6. Results of the preliminary analysis and some aspects of comparative genomics will be presented. Roberts TM and Koths KE 1976. The blue-green alga Agmenellum quadruplicatum contains covalently closed DNA circles. Cell 9:551-557. Session V Poster Presentation Abstracts 103 First fruits of the Synechococcus elongatus PCC 7942 functional genomics project C. KAY HOLTMAN, YOU CHEN, and SUSAN S. GOLDEN*, Department of Biology, Texas A&M University, College Station, TX 77843-3258 We are engaged in a functional genomics project that aims to inactivate each locus in the genome of Synechococcus elongatus PCC 7942 and assay the resulting mutants for defects in circadian rhythms. The goal is to identify all loci that contribute to the function of the circadian clock, while producing and archiving a genetic resource for the cyanobacterial community. S. elongatus PCC 7942 is the model organism for cyanobacterial circadian rhythms, which can be monitored as 24-h rhythms of bioluminescence produced by the circadian expression of luciferase reporter genes. Our approach is to isolate Mu or Tn5 insertions in cloned genomic DNA, determine the positions of insertions by nucleotide sequencing, and transfer the mutations to the chromosome in reporter strains by homologous recombination. Each mutant is then screened for defects in circadian rhythmicity. We have developed high throughput methods for both transformation and circadian screening. The Joint Genome Institute (JGI) has finished the complete S. elongatus genome sequence using plasmid and fosmid libraries. Integration of our insertion data with the JGI sequence has facilitated the functional genomics project by reducing our sequencing burden and revealing the specific clones to target to complete global mutagenesis. Among the first approximately 200 mutagenized loci we found mutants that exhibit an altered circadian phenotype. All previous insertions in kaiABC were found to cause an arrhythmic circadian phenotype; however, a Mu insertion that truncates kaiA exhibited a short period phenotype and has implications for protein-protein interactions of the clock. Mu insertions in genes that encode a putative response regulator and a heat shock protein have also been found that give altered circadian phenotypes. Insertions in genes clpP2 and clpX resulted in cells with a long circadian period. However, the phenotypes were detected in merodiploids, as the mutant alleles did not segregate, suggesting that the genes are essential. We have developed an antisense method that is effective for controlling expression of these essential genes, in which segments of the target gene are expressed in antisense from an IPTG-inducible promoter. Titration of antisense expression via IPTG concentration gives a range of phenotypes extending from no effect, through a phenocopy of the merodiploid inactivation phenotype, to loss of bioluminescence that we interpret as cell death. The methods, clones, and mutagenesis templates of the project will be important resources for the S. elongatus research community. *Author for correspondence; email: sgolden@mail.bio.tamu.edu Session V Poster Presentation Abstracts 104 Deletion of large chromosomal fragments of Anabaena sp. PCC 7120 with a Cre/loxP system YinZhang and Jindong Zhao, College of Life Sciences, Peking University, Beijing 100871, China jzhao@pku.edu.cn The Cre/loxP system has been widely used in gene manipulation of eukaryotic cells as
well as prokaryotic cells. It is based on the recombination system of bacteriophage P1 for site specific crossover. We have constructed a Cre/loxP system for manipulation of the genome of the heterocystous cyanobacterium Anabaena sp. PCC 7120. This system consists of two suicidal plasmids containing loxP sequence and a shuttle vector pRL25C containing the cre gene under control of the copper inducible petE promoter. To delete a fragment from the genome, the flanking regions of the target fragment were PCR-amplified and inserted into the suicidal plasmids. The suicidal plasmids were then transformed into Anabaena cells by conjugal transfer. Appropriate antibiotics selection allows site-specific insertion of the loxP sequence into the flanking regions of the target fragment. The shuttle vector pRL25C/cre is then transformed into the cells. In the presence of copper in growth medium, the expression of cre is induced, leading to specific deletion of the target fragment. This system has been tested for four fragments of different sizes: 1 kb (glnB), 2 kb (hetR), 10 kb (cpcBA operon) and 22 kb (unknown gene clusters). Our results show that this system could be used effectively for deleting both small and large fragments from the genome of Anabaena 7120. Other possible applications of this system in genetic manipulation of cyanobacterial genomes will be discussed. ParticipantAddressess 105 Poster Presentations Session VI Carbon metabolism Session Chair: Dean Price, Australian National University ParticipantAddressess 106 IDENTIFICATION OF A NEW CLASS OF BICARBONATE TRANSPORTER FROM THE MARINE CYANOBACTERIUM, SYNECHOCOCCUS PCC7002 PRICE, G.D., WOODGER, F.J., TUCKER, L., BADGER, M.R. and 1HOWITT, S.M. Molecular Plant Physiology, Research School of Biological Sciences, Australian National University, ACT, 0200, Canberra, Australia; 1. Biochem & Molec Biol, Science Faculty, ANU. In aquatic environments the CO2 supply rate for photosynthesis can be severely restricted, compared to terrestrial environments, and in order to maintain the efficiency of photosynthetic carbon fixation cyanobacteria have evolved an efficient mechanism for accumulation of inorganic carbon (Ci; CO2 & HCO3-,) known as a CO2 concentrating mechanism (CCM). This CCM involves the operation of active CO2 and HCO3- transporters and results in the concentration of CO2 around Rubisco in a unique microcompartment called the carboxysome. In freshwater strains of cyanobacteria there are two CO2 uptake systems and at least two HCO3- transporters employed to provide effective accumulation of Ci within the cell the genes involved have been identified. However, in marine cyanobacteria the physiological characteristics and genetic identification of Ci transporters are less well understood. We have used the marine cyanobacterium, Synechococcus PCC7002 as a model marine cyanobacterium to characterize the properties of HCO3- transporters. We have confirmed thorough gene disruptions, and gain-of-function analyses, that the sbtA homolog codes for a HCO3transporter, and significantly, we have identified a new HCO3- transporter, named bicA, that codes for a low affinity HCO3- transporter with a high flux property. Close homologs of bicA are present in the genome databases of all sequenced marine cyanobacteria. The potential importance of the BicA transporter in marine systems will be discussed.
ParticipantAddressess 107 Pleiotropic regulation of carbohydrate metabolism by Hik8 (a SasA orthologue) in Synechocystis 6803 ABHAY K SINGH AND LOUIS A SHERMAN* Department of Biological Sciences, Purdue University, West Lafayette, IN Organisms respond to changes in environmental pertubations by regulating the expression of genes that are crucial for growth and survival under stress conditions. Histidine kinases are often involved in sensing these pertubations and the transduction of signals to trigger the responses. We have used full genome microarrays of the cyanobacterium Synechocystis sp PCC 6803 to study the global gene expression in response to environmental stresses such as nutrient deficiency or oxidative stress (1). We have focused on one such histidine kinase (sll0750, Hik8) which is related to SasA of Synechococus sp PCC 7942 (2) and which was found to be differentially regulated under some stress conditions. A deletion mutant ( hik8) was analyzed for differential gene expression relative to the wild-type when grown photoautotrophically and after 1 h in the dark. Preliminary analysis of the microarray data indicated that two main functional categories were affected by the absence of hik8; (a) genes involved in carbohydrate metabolism; and (b) genes coding for ribosomal proteins, especially in dark-adapted hik8. Additionally, the cyanobacterial phytochrome (cph1) and its cognant response regulator (rcp1), which are cotranscribed in Synechocystis 6803, were also regulated by hik8. Northern blot analysis of genes encoding key enzymes of carbohydrate metabolism demonstrated that phosphofructokinase, glyceraldehyde 3 phosphate dehydrogenase, fructose bisphosphate aldolase, glucose 6 phosphate dehydrogenase, 6 phosphogluconate dehydrogenase, phosphoenolpyruvate synthase, ADPglucose pyrophosphorylase and glycogen phosphorylase were differentially regulated in hik8 grown in the presence or absence of glucose. In some cases, differential expression was dependent on growth conditions (photoautotrophic vs. photoheterotrophic). The hik8 strain was conditionally lethal; it had a comparable doubling time to wild-type in photoautotrophic and photoheterotrophic growth conditions in continuous light, whereas it grew poorly compared to the wild-type under photoheterotrophic conditions with different light and dark cycles. Growth was completely stopped and cells eventually died when the light duration was less than 6 h on a 24-h regime. The determination of glycogen content indicated that hik8 strain had the ability to accumulate glycogen, but was unable to properly utilize these reserves for growth. Enzyme activities of G6PDH, 6PGDH and PFK was significantly reduced in hik8 compared to WT. In contrast, there was no change in activity of G3PDH. These results suggest that the conditionallethal phenotype of hik8 is due to the inability to metabolize glucose for generation of reducing power and substrates for biosynthesis. The results demonstrated that Hik8 has a pleiotropic control of genes involved in central carbohydrate metabolism. 1. Singh AK, McIntyre LM, Sherman LA.2003. Plant Physiol. 132:1825-1839. 2. Iwasaki H, Williams SB, Kitayama Y, Ishiura M, Golden SS, Kondo T. 2000. Cell. 101:223-233. ParticipantAddressess 108 Towards resolving the Glucose sensing in Synechocystis PCC 6803 1 KAHLON, S., 1BEERI K., 2OHKAWA, H., 1MURIK, O., 3HIHARA, Y., 4OGAWA, T., 5SUZUKI, I. and A. KAPLAN1* 1 Dept. Plant and Environmental Sciences, The Hebrew University of Jerusalem, Israel 2 Dept. Biology, Washington University, St. Louis, USA.
3 Dept. Biochemistry and Molecular Biology, Saitama University, Japan 4 Bioscience Center, Nagoya University, Japan 5 National Institute for Basic Biology, Okazaki, Japan There is a large diversity among cyanobacteria with respect to carbon nutrition. While some are obligate photoautotrophs others can switch between photoautotrophic, photomixotrophic and heterotrophic modes of metabolism. Glucose sensitive and tolerant strains of Synechocystis PCC 6803 are available but little is known about the regulation between photoautotrophic and photomixotrophic growth. Inactivation of both genomic and plasmid copies of sll0790 (encoding Hik31) in Synechocystis PCC 6803 resulted in a mutant unable to grow in the presence of D-glucose. The extent of glucose-dependent death of hik31 was affected by the light intensity and ambient CO2 level. We are investigating the role of Hik31 in the acclimation of Synechocystis PCC 6803 to photomixotrophic growth by additional mutations and analysis of glucose-related processes and transcript levels in the wild type and the mutants. Inactivation of the glucose transporter in hik31 rescued the cells indicating that the glucose signal is sensed inside the cells or that the transporter, as in certain eukaryotic cells, mediates the signal. The glucose sensitive (PCC) and hik31 strains do not show glucokinase activity suggesting inability to convert glucose to glucose 6-phosphate. The levels and activities of glucose 6-phosphate dehydrogenase and 6-phosphogluconate dehydrogenase increased significantly in WT cells exposed to glucose but were constitutively high in hik31 cells regardless of the presence of glucose. A 105 kDa protein, the nature of which is not known but which is recognized by a G6PD antibody, is present in WT but not in hik31. We propose that Hik31 is involved in the regulation between photoautotrophic and photomixotrophic growth of Synechocystis 6803. * Corresponding author ParticipantAddressess 109 A proteomic study of carboxysomes from -cyanobacteria BEN M. LONG, G. DEAN PRICE & MURRAY R. BADGER* Molecular Plant Physiology Group, Research School of Biological Sciences, Australian National University, PO Box 475, Canberra ACT 2601. Carboxysomes are protein-bound, polyhedral structures within cyanobacteria, containing the key enzyme for photosynthetic CO2-fixation, namely Rubisco. Sequencing of cyanobacterial genomes has revealed that cyanobacteria possess one, or other, of two types of carboxysomes. Cyanobacteria containing Form-1A Rubisco (e.g. Prochlorococcus marinus MED4) possess carboxysomes, while those with Form-1B Rubisco possess -carboxysomes (e.g. Synechococcus PCC7942). Given the central importance of carboxysomes in the CO2 concentrating mechanism (CCM) of cyanobacteria, understanding the nature and composition of these structures is of considerable importance. In an effort to characterise the structure of -carboxysomes, particularly the outer protein shell, we have undertaken a proteomic analysis of these structures from the freshwater cyanobacterium Synechococcus sp. PCC7942. Both MALDI-TOF analysis of excised SDS-PAGE bands and MudPIT analysis of complex mixtures of digested proteins have been used in an attempt to identify the proteins constituting -carboxysomes. We report here some preliminary data on the identity of proteins associated with carboxysomes from Synechococcus sp. PCC7942. * Corresponding author ParticipantAddressess 110
Global patterns of gene expression in Synechocystis sp. PCC 6803 in response to inorganic carbon limitation and the inactivation of ccmR, a LysR family regulator HONG-LIANG WANG, BRADLEY L. POSTIER and ROBERT L. BURNAP* Department of Microbiology & Molecular Genetics, 307 Life Sciences East, Oklahoma State University, Stillwater, OK 74075 The cyanobacterium Synechocystis sp. PCC 6803 possesses multiple inorganic carbon (Ci) uptake systems that are regulated according to Ci availability in the environment. The control mechanisms of these systems and their integration with other cell functions remain to be clarified. Full genome microarrays and RT-PCR techniques were used to analyze the changes in global gene expression in response to Ci downshift and the inactivation of ccmR (sll1594, formerly, ndhR), a LysR family regulator of Ci uptake. A relatively mild Ci-limitation [3% CO2 (v/v) in air to air alone] induced a dramatic up-regulation of genes encoding both inducible CO2 and HCO3- uptake systems in the cyanobacterial cells grown in Na2CO3-free BG-11 medium buffered at pH 7.0. The expression of slr1513 (designated sbtB, more recently) and sll1735, physically clustered with sbtA and ndhF3/ndhD3/cupA, respectively, were also coordinated with their upstream genes encoding the essential components for HCO3- and CO2 uptakes. Analyses of RT-PCR and DNA microarray hybridization revealed the expression of ndhD5/ndhD6, physically forming a probable transcriptional unit with downstream genes with homologies to antiporter proteins. This leads us to propose that these genes encode in sodium efflux system, driven by redox energy and used to drive the sodium dependent bicarbonate uptake transporter, SbtA, identified by Ogawa. An opposite regulation of the acquisition and thence assimilation of carbon and nitrogen occurred, demonstrating a striking expression coordination of relevant genes and operons. Based on the analyses of RT-PCR and DNA microarray hybridization, ndhR inactivation up-regulated the expressions of sbtA/sbtB, ndhF3/ndhD3/cupA/sll1735 and slr200613 including ndhD5 and ndhD6, indicating a vital role of the regulatory gene in both CO2 and HCO3-. Based upon the current information, we suggest that ndhR is renamed ccmR to better represent its broader regulatory characteristics and that the regulated genes encode an integrated system of proteins operating to concentrate inorganic carbon using redox energy transduced by Type I dehydrogenases directly as with the CUP subsystem or indirectly via a sodium gradient generated by the NdhD5/NdhD6 subsystem. * Corresponding author Participant List Printed 8/12/2004 Title: Number: Subtitle:Area: 561059 F2005Schedule #: Term: CALS Meeting Dates: 8th Cyanobacterial Molecular Biology Workshop August 24 - 29, 2004 172 00 Section:1 Work PhoneName Title Company City, State Work Email (781)283-3068Allen, Mary Prof Wellesley College Wellesley, MA mallen@wellesley.edu 49 431 880 4237Appel, Jens Kiel, Germany 49 4318504Backasch, Ninja Botanical Institute Kiel, Germany nbackasch@bot.uni-Kiel.de 61 2 61253741Badger, Murray Prof The Australian National University Canberra City, Australia
murray.badger@anu.edu.au (419)372-4890Baranova, Maria Grad Student Bowling Green State University Bowling Green, OH bmaria@bgnet.bgsu.edu (419)494-1445Boyanapalli, Ramakrishna Grad Student Bowling Green State University Bowling Green, OH rboyana@bgnet.bgsu.edu (780)492-1805Brown, Jessica Grad Student University of Alberta Edmonton, AB Canada jmb5@ualberta.ca (419)372-8527Bullerjahn, George Bowling Green State University Bowling Green, OH bullerj@bgnet.bgsu.edu 43 14277 52810Burey, Suzanne Vienna, Austria suzanne.burey@univie.ac.at (405)744-7445Burnap, Robert Oklahoma State University Stillwater, O burnap@biochem.okstate.edu 33 144 323534Cadoret, Jean C. Ecole Normale Superieure Paris, France cadoret@biologie.ens.fr (979)845-9821Canales, Shannon Texas A & M University College Station, TX smackey@mail.bio.tamu.edu Cann, Martin Durham, UnitedKingdom m.j.cann@durham.ac.uk (865)974-4014Carberry, Matthew University of Tennessee Knoxville, TN matthewc@charter.net 44 0113 3435651Chapman, Karen E. Mrs University of Leeds Leeds, United Kingdom mic6kec@leeds.ac.uk (979)845-9821Chen, You Texas A&M University College Station, TX ychen@mail.bio.tamu.edu (979)845-9821Clerico, Eugenia Texas A & M University College Station, TX eclerico@mail.bio.tamu.edu (415)422-6450Cobley, John Prof University of San Francisco San Francisco, CA cobley@usfca.edu (301)405-1035Cunningham, Jr., Francis X. University of Maryland College Park, MD fc18@umail.umd.edu (919)515-5747Curtis, Stephanie NC State Raleigh, NC securtis@ncsu.edu (651)962-5245Ditty, Jayna Assistant Professor University of St. Thomas St. Paul, MN jlditty@stthomas.edu (979)845-9821Dong, Guogang Grad Student Texas A&M University College Station, TX gdong@mail.bio.tamu.edu (804)828-0794Elhai, Jeff VCU Richmond, VA ElhaiJ@VCU.Edu (517)353-6641Fan, Qing Post Research Assoc Michigan State University East Lansing, MI FANQ@MSU.EDU 349-1497Ext. 8176Fernandez-Pinas, Francisca Dr. Universidad Autonoma de Madrid MADRID, Spain francisca.pina@uam.es 49 641 9935545Forchhammer, Karl Professor University Giessen Giessen, Germany karl.forchhammer@mikro,bio,uni-giessen.de (480)965-9028Fromme, Petra Prof. Dr. Arizona State University Tempe, AZ pfromme@asu.edu 81 52 7894105Fujita, Yuichi Assistant Professor Nagoya University Nagoya, Japan fujita@agr.nagoyau.ac.jp Page 1 of 3 regr44aForm Modified: 5/212003 Participant List Printed 8/12/2004 Work PhoneName Title Company City, State Work Email (612)625-4275Gleason, Florence Professor University of MInnesota Saint Paul, MN florence@cbs.umn.edu (979)845-9823Golden, James Professor Texas A&M University College Station, TX jgolden@tamu.edu (979)845-9824Golden, Susan Prof Texas A&M University College Station, TX sgolden@tamu.edu 44 07966 966 292Graham, Douglas PhD Student The Robert Gordon University Aberdeen,
UnitedKingdom ps.graham-s@rgu.ac.uk 49 431 8804237Gutekunst, Kirstin Kiel, Germany 49 3814986Hagemann, Martin Dr. Universtiy Rostock Rostock, D Germany martin.hagemann@biologie.uni-rostock.de (773)702-1069Haselkorn, Robert Dist. Serv. Prof Mol. Genetics & Cell BIol., U of Chi Chicago, IL rh01@uchicago.edu 81 48 8583396Hihara, Yukako Dr Saitama University Saitama, Japan hihara@molbiol.saitama-u.ac.jp (979)845-4388Holtman, Carolyn K. Assistant Reserach Scientist Texas A&M University College Station, TX choltman@mail.bio.tamu.edu (920)424-7084Horn, Darryl University of Wisconsin Oshkosh Oshkosh, WI hornd27@uwosh.edu 33 144 323519Houmard, Jean Dr Ecole Normale Superieure Paris, France jhoumard@biologie.ens.fr (979)845-9821Ivleva, Natalia Texas A & M University College Station, TX nIvleva@mail.bio.tamn.edu 33 49 1164298Jeanjean, Robert Marseille, France jeanjean@ibsm.cnrs-mrs.fr (920)424-7084Kallas, Toivo Prof University of Wisconsin-Oshkosh Oshkosh, WI kallas@uwosh.edu 972 2658523Kaplan, Aaron Jerusalem, Israel aaronka@vms.huji.ac.il (817)938-6823Ext. Kappell, Anthony Grad Student Univ. of Texas at Arlington Arlington, TX akappell@uta.edu 81 5454 6647Katayama, Mitsunori Assistant Prof Department of LIfe Sciences Meguro, Japan katayama@bio.c.u-tokyo.ac.jp (540)231-4317Kennelly, Peter Professor Virginia Tech Blacksburg, VA pjkennel@vt.edu (310)825-7417Kerfeld, Cheryl UCLA Los Angeles, CA kerfeld@mbi.ucla.edu 34 205 257070Krasikov, Vladimir V. Msc. University of Amsterdam Amsterdam,Netherlands krasikov@science.uva.nl (480)965-3698Kufryk, Galyna Arizona State University Tempe, AZ galyna.kufryk@asu.edu (517)353-6641Lechno-Yossef, Sigal Michigan State University East Lansing, MI 349-1497Ext. 8176Leganes, Francisco Dr. Universidad Autonoma de Madrid MADRID, Spain francisco.leganes@uam.es (517)353-6641Liu, Jinjie MIchigan State University East Lansing, MI 61 261 254213Long, Ben Dr Australian National University Canberra, Australia Ben.Long@anu.edu.au 34 965 909587Luque, Ignacio Dr Universidad de Alicante Alicante, Spain ignacio.luque@ua.es 49 641 9935554Mani, Maheswaran Mr IMMB Giessen, Germany maheswara.mani@bio.uni-giessen.de (530)752-7769Martin, Miriam Post-Doc Researcher Universtiy fo California-Davis Davis, CA memartin@ucdavis.edu 31 205 257070Matthijs, Hans University of Amsterdam Amsterdam,Netherlands hansmatt@science.uva.nl (419)372-8550McLean, Debra Admin Assist BGSU Bowling Green, OH dmclean@bgnet.bgsu.edu (530)752-3346Meeks, Jack Prof University of California Davis, CA jcmeeks@ucdavis.edu Page 2 of 3 regr44aForm Modified: 5/212003 Participant List Printed 8/12/2004 Work PhoneName Title Company City, State Work Email (540)231-3062Mukhopadhyay, Archana Virginia Tech Blacksburg, VA amukhopa@vt.edu (709)737-8529Mulligan, Martin Memorial University of Newfoundland St. John's, NL Canada mulligan@mun.ca 81 48 8583396Muramatsu, Masayuki University of Tokyo Saitama, Japan kk47518@mail.ecc.tokyo.ac.jp 34 954 489578Muro-Pastor, Alicia CSIC-University of Sevilla Sevilla, Spain alicia@ibvf.csic.es
81 52 789 2963Nakajima, Masato Division of BiologicalScience Nagoya University Nagoya, Japan mnakaj@biol1.bio.nagoya-u.ac.jp 81 29 888 8649Nishizawa, Akito Ibaraki University Inashiki Ami, Japan ZAN01240@nifty.ne.jp 49 234 3223633Nowaczyk, Marc Dipl. Biol. Ruhr-University Bochum Bochum, Germany marc.m.nowaczyk@rub.de (780)492-1803Owttrim, George Associate Professor University of Alberta Edmonton, AB Canada g.owttrim@ualberta.ca (780)492-1805Ext. Patterson-Foctin, Laura Grad Student University of Alberta Edmonton, AB Canada laurap@ualberta.ca 43 1427752Peschek, Gunter A. Professor University of Vienna Vienna, Austria guenter.peschek@univie.ac.at 61 281 258423Price, G Dean Dr Australian National University Acton-Canberra,Australia Dean.Price@anu.edu.au (919)515-5730Ramirez, Martha Researcher NC State Raleigh, NC meramir2@unity.ncsu.edu 54 223 4748257Salerno, Graciela Dr FIBA Mar del Plata,Argentina gsalerno@fiba.org.ar (504)280-7194Ext. Schluchter, Wendy Assistant Professor University of New Orleans New Orleans, LA wschluch@uno.edu 43 1 4277 52548Schmetterer, Georg Prof. Inst. Physical Chemistry, Vienna Univers Vienna, Austria georg.schmetterer@univie.ac.at 972 3 531 7790Schwarz, Rakefet Ramat-Gan, Israel schwarr2@mail.biu.ac.il (781)283-3068Shea, Katherine Wellesley College Wellesley, MA kshea@wellesley.edu (814)863-7405Shen, Gaozhong Dr Penn State University Park, PA gxs22@psu.edu (765)494-8106Sherman, Louis Professor Purdue University West Lafayette, IN Isherman@purdue.edu 81 29 888 8652Shirai, Makoto Dr Ibaraki Univ. Inashiki, Japan shirai@mx.ibaraki.ac.jp Six, Christopher PhD Student Station Biologique de Roscoff Roscoff, ZZ France 81 28 888 8649Sousuke, Imamura Ibaraki University Inashiki Ami, Japan ad2201s@acs.ibaraki.ac.jp (818)677-7146Summers, Michael California State University Northride Northridge, CA michael.l.sumers@csun.edu 81 52 7892495Terauchi, Kazuki Dr Nagoya University Nagoya, Japan terauchi@bio.nagoya-u.ac.jp (919)515-5730Thayer, Rebecca Grad Student North Carolina State University Raleigh, NC r_thayer@bellsouth.net (314)516-6208Thiel, Teresa Dr St. Louis, MO theil@umsl.edu 81 46 8679781Tomitani, Akiko Dr University of Leeds Yokosuka, Japan akiko_tomitani@hotmail.com (517)353-2049Ext. 51735391Wolk, C. Peter Professor Michigan State University E. Lansing, MI wolk@msu.edu 61 261 254213Woodger, Fiona Dr Australian National University Canberra, Australia Fiona.Woodger@anu.edu.au (615)343-1350Xu, Yao REs. Assist. Prof. Vanderbilt University Nashville, TN yao.xu@vanderbilt.edu 34 205 257070Yeremenko, Nataliya Msc. University of Amsterdam Amsterdam,Netherlands eremenko@science.uva.nl Page 3 of 3 regr44aForm Modified: 5/212003 Newer Posts Older Posts Home Developments in Fungal Taxonomy GENERAL CONCLUSIONS Fungal systematics is still based mainly on morphological criteria, and pathogenic fungi are usually recognized and identified basically by their phenotypes. Numerous alternative approaches have been developed,
including nutritional and physiological studies, serologic tests, secondary metabolites, ubiquinone systems, and fatty acids. Although some of these are very useful for identifying poorly differentiated fungi such as yeasts and black yeasts, they are only complementary tools of morphological data in most cases. Molecular biology techniques, especially the analysis of rRNA sequences, are currently used for reliable phylogenetic studies, which enable a more natural classification system to be established. However, despite the effective application of these techniques in PCRmediated identification systems, they are not yet currently available in the routine clinical mycology environment. The constant discovery of new emerging mycotic agents in different clinical settings that often affect critically ill patients increases the need for the development of rapid and accurate identification systems, since delay in the diagnosis and initiation of therapy leads to a high mortality rate. On the other hand, if the isolates described in a report are discarded after a study finishes, the etiological data cannot then be checked in any further investigations (119). Therefore, contemporary practitioners and laboratorians should contact expert mycologists to identify the clinical isolates correctly and should deposit the strains in a reference culture collection. Most of these isolates must be reidentified by modern methods for a critical evaluation of the clinical cases. The problem of numerous undescribed species, together with the superficial level of knowledge that we have even for the fungi which have names, argues for a much greater emphasis on fungal biosystematics in the future. More attention to medical mycology and increased funding for training of medical mycologists are critical to address the current threats from new and reemerging fungal infections. **** TmPrime/ Agrocybe Pediades Awesome Inc. template. Powered by Blogger.
(1)"While environmental SERRATIA MARCESCENS strains are often red, due to the production of prodigiosin, the strains associated with hospital outbreaks are mostly non-pigmented." "NEUROSPORA CRASSA" is a pinkish to red mold but is not as common and is generally lighter in color then Serratia marcescens." "NEUROSPORA CRASSA" , is a central organism in the history of twentieth-century genetics, biochemistry and molecular biology.
Archived Article/ March 26, 2010 (Atlanta, Georgia) March 26, 2010 (Atlanta, Georgia) Nasal application of 2% mupirocin and bleach baths were found to be more effective at eradicating Staphylococcus aureus colonization than other interventions, according to the findings of a randomized trial.
Serratia Marcescens.(SM) Synonomy: Chromobacter prodigiosus, Bacterium prodigiosus, Micrococcus prodigiosus, Serratia marcescens Bizio, Zaogalactina imetropha Sette, Monas prodigiosa Ehrenberg, Palmella prodigiosa Montagne, Micrococcus prodigiosus Cohn, Bacillus prodigiosus Fluegge, Bacillus
imetrophus Trevisan, Bacillus marcescens De Toni and Trevisan, "Serratia marcescens, previously called Chromobacterium prodigiosum" **** American Society for Microbiology / Infection and Immunology / Serratia **** Biotyping of Serratia marcescens and its use in epidemiological studies. **** HEALTH EFFECTS OF PROJECT SHAD BIOLOGICAL AGENT: SERRATIA MARCESCENS **** KARGER **** Biofilm Formation and Sloughing in Serratia marcescens **** J.P. Euzby: List of Prokaryotic names with Standing in Nomenclature - Genus Serratia **** ION CHANNEL **** LABOME.org **** NCBI / Entry/ Serratia **** DSMZ **** Hopkins/ Serratia species **** DOE Genome Projects (06-Oct-2010) **** phage (wIF3) **** phiIF3 Serratia marcescens/ putative reference strain Db11
NO MERCY FOR MRSA / TREATMENT ALTERNATIVES/ Adjunctive Use Rifampin **** NO MERCY FOR MRSA: treatment alternatives to vancomycin and linezolid **** Adjunctive use of rifampin for the treatment of Staphylococcus aureus infections: a systematic review of the literature MRSA/ GREEN TEA/ Epigallocatechin Gallate **** Green Tea to fight MRSA? **** Additive, indifferent and antagonistic effects in combinations of epigallocatechin gallate with 12 non--lactam antibiotics against methicillin-resistant Staphylococcus aureus **** Mechanism of Synergy between Epigallocatechin Gallate and -Lactams against MethicillinResistant Staphylococcus aureus **** The Effect of Green Tea on the Growth and Morphology of Methicillin-resistant and Methicillinsusceptible Staphylococcus aureus CA-MRSA/ MRSA/ MSSA **** JAMA **** Genetic transfer in Staphylococcus: a case study of 13 genomes **** Use of Oligoarrays for Characterization of Community-Onset Methicillin-Resistant Staphylococcus aureus
**** Genetic Changes That Correlate with Reduced Suceptibility to Daptomycin in Staphylococcus aureus **** Heterogeneity of Methicillin-Susceptible Staphylococcus aureus Strains at a German University Hospital Implicates the Circulating-Strain Pool as a Potential Source of Emerging Methicillin-Resistant S. aureus Clones **** Laborotory Detection of Extended-Spectrum B-Lactamases (ESBLs) **** Community-acquired methicillin-resistant Staphylococcus aureus carrying Panton-Valentine leukocidin genes: WORLDWIDE EMERGENGE. **** Professional Report/ OCTENISAN **** Susceptibility of MRSA to octenidine dihydrochloride **** Studies on the Efficacy of Octenidine Dihydrochloride and Octenisan
Your Insect Bite Might be Staph! **** Hospitalizations and Deaths Caused by Methicillin-Resistant Staphylococcus aureus, United States, 19992005 **** Subtle genetic changes enhance virulence of methicillin resistant and sensitive Staphylococcus aureus **** Powerful strains of MRSA are beginning to break out of hospitals into the community. **** Community-associated MRSA: Superbug at our doorstep **** "As amoeba produce cysts to help them spread, this could mean that MRSA maybe able to be 'blown in the wind' between different locations" "This makes matters even more worrying," WHITE HOUSE CUT TESTIMONY **** NEW YORK TIMES / Infection Killed Almost 19,000 in 2005, Study Says **** REDIRECTED / CNN / Sources: White House cut testimony / "It was eviscerated", said a CDC official, familiar with both versions, who spoke on condition of anonymity because of the sensitive nature of the review process. **** Dermatology Times / April 01, 2002/ CDC downplays "mystery rash" link **** AP / 09/17/07/ Mysterious outbreak at Houston school scares parents, teachers **** MIT / TECHNOLOGY REVIEW / Biotechnologys advance could give malefactors the ability to manipulate life processes -- and even affect human behavior. **** WATCH VIDEO! CYANOBACTERIA **** WATCH VIDEO! BROWN ALGAE (PHAEOPHYCEAE = PLEOSPORALES = PHOMA SP.) **** WATCH VIDEO! ASCOMYCETES (Origin on microalgae and cyanobacteria. Very probable) **** WATCH VIDEO! SLIME MOLD/ A Model to Investigate Cytoplasmic Actomyosin **** WATCH VIDEO! MOLECULAR EXPRESSIONS/ CYANOBACTERIUM / BLUE GREEN ALGAE/ Phormidium (Algae) Movies **** WATCH VIDEO! CYANOBACTERIA PHORMIDIUM **** WATCH VIDEO! RESEARCH CHANNEL / BIOLOGY IS NANOTECHNOLOGY **** WATCH VIDEO! EUGLENA / THE EUGLENOID PROJECT Algae **** INVENTAIRE DES ALGUES DE ROSCOFF **** ALGAE INDEX / IMAGE SOURCE / FACULTADES DE CIENCIAS Y FARMACIA / UNIVERSIDAD DE NAVARRA **** UNIVERSITY OF BERKELY / CENTER FOR PHYCOLOGICAL DOCUMENTATION **** VISUALS UNLIMITED (exellent image database)
**** Molecular detection of ascomycetes associated with Fucus serratus/ 1 **** Molecular detection of ascomycetes associated with Fucus serratus/ 2 **** Thornber Lab/ University of Rhode Island **** UTEX / UNIVERSITY OF TEXAS / ALGAE COLLECTION / **** PROTIST INFORMATION CENTER (IMAGE/VIDEO DATABASE) **** Twisted Bacteria FUSARIUM **** USDA / The Fusarium International Genomics Initiative **** Fusarium-mitochondria citations **** FUSARIUM: A SIGNIFICANT EMERGING PATHOGEN **** FUSARIUM / PLEOSPORA MYCO TOXINS **** Pathogenic Fungi Database (PFDB) **** CYBERNOME **** CBMG **** BIOTA TAIWANICA **** UFRGS **** Linear mitochondrial plasmids of Fusarium oxysporum contain genes with sequence similarity to genes encoding a reverse transcriptase from Neurospora spp. **** Endophthalmitis Caused by Fusarium proliferatum **** BJ SIGNAL **** BJ ENERGY / EUGLENA / Maturation of the unusual single-cysteine (XXXCH) mitochondrial c-type cytochromes found in trypanosomatids must occur through a novel biogenesis pathway **** PROTIST INFORMATION SERVER **** INDEX EUGLENA **** The mitochondrial genome of Euglena gracilis. **** FungalGenomics **** MYCONET / 4324. Ascomycota / 4. Origin on microalgae and cyanobacteria. - Very probable. **** MYCONET / 3318. Pleosporales Luttrell ex M.E. / Notes on ascomycete systematics **** DOE FUNGAL GENOMICS PROJECT **** MYCOLEGIUM **** Revista do Instituto de Medicina Tropical de So Paulo / Pheohyphomycosis; Phoma cava; Subcutaneous mycosis **** CYANOBACTERIA/ Great Lakes Water Life / GENUS Coelosphaerium **** GEOFUNGI / BOTANICA COMPLUTENSIS / Nr. 25, 2001 **** GLOSSARY/ MYCOLOGY BIOFILM **** INDEX ARTICLES / Extracellular DNA Required for Bacterial Biofilm Formation **** GENETICS OF BIOFILMS LABORATORY **** Genetic Identification of the Main Opportunistic Mucorales **** Azithromycin Blocks Quorum Sensing and Alginate Polymer Formation and Increases the Sensitivity to Serum and Stationary-Growth-Phase Killing of Pseudomonas aeruginosa and Attenuates Chronic P. aeruginosa Lung Infection in Cftr **** Lateral Gene Transfer and Cyanobacterial Toxicity **** FUNGAL GENOMICS STOCK CENTER NEW FOR 2010: Mystery disease blights Afghan opium poppies
**** Risks of Using Biological Agents to Eradicate Drug Plants **** Mystery disease blights Afghan opium poppies **** REUTERS: Mystery disease blights Afghan opium poppy crop **** New York Times: Mysterious Blight Destroys Afghan Poppy Harvest **** Poppy disease halves Afghan opium crop **** Fungus Hits Afghan Poppies **** First Report of Downy Mildew of Opium Poppy Caused by Peronospora arborescens in Spain BIO-CONTROL **** EEUU Admite posible vnculo entre Armas Biolgicas y Agente Verde **** FIRST FIND OF YEAST LIKE CELL **** Risks of Using Biological Agents to Eradicate Drug Plants **** Molecular Identification of Fusarium Species in Onychomycoses **** Endophthalmitis Caused by Fusarium proliferatum **** Clinical and Epidemiological Aspects of Infections Caused by Fusarium Species: a Collaborative Study from Israel **** Disseminated hyalohyphomycosis caused by a novel human pathogen, Fusarium napiforme. BIO-CONTROL / AGENT GREEN / SUNSHINE PROJECT/ PROJECT BACHUS **** THE SUNSHINE PROJECT **** THE SUNSHINE PROJECT/ GERMAN WEBSITE **** ISR / PROJECT BACHUS / BIOLOGICAL WEAPONS PRODUCTION **** Risks of Using Biological Agents to Eradicate Drug Plants **** USA Admits Possible Link between Biological Weapons and Agent Green **** Biowarfare in the Andes / The labs are brewing up two types of killer fungi, Fusarium oxysporum (for use against marijuana and coca plants) and Pleospora papaveracea (to destroy opium poppies). American Phytopathological Society BIO-CONTROL / PROJECT CLEAR VISION **** THE NEW YORK TIMES **** PROJECT CLEAR VISION / U.S. Germ Warfare Research Pushes Treaty Limits **** Useful Mutants, Bred With Radiation NOSTOCOIDA / TETRASPHAERA / AVIAN VACUOLAR MYELINOPATHY / BALD EAGLE DEMISE NOSTOCOIDA LIMICOLA **** A mysterious brain disease is killing birds, It is believed that a man-made... **** INVESTIGATION OF A NOVEL EPIPHYTIC CYANOBACTERIUM ASSOCIATED WITH RESERVOIRS AFFECTED BY AVIAN VACUOLAR MYELINOPATHY **** Isolates of Candidatus Nostocoida limicola Blackall et al. 2000 should be described as three novel species of the genus Tetrasphaera, as Tetrasphaera jenkinsii sp. nov., Tetrasphaera vanveenii sp. nov. and Tetrasphaera veronensis sp. nov. **** 'Candidatus Nostocoida limicola', a filamentous bacterium from activated sludge. KEY ARTICLE: RECREATIONAL AND OCCUPATIONAL FIELD EXPOSURE TO FRESHWATER CYANOBACTERIA / Ian Stewart **** Recreational and occupational field exposure to freshwater cyanobacteria a review of anecdotal and case reports, epidemiological studies and the challenges for epidemiologic assessment KEY ARTICLE: ECOPHYSIOLOGY OF MARINE CYANOBACTERIAL BLOOMS MICROCYSTIN-LR / FAST DEATH FACTOR The microcystins are hepatotoxic products of freshwater blooms of cyanobacteria of Microcystis spp.,
M. aeruginosa in particular. Microcystin-LR, also known as the fast death factor, is the most common of the microcystins and presumably the toxin of choice to be weaponized. Although the aerosolized form of microcystin is the most likely threat, ingestion - even from natural sources - must be considered a significant hazard. MICROCYSTIS-LR / PATHOGENICITY **** Freshwater cyanobacterium Microcystis aeruginosa (UTEX 2385) induced DNA damage in vivo and in vitro **** Microcystin-LR induces oxidative DNA damage in human hepatoma cell line HepG2. **** The Gas Vesicle Gene Cluster from Microcystis aeruginosa and DNA Rearrangements That Lead to Loss of Cell Buoyancy **** Allergenic (sensitization, skin and eye irritation) effects of freshwater cyanobacteria experimental evidence SAN-FRANCISCO The first distribution, biomass and toxocity study of a newly established bloom of the colonial cyanobacteria Microcystis aeruginosa was conducted on October 15, 2003, in the upper San Francisco Bay Estuary. Mycrocystis aeruginosa was widely distributed throughout 180 km of waterways in the upper San Francisco Bay Estuary from freshwater to brackish water environments and contained hepatotoxic microcystins at all stations. CYANO **** The first distribution, biomass and toxicity study of a newly established bloom of the colonial cyanobacteria Microcystis aeruginosa was conducted on October 15, 2003 in the upper San Francisco Bay Estuary. **** Evidence for Recombination in the Microcystin Synthetase (mcy) Genes of Toxic Cyanobacteria Microcystis.spp **** Systematic survey on crystalline features of algal celluloses **** Isolation, Characterization, and Quantitative Analysis of Microviridin J, a New Microcystis Metabolite Toxic to Daphnia **** Signalling through cyclic nucleotide monophosphates in cyanobacteria **** A mannan binding lectin is involved in cellcell attachment in a toxic strain of Microcystis aeruginosa **** HIDDEN ECOLOGIES? "Scientists fear catastrophic losses" **** THURSDAY / MAY 3, 2007 / Bee deaths spark food crisis fear **** MONDAY / APRIL 30, 2007 / Scientists fear catastrophic losses **** FRIDAY / APRIL 27, 2007 / Algae bloom killing wildlife off California coast **** WASHINGTON (CNN) -- Beekeepers throughout the United States have been losing between 50 and 90 percent of their honeybees over the past six months, perplexing scientists **** Humans Making Wildlife Sick PHOMA **** eT SEARCH ENGINE/ articles citing: PHOMA sp. **** Phoma Saccardo: Distribution, secondary metabolite production and biotechnological applications **** Phoma and Stemphol **** Equisetin and a novel opposite stereochemical homolog phomasetin **** (PDF) The fungal strain that produced magenta pigment was closely related to Phoma herbarum. **** Subcutaneous Infection by Phoma Species ***** A class-wide phylogenetic assessment of Dothideomycetes
**** (PDF) PHOMA HERBARUM WESTENDORP / PUTATIVE AGENT OF SAPROLEGNIOSIS ? PHOMA AND SARCOIDOSIS **** Experimental Skin Sarcoidosis **** Sarcoidosis of the Skin/ A Dermatological Puzzle **** Foundation for Sarcoidosis Research **** SUBCUTANEOUS PHEOHYPHOMYCOSIS CAUSED BY Phoma cava. CLICK IMAGE TO OBTAIN PSI BLAST RESULTS BASED ON ITS PHOMA SP. ITS PHOMA sp. >Contig_1 ATCATTAAATACAGTAGATTTCTACTGATCGGGGGGGGTGGAAAGTCCCAGTTTGATTACTG GATCGCGAGTAAGCCCC CTGTCTGCACCCTTGTCTTTTGCGTACTTATGTTTCCTCGGCGGGCTTGCCTGCCGAATGGA CAATTCTAAAACCTTTT TAATTTTCAATCAGCGTCTGAACAATTATAATAATTACAACTTTCAACAACGGATCTCTTGGT TCTGGCATCGATGAAG AACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTG AACGCACATTGCGCCCCT TGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTATGCTTGGTGTTG GGTGTTTGTCCTCTCC CTTGCGTTTGGACTCGCCTTAAAGAAATTGGCAGCCAGTGTATTGGTATAGAAGCGCAGCA CAATTTGCGACTCTAGCT AATAATTACTTGCAACCATCAAGTCTA //// ITS AGROCYBE PEDIADES (Fr.) FAYOD >Contig_1 CCGAGGCAACTCGGTCGGGAGGACTGCTGGCTTTCACGAGTCGGCTTTCCTTGTATTATCC AGGCCTATGTCTTACACA TACCCCAAAGAATGTAACAGAATGTATTGTATATGGCCTAGTGCCTATAAACTATATACAACT TTCAGCAACGGATCTC TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATT CAGTGAATCATCGAATCT TTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATT CTCAACCTTATTAGCTT TTGCTGATAATGGCTTGGACTTGGGGGTCTTTTTGCTGGCTTTCATTAGTCTGCTCCCCTTAA ATGTATTAGCCGGTGC CCCGCAGTGGAACCGTCTATTGGTGTGATAATTATCTACGCCGTGGACGTCTGCTATAATGG GTTTGCGCTGCTTCTAA CCGTCTCTCGGGACAACACAAATGACAA Phoma and related pleosporalean genera Highlights of the Didymellaceae: A polyphasic approach to characterise Phoma and related pleosporalean genera Fungal taxonomists routinely encounter problems when dealing with asexual fungal species due to poly- and paraphyletic generic phylogenies, and unclear species boundaries. These problems are aptly illustrated in the genus Phoma. This phytopathologically significant fungal genus is currently subdivided into nine sections which are mainly based on a single or just a few morphological characters. However, this subdivision is ambiguous as several of the section-specific characters can occur within a single species. In addition, many teleomorph genera have been linked to Phoma, three of which are recognised here. In this study it is attempted to delineate generic boundaries, and to come to a generic circumscription which is more correct from an evolutionary point of view by means of multilocus sequence typing. Therefore, multiple analyses were conducted utilising sequences obtained from 28S nrDNA (Large Subunit - LSU), 18S nrDNA (Small Subunit - SSU), the Internal Transcribed Spacer regions 1 & 2 and 5.8S nrDNA (ITS), and part of the -tubulin (TUB) gene region. A total of
324 strains were included in the analyses of which most belonged to Phoma taxa, whilst 54 to related pleosporalean fungi. In total, 206 taxa were investigated, of which 159 are known to have affinities to Phoma. The phylogenetic analysis revealed that the current Boeremaean subdivision is incorrect from an evolutionary point of view, revealing the genus to be highly polyphyletic. Phoma species are retrieved in six distinct clades within the Pleosporales, and appear to reside in different families. The majority of the species, however, including the generic type, clustered in a recently established family, Didymellaceae. In the second part of this study, the phylogenetic variation of the species and varieties in this clade was further assessed. Next to the genus Didymella, which is considered to be the sole teleomorph of Phoma s. str., we also retrieved taxa belonging to the teleomorph genera Leptosphaerulina and Macroventuria in this clade. Based on the sequence data obtained, the Didymellaceae segregate into at least 18 distinct clusters, of which many can be associated with several specific taxonomic characters. Four of these clusters were defined well enough by means of phylogeny and morphology, so that the associated taxa could be transferred to separate genera. Aditionally, this study addresses the taxonomic description of eight species and two varieties that are novel to science, and the recombination of 61 additional taxa. Keywords: Boeremia, coelomycetes, Didymella, Didymellaceae, DNA phylogeny, Epicoccum, Leptosphaerulina, Macroventuria, Peyronellaea, Phoma, Pleosporales, taxonomy, Stagonosporopsis Related article/ Click titel: Multiple Didymella teleomorphs are linked to the Phoma clematidina morphotype Articles from Studies in Mycology are provided here courtesy of CBS Fungal Biodiversity Centre Copyright 2010 CBS Fungal Biodiversity Centre PHOMA spp. "In hairy areas, the fungi grow around the hair shaft" **** NCBI / Link to Phoma **** Phoma spp. **** Sekundrstoffe aus endophytischen Pilzen mariner Habitate und Abbaureaktionen an Simocyclinon D8 **** PHOMA/ Anamorph genera associated with Botryosphaeria **** Synonym and Classification Data for Phoma spp. **** PHOMA SPP. FACT SHEET **** Human Phaeohyphomycotic Osteomyelitis Caused by the Coelomycete Phomopsis Saccardo 1905: Criteria for Identification, Case History, and Therapy **** ITS sequencing support for Epicoccum nigrum and Phoma epicoccina being the same biological species **** Association of a new species of Phoma with Pleospora Herbarum (Pers.) Rahb -**** ARTICLE: Applied and Environmental Microbiology/ Characterization and Differentiation of... (Phoma = Myrothecium = Malbranchea) **** Some isolates originally identified as E. nigrum developed a "Phoma-like" pycnidial state **** Evidence of the production of silver nanoparticles via ... **** Nomenclatural Fact Sheet - Phoma crystalliniformis **** Fungi: Phoma **** Phoma glomerata as a Mycoparasite of Powdery Mildew
**** First report of Phoma sorghina (Sacc.) **** Extracellular lipolytic activity in Phoma glomerata **** Identification of Sources of Resistance to Phoma medicaginis Isolates in Medicago truncatula SARDI Core Collection Accessions, and Multigene Differentiation of Isolates FUSARIUM SOLANI / PHOMA TELEOMORPH - ANAMORPH - HOLOMORPH - SYNANAMORPS **** teleomorph, anamorph, holomorph and synanamorphs. **** ANAMORPH INDEX GLOBAL BIODOVERSITY INFORMATION FACILITY Synonyms: Naucoria vervacti, Agrocybe arvalis, Agaricus arenicola, Agaricus temulentus, Agrocybe temulenta, Agrocybe arenaria, Agrocybe subpediades, Naucoria subpediades, Naucoria temulenta, Agrocybe temulenta, Pseudodeconica semiorbicularis, Naucoria pediades, Agaricus pediades, Agrocybe arenicola, Agrocybe semiorbicularis, Nolanea pediades, Naucoria semiorbicularis, Naucoria arenaria, Agaricus semiorbicularis KEY ARTICLE: FREDERICKS ET AL / VETERANS AFFAIRS / GULF WAR RELATED SYNDROME ***** FREDERICKS ET AL: ARCHIVED ARTICLES WILL SHOW UP MID PAGE ***** GULF WAR RELATED SYNDROME **** Surface signaling in pathogenesis. **** Disseminated hyalohyphomycosis caused by a novel human pathogen, Fusarium napiforme. **** The First Find of Yeast-like Cells of Fusarium moniliforme and Mechanism of Infection Injury. **** Disseminated infection by Fusarium moniliforme during treatment for malignant lymphoma. **** Genetic diversity of human pathogenic members of the Fusarium oxysporum complex inferred from multilocus DNA sequence data and amplified fragment length polymorphism analyses: evidence for the recent dispersion of a geographically widespread clonal lineage and nosocomial origin QUORUM SENSING **** QUORUM SENSING VIDEO / The Biofilm Lifecycle / ANIMATION ARCHIVE **** Surface-active proteins enable microbial aerial hyphae to grow into the air **** Plants and animals both listen to and disrupt bacterial quorum sensing signaling, prompting interest in mechanisms, applications **** Quorum sensing and bacterial cross-talk in biotechnology **** Slimy businessthe biotechnology of biofilms **** Bacterial Quorum Sensing in Pathogenic Relationships **** MicroMeeting **** Bugging the Bugs **** MICROBES, IMMUNITY, AND DISEASE: A Symphony of Bacterial Voices **** Revisiting quorum sensing: Discovery of additional chemical and biological functions for 3-oxoN-acylhomoserine lactones **** Molecular structure is solved for key protein of quorum-sensing bacteria MESOMYCETOZOEA / DRIP CLADE / AQUATIC MOLD / RHINOSPORIDOSIS **** The two Dermocystidium species resemble Rhinosporidium **** USE OF STILBENE DERIVATIVES FOR TREATMENT AND PREVENTION OF AQUATIC MOLD INFECTIONS **** FAO / Saprolegnia AND OTHER PHYCOMYCETE INFECTIONS [DERMAL MYCOSES] **** Parasitism by Dermocystidium ranae **** Observations on the Life Stages of Sphaerothecum destruens n. g., n. sp., a Mesomycetozoean
Fish Pathogen Formally Referred to as the Rosette Agent **** Differentiation between Prototheca and morphologically similar green algae in tissue. **** A molecular phylogeny of Pythium insidiosum **** Development of an Immunochromatographic Test for Rapid Serodiagnosis of Human Pythiosis **** Lacazia Loboi and Rhinosporidium seeberi; a genomic perspective **** Molecular Model for Studying the Uncultivated Fungal Pathogen Lacazia loboi **** Nature and significance of the electron-dense bodies of the endospores of Rhinosporidium seeberi **** Phylogenetic Analysis of Rhinosporidium seeberi **** A new rubisco-like protein coexists with a photosynthetic rubisco in the planktonic cyanobacteria Microcystis. **** Algae as Tools in the Study of Cellulose **** Rhinosporidium seeberi: A Human Pathogen From a Novel Group of Aquatic Protistan Parasites **** Phylogenetic Analysis of Rhinosporidium seeberi's 18S Small-Subunit Ribosomal DNA Groups This Pathogen among Members of the Protoctistan Mesomycetozoa Clade **** Altered expression of two light-dependent genes in a microcystin-lacking mutant of Microcystis aeruginosa PCC 7806. **** Evidence for recombination in the microcystin synthetase **** Report of the First Human Case of Lobomycosis in the United States **** Transcription and in vivo expression of a Microcystis aeruginosa plasmid **** Fungal and Parasitic Infections of the Eye **** Recreational and occupational field exposure to freshwater cyanobacteria a review of anecdotal and case reports, epidemiological studies and the challenges for epidemiologic assessment **** Molecular Model for Studying the Uncultivated Fungal Pathogen Lacazia loboi THE WALL STREET JOURNAL / THE INFORMED READER / DISEASE OR DELUSION? **** THE WALL STREET JOURNAL **** THE INFORMED READER / DISEASE OR DELUSION? **** Ear Bacteria Resist Treatment **** HEALTH **** Dettol Man or Lysol: too much of a good sanitizer can kill QUICK DETAIL The abbreviation (sp.) used after a genus name refers to an undetermined species; (spp.) after a genus name refers to several species without naming them individually. THE MYSTERIOUS RELATIONSHIPS OF RHINOSPORIDOSIS SEEBERI **** THE MYSTERIOUS RELATIONSHIPS OF RHINOSPORIDOSIS SEEBERI **** Lymphadenitis, trans-epidermal elimination and unusualhistopathology in human rhinosporidiosis CAUSATIVE AGENT OF RHINOSPORIDOSIS IS MICROCYSTIS SP. ? **** Why did previous investigators not find well-defined mitochondria? I am convinced that these mitochondria are from human cells Emerging (unusual nosocomial) Infections **** Epidemiology and Clinical Aspects of Unusual Fungal Nosocomial Infections **** Fungal and Parasitic Infections of the Eye **** In-vitro antifungal susceptibility of clinical and environmental Fusarium spp. strains **** Cutaneous Infection by Fusarium Species in Healthy and Immunocompromised Hosts: Implications for Diagnosis and Management **** Fatal disseminated fusarium infection in acute lymphoblastic leukaemia in complete remission **** Fusarium Outbreak: Lessons Learned **** The effect of propyl gallate on the activity of various antifungal drugs against filamentous fungi in vitro. **** Fusarium, a Significant Emerging Pathogen
"A NEW WAY TO LOOK AT FILAMENTS" **** A NEW WAY TO LOOK AT FILAMENTS **** Isolation and cultivation of filamentous bacteria implicated in... Cellular fatty acids as chemotaxonomic markers of the genera.... **** Cellular fatty acids as chemotaxonomic markers of the genera Anabaena, Aphanizomenon, Microcystis, Nostoc and Planktothrix (cyanobacteria) **** The clade containing filamentous heterocystous cyanobacteria was divided into three discrete groups of.... GAS VACUOLES, ELECTRON-DENSE BODIES AND VIRUS **** The result of electron microscopic investigation of gas-vacuoles in a culture of the benthal alga Oscillatoria chalybea was compared with the extensive literature concerning gas-vacuole formation and virus infection in bacteria and animals. **** Gas vesicle proteins **** Nauture and significance of the electron-dense bodies.... CLASSIFICATION **** Molecular characterization of planktic cyanobacteria of Anabaena, Aphanizomenon, Microcystis and Planktothrix genera **** Quantitative Real-Time PCR Detection of Toxic Nodularia Cyanobacteria in the Baltic Sea **** A proposal for the unification of five species of the cyanobacterial genus Microcystis Kutzing ex Lemmermann 1907 under the Rules of the Bacteriological Code **** A proposal for further integration of the cyanobacteria under the Bacteriological Code **** TAXONOMY BROWSER **** Systematic-bacteriology--Enterobacteriaceae INDEX DATASERVICES **** SANGER/ Staphylococcus aureus Blast **** List of Prokaryotic names with Standing in Nomenclature **** BLAST INFORMATION **** MAX PLANCK INSTITUTE FOR TERRESTRIAL MICROBIOLOGY (INDEX) **** BROAD INSTITUTE **** IMMUNEEPITOPE **** MAX PLANCK / BIO-MEDICAL **** JVI / CMR (MICROBIAL GENOMES) **** CYANOBASE **** CYANOBASE LINKS **** Synechocystis PCC6803 and Anabaena PCC7120 **** NCBI / BLAST (Basic Local Alignment Search Tool) **** BIOTA TAIWANICA **** Neosartorya fischeri Genome Project **** LANL **** FASTA **** DOE **** EMBL-EBI **** RNA RIBOSOMAL DATABASE **** PFAM/ DB / SANGER **** FUNGAL GENOMES SEARCH **** GOBASE **** GenDis **** IMG **** DDBJ / DNA DATA BANK OF JAPAN
**** NEMATOSTELLA VECTENSIS DATA BASE **** INSDC **** CABI Bioscience Databases **** BIOAFRICA **** ESTREE **** SGD SITE MAP **** TREEBASE **** CLCBIO **** MYCOBANK **** GLOBAL BIODIVERSITY INFORMATION FACILITY **** USDA AGRICULTURAL RESEARCH SERVICE **** BRENDA **** FLYBASE **** PASTEUR/ CYANOLIST **** Genstyle Companion Database Browser **** YEASTGENOME **** YCR (YEAST RESOURCE CENTER) ARCHIVE 2007 (51) 2008 (1) January (1) **** KEY ARTICLES VIA: Fungal Genomes and Comparat... 2010 (1) **** KEY ARTICLES VIA: Fungal Genomes and Comparative Genomics Newer Posts Older Posts Home Developments in Fungal Taxonomy GENERAL CONCLUSIONS Fungal systematics is still based mainly on morphological criteria, and pathogenic fungi are usually recognized and identified basically by their phenotypes. Numerous alternative approaches have been developed, including nutritional and physiological studies, serologic tests, secondary metabolites, ubiquinone systems, and fatty acids. Although some of these are very useful for identifying poorly differentiated fungi such as yeasts and black yeasts, they are only complementary tools of morphological data in most cases. Molecular biology techniques, especially the analysis of rRNA sequences, are currently used for reliable phylogenetic studies, which enable a more natural classification system to be established. However, despite the effective application of these techniques in PCRmediated identification systems, they are not yet currently available in the routine clinical mycology environment. The constant discovery of new emerging mycotic agents in different clinical settings that often affect critically ill patients increases the need for the development of rapid and accurate identification systems, since delay in the diagnosis and initiation of therapy leads to a high mortality rate. On the other hand, if the isolates described in a report are discarded after a study finishes, the etiological data cannot then be checked in any further investigations (119). Therefore, contemporary practitioners and laboratorians should contact expert
mycologists to identify the clinical isolates correctly and should deposit the strains in a reference culture collection. Most of these isolates must be reidentified by modern methods for a critical evaluation of the clinical cases. The problem of numerous undescribed species, together with the superficial level of knowledge that we have even for the fungi which have names, argues for a much greater emphasis on fungal biosystematics in the future. More attention to medical mycology and increased funding for training of medical mycologists are critical to address the current threats from new and reemerging fungal infections. **** TmPrime/ Agrocybe Pediades Awesome Inc. template. Powered by Blogger.
http://www.biology-online.org/biology-forum/about1958-6384.html by tamtam Tue Jan 09, 2007 2:52 pm By the way: Why did previous investigators not find well-defined mitochondria? I am convinced that these mitochondria are from human cells. Causative Agent of Rhinosporidiosis File Format: PDF/Adobe Acrobat We have isolated a prokaryotic cyanobacterium, a Microcystis ... regulation and molecular aspects of muscle, liver, pancreas, connective tissue ... jcm.asm.org/cgi/reprint/39/1/413.pdf - Similar pages http://jcm.asm.org/cgi/content/full/39/1/413 This means that another person is trying to integrate into your system. I am rather convinced that this is the case, so I herald Ahluwalia, K. B. Sincerely, tamtam
"Rhinosporidiosis is the first human disease shown to be caused by a cyanobacterium" Causative Agent of Rhinosporidiosis - Journal of Clinical ... jcm.asm.org/content/39/1/413.full by KB Ahluwalia - 2001 - Cited by 14 - Related articles Rhinosporidiosis is the first human disease shown to be caused by a cyanobacterium. Surprisingly, controls such as samples from normal people inhabiting the ... Causative Agent of Rhinosporidiosis - National Center for ... www.ncbi.nlm.nih.gov ... J Clin Microbiol v.39(1); Jan 2001 by KB Ahluwalia - 2001 - Cited by 14 - Related articles Rhinosporidiosis is the first human disease shown to be caused by a cyanobacterium. Surprisingly, controls such as samples from normal people inhabiting the ... Causative Agent of Rhinosporidiosis - PubMed Central Canada pubmedcentralcanada.ca ... J Clin Microbiol v.39(1); Jan 2001 by KB Ahluwalia - 2001 - Cited by 14 - Related articles Rhinosporidiosis is the first human disease shown to be caused by a cyanobacterium. Surprisingly, controls such as samples from normal people inhabiting the ... Causative Agent of Rhinosporidiosis - Europe PubMed Central europepmc.org/articles/PMC87751 Rhinosporidiosis is the first human disease shown to be caused by a cyanobacterium. Surprisingly, controls such as samples from normal people inhabiting the
"Causative Agent of Rhinosporidiosis" morgellons cyanobacterium Nanocytes - Morgellons www.morgellons-disease-research.com/Morgellons.../Thread-Nanocytes Jun 12, 2009 - Morgellons Disease Health and Wellness. ... Morgellons Disease Message Board .... Causative Agent of Rhinosporidiosis -- Ahluwalia et al. 39 (1): 413 ... is also caused by or includes a component that is cyanobacterium. Nanocytes - Morgellons www.morgellons-disease-research.com/Morgellons.../Thread-Nanocytes?... Jun 13, 2009 - Morgellons Disease Health and Wellness. ... 'daughter' cells of the Prokaryotic Cyanobacterium- Microsystis sp (blue green alga) per Dr Ahluwalia and ... Microcystis the causative agent of Rhinosporidiosis - per Tam Tam and
http://jcm.asm.org/content/39/1/413.full.pdf JOURNAL OF CLINICAL MICROBIOLOGY, 0095-1137/01/$04.0010 DOI: 10.1128/JCM.39.1.413415.2001 Jan. 2001, p. 413415 Vol. 39, No. 1 Causative Agent of Rhinosporidiosis I have read the paper by Herr et al. (7) describing 18S ribosomal DNA (rDNA) in Rhinosporidium seeberi and its phylogenetic similarities with protoctistan fish parasites known as the DRIP clade. For extraction of DNA, the authors either dissected sporangia and purified them by centrifugation to remove human cells or used 100 mg of human tissue containing R. seeberi (7). This procedure without enzymatic digestion is insufficient for removing human cells that are always associated with sporangia (1, 3). Thus, contaminating human cells are the source of 18S rDNA amplified in this study (7). We have isolated a prokaryotic cyanobacterium, a Microcystis sp. (a blue-green alga), from pond water samples where patients had been bathing. The same cyanobacterium, Microcystis, and its daughter cells termed nanocytes have been demonstrated in clinical samples (4). After gaining entry into the light-deprived environment in human epithelium, the photosynthetic cells of Microcystis differentiate into round bodies containing many Microcystis cells described by Herr et al. (7) as sporangia and spores. We have successfully cultured the organism isolated from round bodies for the first time (2). Pure axenic cells were used for extraction of DNA. Our team has compared the DNA from Microcystis from pond water with the DNA from microbes found in clinical samples by using PCR, cloning, sequencing, and Southern hybridization. Our study demonstrates the presence of a prokaryotic cyanobacterium inside round bodies (unpublished results) but not 18S rDNA. Vanbreuseghm (12) had also suggested that R. seeberi produces precursors of chlorophyll and should be regarded as a pathogenic alga. In the findings of Herr et al. (see Fig. 2A in reference 7), structures labeled as nuclei do not demonstrate a double membrane, while ribosome-like configurations are visible both outside and inside these nuclei. Actually, these are not nuclei but nanocytes of Microcystis encompassing naked prokaryotic DNA. The mitochondria illustrated in the work of Herr et al. (see Fig. 2A of reference 7) do not demonstrate two membranes. The mitochondria with flat cristae shown in Fig. 2B of this study (7) have two distinct membranes and are strikingly similar to those present in human cells. Since mitochondria magnified in Fig. 2B in reference 7 do not belong to Fig. 2A, their spatial relationship to sporangia or human cells and their source are not clear. It is noteworthy that mitochondria were observed only in intermediate sporangia (7), in which a large amount of host epithelial cells is present (see Fig.
5 in reference 9). Why were mitochondria, which are specialized for vital functions, not observed in young and mature sporangia? Why did previous investigators not find well-defined mitochondria? I amconvinced that these mitochondria (7) are from human cells. On the basis of flat cristae in mitochondria in R. seeberi (see Fig. 2B in reference 7) and in Dermocystidium (10), Herr et al. (7) have suggested a relationship between R. seeberi and the DRIP clade. Flat cristae are not a distinctive feature of the DRIP clade but are common to most eukaryotes. The authors who studied the DRIP clade have themselves stated that mitochondria in Dermocystidium are like those in almost all animals and eumycota (10). Herr et al. mention that I consider the causative organism an artifact of carbohydrate waste (7). I have never stated that R. seeberi is an artifact (1). The spheres of cellular waste (1) are now found to be polysaccharide reserves characteristic of cyanobacteria (5). Unexplained vacuoles, vesicles, and refractile bodies, as well as the concentric lamellated bodies in R. seeberi (8, 9, 11), correspond to cell inclusions (5) and photosynthetic membranes in cyanobacteria (6). Finally, the conclusion of Herr et al. (7) that R. seeberi is related to the DRIP clade, based on 18S rDNA and mitochondria from human cells, is unwarranted. Supporting evidence drawn from superficial criteria such as spherical parasites, endospores, the inability to culture, and the aquatic habitat (7) has very little meaning. Inadequate knowledge about the various manifestations of the microbe, after acquisition of the pathogenic state, may also have led to the erroneous conclusions. REFERENCES 1. Ahluwalia, K. B. 1992. New interpretations in rhinosporidiosis, enigmatic disease of the last nine decades. J. Submicrosc. Cytol. Pathol. 24:109114. 2. Ahluwalia, K. B. 1999. Culture of the organism that causes rhinosporidiosis. J. Laryngol. Otol. 113:523528. 3. Ahluwalia, K. B., and S. Bahadur. 1990. Rhinosporidiosis associated with squamous cell carcinoma of the tongue. J. Laryngol. Otol. 104:648650. 4. Ahluwalia, K. B., N. Maheshwari, and R. C. Deka. 1997. Rhinosporidiosis: a study that resolves etiologic controversies. Am. J. Rhinol. 11:479483. 5. Allen, M. M. 1984. Cyanobacterial cell inclusions. Annu. Rev. Microbiol. 38:125. 6. Golecki, J. R., and G. Drews. 1982. Supramolecular organization and composition of membranes, p. 128138. In N. G. Carr and B. A. Whitton (ed.), The biology of cyanobacteria. Blackwell Scientific Publications, Oxford, England. 7. Herr, R. A., L. Ajello, J. W. Taylor, S. N. Arseculeratne, and L. Mendoza. 1999. Phylogenetic analysis of Rhinosporidium seeberis 18S small subunit ribosomal DNA groups this pathogen among members of the protoctistan Mesomycetozoa clade. J. Clin. Microbiol. 37:27502754. 8. Kannan-Kutty, M., and E. C. Teh. 1974. Rhinosporidium seeberi: an electron microscopic study of its life cycle. Pathology 6:6370.
9. Kennedy, F. A., R. R. Buggage, and L. Ajello. 1995. Rhinosporidiosis: a description of an unprecedented outbreak in captive swans (Cygnus spp.) and a proposal for revision of the ontogenic nomenclature of Rhinosporidium seeberi. J. Med. Vet. Mycol. 33:157165. 10. Ragan, M. A., C. L. Goggin, R. J. Cawthorn, L. Cerenius, A. V. C. Jamieson, S. M. Plourdes, T. G. Tand, K. Soderhall, and R. R. Gutell. 1996. A novel clade of protistan parasites near the animal fungal divergence. Proc. Natl. Acad. Sci. USA 93:1190711912. 11. Thianprasit, M., and K. Thagerngpol. 1989. Rhinosporidiosis, p. 6485. In M. R. McGinnis and M. Borgers (ed.), Current topics in medical mycology, vol. 3. Springer Verlag, New York, N.Y. 12. Vanbreuseghm, R. 1973. Ultrastructure of Rhinosporidium seeberi. Int. J. Dermatol. 12:2028. Karvita B. Ahluwalia Cell Biology and EM Section Department of Biophysics All India Institute of Medical Sciences New Delhi-110029, India Phone: 0091-11-6593640 Fax: 0091-11-6862663 E-mail: aluwalia@medinst.ernet.in Authors Reply We thank Dr. Ahluwalia for the opportunity to address her position on the prokaryotic nature of Rhinosporidium seeberi (4, 5). We differ with the arguments presented in her letter regarding our phylogenetic analysis of R. seeberi (7) and her assertion that this hydrophilic pathogen is a cyanobacterium 413 and not a Mesomycetozoan. Our position is based on our studies (7) and a report by Fredericks et al. (6) which confirmed our phylogenetic analysis. Dr. Ahluwalias statement that the 18S small-subunit (SSU) rDNA that we isolated from R. seeberis endospores and sporangia came from DNA of human origin is groundless and reflects little understanding of molecular microbiological procedures. An experienced molecular biologist would have readily noted that the human 18S SSU rDNA nucleotide sequences and our sequence (GenBank accession no. AF118851) are unrelated. In fact, as per our BLAST (Basic Local Alignment Search Tool) analysis, our sequence was not found in the human genome. Moreover, the sequence of R. seeberi published by Fredericks et al. (GenBank accession no. AF158369) (6), from a dog with rhinosporidiosis, is identical to our sequence. Both of these groups proved beyond doubt that their 18S SSU rDNAs came from the sporangia and endospores of R. seeberi. Fredericks et al. (6) did not contaminate their samples
with canine DNA; neither could our sequence (7) possibly be of human origin. These two independent reports on the phylogenetic connection of R. seeberi with the Mesomycetozoans clearly indicate that Dr. Ahluwalias prokaryotic theory is incorrect. There can be no reasonable doubt that R. seeberi is a eukaryotic organism not only on the basis of the two cited DNA studies (6, 7) but on the demonstration by numerous investigators of the presence of prominent nuclei and mitochondria in the sporangia of this pathogen (8, 9). Dr. Ahluwalias evolving concepts regarding the nature of R. seeberi have ranged widely during the past 8 years. In 1992, she concluded, on the basis of light microscopy, electron microscopy, and cytochemical studies of tissue from subjects with rhinosporidiosis, that The round body is a unique structure composed of both plant and human material that is self-assembled in response to specific function pertaining to its elimination from the tissue (1). In a follow-up paper (2), she stated that This study provides unequivocal evidence against involvement of fungus in rhinosporidiosis. Two carbohydrates, namely defective proteoglycans synthesized intracellularly and an exogenous polysaccharide ingested through diet of tapioca constitute indigestible material in NB (nodular bodies) and scw (spheres of cellular waste). In a 1994 publication, Ahluwalia et al. (3) concluded that The so-called fungal sporangium was shown to be a unique body organized in host tissue for elimination of two indigestible carbohydrates, starch (possibly from FIG. 1. (A) Transmission electron microscopy photograph of a R. seeberis intermediate sporangium, showing several mitochondria with flat cristae (black and white asterisks) and a laminated body (arrow). (B and C) An enlargement of the mitochondria in panel A. 414 LETTERS TO THE EDITOR J. CLIN. MICROBIOL. tapioca) and defective proteoglycans (precursor of mucus). The authors went on to say that Dietary dry tapioca and chronic inflammation in undernourished individuals could lead to rhinosporidiosis. From this bizarre concept, Ahluwalia et al. in 1997 (4) went on to publish a new hypothesis on the etiologic agent of rhinosporidiosis. In this study, she announced that We have been able to isolate the cyanobacterium Microcystis aeruginosa from water samples of ponds and rivers where patients of rhinosporidiosis were bathing. It is likely that this cyanobacterium is the causative agent of this disease. Finally, in 1999 (5), she announced that Observations based on laser-scanning confocal microscopy, light and electron microscopy confirm that a cyanobacterium Microcystis sp. is the causative agent of the disease. Rhinosporidiosis is the first human disease shown to be caused by a cyanobacterium. Surprisingly, controls such as samples from normal people inhabiting the same areas where the water samples were collected and cultures of endospores
and sporangia free of bacteria obtained after multiple washes and filtration steps were not included. It would also be interesting to probe M. aeruginosa with sera from patients with rhinosporidiosis, a key experiment that was also absent in Ahluwalias studies. The mere isolation of the ubiquitous bluegreen bacterium M. aeruginosa from pond and river waters in India does not have any significance with respect to the infections caused by the eukaryotic protist R. seeberi. Thus, the lack of controls in Dr. Ahluwalias experiments is the source of her errors. This lapse undoubtedly led Dr. Ahluwalia to conclude that the mere isolation of M. aeruginosa from infected tissues was enough to prove her conjecture. We disagree with Dr. Ahluwalias statement that there are no other studies depicting mitochondria in R. seeberi. At least two independent studies showed these organelles within R. seeberis sporangia (8, 9). In an effort to further clarify our finding, we have included Fig. 1. In this figure an intermediate sporangium (Fig. 1A, previously printed in reference 7) containing several nuclei, mitochondria, and a laminated body is shown. An enlargement of Fig. 1A presents details of the flat mitochondrial cristae of R. seeberi (Fig. 1B and C). The presence of a laminated body indicates that this is a healthy sporangium and that the mitochondria within the spherical body are not of human origin, as charged by Ahluwalia, but are attributable to R. seeberi. Contrary to Dr. Ahluwalias studies, our results have already been confirmed by other investigators (6). These researchers also concluded that R. seeberi is phylogenetically linked with the Mesomycetozoa (DRIP) clade. In contrast, we could not replicate her results when purified endospores and sporangia were cultured in a variety of media. We strongly recommend that Dr. Ahluwalia repeat our molecular studies with uncontaminated endospores and sporangia from patients with rhinosporidiosis in India to contest our data. However, the results achieved so far by two independent laboratories could well be the requiem to Dr. Ahluwalias prokaryotic theory of R. seeberi. REFERENCES 1. Ahluwalia, K. B. 1992. Plant molecular in human diseasea novel association, p. 289292. In R. J. Wegmann and M. A. Wegmann (ed.), Gene regulation and molecular aspects of muscle, liver, pancreas, connective tissue and plants, vol. 5. Peeters Press, Leuven, Belgium. 2. Ahluwalia, K. B. 1992. New interpretations in rhinosporidiosis, enigmatic disease of the last nine decades. J. Submicrosc. Cytol. Pathol. 24:109114. 3. Ahluwalia, K. B., N. Sharma, S. K. Kacker, and R. C. Deka. 1994. Association of tapioca and chronic inflammation with rhinosporidiosis. Indian J. Otolayngol. Head Neck Surg. 3:2527. 4. Ahluwalia, K. B., N. Maheshwari, and R. C. Deka. 1997. Rhinosporidiosis: a study that resolves etiologic controversies. Am. J. Rhinol. 11:479483. 5. Ahluwalia, K. B. 1999. Culture of the organism that causes rhinosporidiosis.
J. Laryngol. Otol. 113:523528. 6. Fredericks, D. N., J. A. Jolley, P. W. Lepp, J. C. Kosek, and D. A. Relman. 2000. Rhinosporidium seeberi: a human pathogen from a novel group of aquatic protistan parasites. Emerg. Infect. Dis. 6:273282. 7. Herr, R. A., L. Ajello, J. W. Taylor, S. N. Arseculeratne, and L. Mendoza. 1999. Phylogenetic analysis of Rhinosporidium seeberis 18S small subunit ribosomal DNA groups this pathogen among members of the protoctistan Mesomycetozoa clade. J. Clin. Microbiol. 37:27502754. 8. Teh, E. C., and M. Kannan-Kutty. 1975. Rhinosporidium seeberi: spherules and their significance. Pathology 7:133137. 9. Thianprisit, M., and K. Thagerngpol. 1989. Rhinosporidiosis. Curr. Top. Med. Mycol. 3:6185. Leonel Mendoza Roger A. Herr Medical Technology Program Department of Microbiology Michigan State University 322 N. Kedzie Lab. East Lansing, Michigan 48824 Libero Ajello Department of Ophthalmology Emory University School of Medicine Atlanta, Georgia 30322
R. seeberi hydrophilic pathogen cyanobacterium or Mesomycetozoan Ahluwalia et al. in 1997 (4) went on to publish a new hypothesis on the etiologic agent of rhinosporidiosis. In this study, she announced that We have been able to isolate the cyanobacterium Microcystis aeruginosa from water samples of ponds and rivers where patients of rhinosporidiosis were bathing. It is likely that this cyanobacterium is the causative agent of this disease. Finally, in 1999 (5), she announced that Observations based on laser-scanning confocal microscopy, light and electron microscopy conrm that a cyanobacterium Microcystis sp. is the causative agent of the disease. Rhinosporidiosis is the rst human disease shown to be caused by a cyanobacterium. cyanobacterium Microcystis Rhinosporidiosis
http://www.thamesweb.co.uk/swans/swan_projectPR03.htm DNA taken from the eye cysts of the swans was subsequently examined and tested with DNA from cysts with rhinosporidiosis taken from humans. The DNA analysis revealed the R. seeberi in both species is the same species. This find is historically important. Rhinosporidiosis, once thought to be caused by a fungus is now proven to be a protozoan. This organism is found in moist, warm environments and is most prevalent in India, Sri Lanka and southeast Asia, although cases have occurred in Africa, Central and South America, Europe and the United States. This protozoan has never been cultured and its natural habitat remained unknown. Rhinosporidium seeberi is a natural occurring micro-organism that infects the mucus surfaces of humans and animals who come into contact with it. Rhinosporidiosis is a byproduct of the microorganism. It's a non-contagious chronic infection that usually manifests itself in the form of slowgrowing-tumor-like masses that affect the nasal passages or the eyes. Currently, surgical removal is the only available treatment. However, this study showed that by surgically removing the cysts, the swans showed a spontaneous remission (no noted reoccurrence of the parasite). More testing is expected to be conducted by the doctors and The Regal Swan researchers to find more information on this elusive parasite.
http://jcm.asm.org/content/39/1/413.full.pdf In the ndings of Herr et al. (see Fig. 2A in reference 7), structures labeled as nuclei do not demonstrate a double membrane, while ribosome-like congurations are visible both outside and inside these nuclei. Actually, these are not nuclei but nanocytes of Microcystis encompassing naked prokaryotic DNA. The mitochondria illustrated in the work of Herr et al. (see Fig. 2A of reference 7) do not demonstrate two membranes. The mitochondria with at cristae shown in Fig. 2B of this study (7) have two distinct membranes and are strikingly similar to those present in human cells. Since mitochondria magnied in Fig. 2B in reference 7 do not belong to Fig. 2A, their spatial relationship to sporangia or human cells and their source are not clear. It is noteworthy that mitochondria were observed only in intermediate sporangia (7), in which a large amount of host epithelial cells is present (see Fig. 5 in reference 9). Why were mitochondria, which are specialized for vital functions, not observed in young and mature sporangia? Why did previous investigators not nd well-dened mitochondria? I am convinced that these mitochondria (7) are from human cells. On the basis of at cristae in mitochondria inR. seeberi(see Fig. 2B in reference 7) and inDermocystidium (10), Herr et al. (7) have suggested a relationship between R. seeberi and the DRIP clade. Flat cristae are not a distinctive feature of the DRIP clade but are common to most eukaryotes. The authors who studied the DRIP clade have themselves stated that mitochondria in Dermocystidium are like those in almost all animals and eumycota (10). [I'm not sure what Tam Tam is inferring here. Silent Superbug (Morgellons) is also a cyanobacterium? And these mitochondria are from human cells? As in man-made in a laboratory by mad scientists, then unintentional release?]