Am J Physiol Gastrointest Liver Physiol 306: G983G991, 2014.

First published April 17, 2014; doi:10.1152/ajpgi.00087.2014.

Aging-associated oxidative stress leads to decrease in IAS tone via

RhoA/ROCK downregulation
Jagmohan Singh, Sumit Kumar, Chadalavada Vijay Krishna, and Satish Rattan
Division of Gastroenterology and Hepatology, Department of Medicine, Jefferson Medical College, Thomas Jefferson
University, Philadelphia, Pennsylvania
Submitted 7 March 2014; accepted in final form 8 April 2014

Singh J, Kumar S, Krishna CV, Rattan S. Aging-associated oxidative stress leads to decrease in IAS tone via RhoA/ROCK downregulation. Am J Physiol Gastrointest Liver Physiol 306: G983G991, 2014.
First published April 17, 2014; doi:10.1152/ajpgi.00087.2014.Internal
anal sphincter (IAS) tone plays an important role in rectoanal incontinence (RI). IAS tone may be compromised during aging, leading to
RI in certain patients. We examined the influence of oxidative stress
in the aging-associated decrease in IAS tone (AADI). Using adult
(4 6 mo old) and aging (24 30 mo old) rats, we determined the effect
of oxidative stress on IAS tone and the regulatory RhoA/ROCK signal
transduction cascade. We determined the effect of the oxidative stress
inducer LY83583, which produces superoxide anions (O2), on basal
and stimulated IAS tone before and after treatment of intact smooth
muscle strips and smooth muscle cells with the O2 scavenger SOD.
Our data showed that AADI was associated with a decrease in
RhoA/ROCK expression at the transcriptional and translational levels.
Oxidative stress with a LY83583-mediated decrease in IAS tone and
relaxation of IAS smooth muscle cells was associated with a decrease
in RhoA/ROCK signal transduction, which was reversible by SOD. In
addition, LY83583 caused a significant decrease in IAS contraction
produced by the RhoA activator and a known RhoA/ROCK agonist,
U46619, that was also reversible by SOD. The inhibitory effects of
LY83583 and the ROCK inhibitor Y27632 on the U46619-induced
increase in IAS tone were similar. We conclude that an increase in
oxidative stress plays an important role in AADI in the elderly and
may be one of the underlying mechanisms of RI in certain aging
patients.
aging; internal anal sphincter; oxidative stress; rectoanal incontinence;
RhoA/ROCK
ALTHOUGH MULTIFACTORIAL, the intrinsic tone and fibroelastic properties of the internal anal sphincter (IAS) play major roles in
maintaining rectoanal continence (4). The IAS exhibits spontaneous myogenic tone: it relaxes in response to the rectoanal inhibitory reflex, leading to expulsion of feces. Surgery, trauma, radiation, childbirth (4, 26), and aging are associated with a decrease
in IAS tone and derangement of the fibroelastic properties of the
IAS, leading to rectoanal incontinence (RI) (26, 42, 50). Molecular mechanisms underlying the aging-associated decrease in IAS
tone (AADI) are not known.
Aging is characterized by a progressive decline in physiological function and increased susceptibility to disease. Although multiple theories have been proposed for aging-related
bodily dysfunction, the mitochondrial free radical theory of
aging is widely accepted (1, 16). It has been postulated that
aging-related bodily dysfunction is the result of free radical-

Address for reprint requests and other correspondence: S. Rattan, 901

College, Dept. of Medicine, Division of Gastroenterology & Hepatology, 1025
Walnut St., Philadelphia, PA 19107 (e-mail: satish.rattan@jefferson.edu).
http://www.ajpgi.org

induced oxidative stress and the inability of the antioxidant

defenses to counterbalance these changes.
It follows, therefore, that AADI may be associated with
oxidative stress. In general, when examined individually, aging
(6, 13, 47, 51) and oxidative stress (36, 46) have been reported
to decrease overall propulsive activity of the gut because of
degenerative changes at the neuronal and muscular levels.
Neuromuscular degenerative changes have been reported in the
aging IAS (49), and it has been suggested that a decrease in
IAS tone and altered rectal sensation may be the leading causes
of aging-associated RI (3, 13, 31, 42, 48). At the smooth
muscle level (e.g., rat colon), aging-related changes in colonic
motility have been suggested to be via decreases in phosphorylation of the myosin-binding subunit of myosin phosphatase
target subunit 1 (MYPT1) and regulatory MLC (MLC20),
secondary to RhoA-associated kinase (RhoA/ROCK) inactivation (41). Interestingly, no studies examining the role of oxidative stress during aging in gastrointestinal dysmotility, especially in AADI, have been published. Since the majority of
basal IAS tone is a function of the integrity of myogenic
properties (10, 21, 22, 28, 34), it is critical to examine the role
of oxidative stress during aging in intact IAS smooth muscle
and smooth muscle cells (SMCs).
Reactive oxygen species (ROS) are free radicals with a single
unpaired electron (20, 44), mainly produced by mitochondria as
by-products of O2 metabolism. The important ROS are superox H) (44).
ide anion (O2), H2O2, and the hydroxyl radical (O
While in physiological range, ROS play important roles in cell
signaling processes, their overproduction leads to oxidative stress,
causing damage to cellular constituents, including DNA, proteins,
and lipids (14). Oxidative stress has been implicated in a large
number of chronic degenerative diseases, such as atherosclerosis,
pulmonary fibrosis, and cancer, and as a mechanism of senescence
and aging (17). Also, it has been well established that oxidative
stress leads to decreased contractility of gastrointestinal smooth
muscle (9, 45). The bodys antioxidant defense mechanisms, such
as SOD, catalase, glutathione peroxidase, and heat shock proteins,
play a crucial role in regulating ROS levels. While SOD detoxifies
O2 by dismutation into H2O2, catalase breaks down H2O2 into
H2O and O2 (15).
Homeostasis between the production and deactivation (by
antioxidants) of ROS, which is crucial for human physiology,
is known to be disturbed during aging (27). The purpose of the
present investigation is to determine the effect of oxidative
stress on IAS tone in relation to aging, while monitoring the
contractile signal transduction machinery RhoA/ROCK/phosphorylated MYPT1 (pMYPT1)/phosphorylated MLC20 (pMLC20).
To induce and monitor oxidative stress, we used the O2 generator LY83583 and specific dihydroethidium (DHE) staining strategy, respectively.

0193-1857/14 Copyright 2014 the American Physiological Society

G983

G984

AGING-ASSOCIATED IAS DYSFUNCTION

Table 1. Primers
Sequence (5=-3=)

RhoA
Forward
Reverse
ROCK II
Forward
Reverse
GAPDH
Forward
Reverse

Position

Accession No.

NM_016802
501521
847870

CAGCAAGGACCAGTTCCCAGA
TGCCATATCTCTGCCTTCTTCAGG

NM_013022
TAGAAGAACACCTTAGCAGTGAGGTACAAG
TGTCTCTTCTCCAGCTCTACTTTTGCT

14011430
20342060

GGCTCATGACCACAGTCCAT
CCCCTCCTGTTGTTATGGGG

587606
12031222

NM_017008.4

MATERIALS AND METHODS

Selection of animals for aging studies. Sprague-Dawley rats of two

distinct age groups, 4 6 mo (adult) and 24 30 mo (aging), were used.
IAS tissue sample preparation. Rats were euthanized by decapitation, and their anal canals were quickly removed and transferred to
oxygenated (95% O2-5% CO2) Krebs physiological solution (KPS) of
the following composition (in mM): 118.07 NaCl, 4.69 KCl, 2.52
CaCl2, 1.16 MgSO4 1.01 NaH2PO2, 25 NaHCO3, and 11.10 glucose
(37C). The experimental protocols were approved by the Institutional
Animal Care and Use Committee of Thomas Jefferson University and
were in accordance with the recommendations of the American
Association for the Accreditation of Laboratory Animal Care.
Force measurement. IAS tissues were dissected from the anal canals
of the adult and aging rats in KPS. The serosa, adventitia with blood
vessels, longitudinal smooth muscle layer, and mucosa and submucosa
were carefully removed, and 1 10-mm strips of the circular smooth
muscle (CSM) layer were prepared and hung in 2-ml muscle baths
containing oxygenated KPS. Initially, we applied a tension of 1.0 g and
then allowed the strips to equilibrate for 60 min. To determine the
amplitude of active basal tone in each strip, we determined the relaxing
effects of Ca2-free (0 Ca2) KPS in the beginning and at the end of each
experiment. All force data were monitored using force transducers
(model FT03, Grass Instruments, Quincy, MA) and Chart 4.1.2 via a
PowerLab/8SP data-acquisition system (ADInstruments, Colorado
Springs, CO). We determined the effect of 3 105 M LY83583 (an
oxidative stress inducer) on basal IAS tone and on U46619 (106
M)-induced contraction in the IAS before and after SOD. IAS smooth
muscles were identified by development of steady basal tone that responded to immediate relaxation following electrical field stimulation
(0.520 Hz, 0.5-ms pulse, 12 V, 4-s train duration).
Isolation of SMCs and cell culture. SMCs from the IAS were
isolated as described previously (38). Briefly, IAS tissues from the
CSM layer of the anal canal from adult and aging rats were cut into
1-mm cubes, and the SMCs were dispersed using repeated shortterm incubations with oxygenated KPS containing 0.1% collagenase
type I and 0.01% soybean trypsin inhibitor at 37C for 1 h. Finally, the
cell suspension was filtered through a 500-m Nitex mesh. The tissue
trapped on the mesh was rinsed with 25 ml (5 5 ml) of collagenasefree KPS and incubated in collagenase-free KPS at 37C. The filtrate
containing the cells was centrifuged at 350 g for 10 min at room
temperature. The cells in the pellet were resuspended on collagencoated plates in DMEM with 5% fetal bovine serum, 5% penicillinstreptomycin, 50 g/ml gentamicin, 2 g/ml amphotericin B, and 50
g/ml sodium ascorbate (5) in 100-mm tissue culture dishes (Corning) at 37C and 5% CO2 in an incubator with regulated humidity.
Measurements of SMC length. Freshly isolated SMCs were resuspended in oxygenated KPS (at 37C) at a density of 3 104 cells/ml
in 100-l aliquots and exposed to different concentrations of
LY83583 and RhoA activator for 3 min. SMCs were then fixed with
acrolein (final concentration 1%) and transferred onto chrome-alumcoated glass slides (Fisher Scientific, Pittsburgh, PA). The studies
were repeated in the presence of SOD and LY83583, respectively.

Individual cell lengths were measured by micrometry using phasecontrast microscopy (19) with a custom-assembled microscope
(Olympus, Tokyo, Japan) and a closed-circuit video camera (model
MC-7, PULNiX America, Sunnyvale, CA) connected to a personal
computer. Images of the cells were stored digitally, and cell lengths
were measured by Image-Pro Plus version 4.0 (Media Cybernetics,
Silver Spring, MD). Shortening of SMCs in each category of experiments was calculated as percentile of original cell length.
RT-PCR analysis. mRNAs were isolated from the smooth muscle
strips and the SMCs using the TRIzol method. The smooth muscle
tissues were flash-frozen in liquid N2 and homogenized in 1 ml of
TRIzol reagent (Sigma). SMCs were washed with PBS and lysed in 1
ml of TRIzol reagent. Then chloroform (200 l) was added to tissue
and SMC samples, and the samples were mixed vigorously. Solutions
were centrifuged at 1,500 rpm for 5 min at room temperature, and the
aqueous layer was collected into a separate tube. A 0.7 volume of
isopropanol was added to the tube, the contents were mixed gently,
and the solution was centrifuged for 12 min at 15,000 rpm. The
supernatant was discarded carefully to ensure that the pellet was
undisturbed. The pellet was then washed twice with 70% ethanol, and
RNA was dissolved in diethyl pyrocarbonate-treated RNase-free distilled water. RNA quality was assessed on 0.8% agarose gel and
quantified using a NanoDrop spectrophotometer as the ratio of fluorescence at 260 nm to fluorescence at 280 nm and the ratio of
fluorescence at 260 nm to fluorescence at 230 nm.
RNA (1 g) was reverse-transcribed using the Sensiscript RT kit
for mRNA (Qiagen, Valencia, CA). RhoA, ROCK II, and GAPDH
cDNAs were amplified using gene-specific forward and reverse primers (Table 1). PCRs were carried out with GoTaq Green Master Mix
(Promega) using an Eppendorf Mastercycler personal thermocycler

Fig. 1. Effect of aging on basal internal anal sphincter (IAS) tone. IAS tone was
significantly decreased in aging compared with adult rats. Values are means
SE of 4 animals. *P 0.05.

AJP-Gastrointest Liver Physiol doi:10.1152/ajpgi.00087.2014 www.ajpgi.org

AGING-ASSOCIATED IAS DYSFUNCTION

(Fisher, Allentown, PA). The PCR cycle consisted of 94C for 5 min,
94C for 30 s (denaturation phase), 60C for 30 s (annealing phase),
and 72C for 1 min. PCR products were separated on a 1.5% (wt/vol)
agarose gel containing ethidium bromide and visualized with UV
light, and pictures were taken using the GelDoc-It gel documentation
system (UVP). Relative densities of RhoA and ROCK II were calculated by normalization of the densities of each blot to the density of
GAPDH.
Western blot analysis. IAS smooth muscle strips and SMCs from
adult and aging rats, before and after treatment with LY83583, were
flash-frozen in liquid N2, suspended in ice-cold homogenization
buffer (10 mM TrisHCl, pH 7.5, 5 mM MgCl2, 2 mM EDTA, 250
mM sucrose, 1 mM dithiothreitol, and 1% Triton X-100), and homogenized using an IKA Ultra-Turrax T8 tissue homogenizer (Werke).
The extracts were centrifuged at 800 g for 10 min, and protein
concentration in the resultant supernatant was determined using a
bicinchoninic acid protein assay reagent kit (Pierce, Rockford, IL).
Twenty micrograms of protein in 20 l of lysates were mixed with 2
Laemmli sample buffer (with final concentrations of 62.5 mM Tris,
1% SDS, 15% glycerol, 0.005% bromophenol blue, and 2% mercaptoethanol) and placed in a boiling water bath for 5 min. Proteins in the
samples were separated by SDS-polyacrylamide gel [7.5% gel for
ROCK II, phosphorylated (Thr696) MYPT1, and MYPT1; 15% gel for
RhoA, MLC20, and phosphorylated (Thr18/Ser19) MLC20] and then
electrophoretically transferred onto polyvinylidene difluoride membranes using the iBlot dry blotting system (Invitrogen, Carlsbad, CA)
at room temperature.
To block nonspecific antibody binding, the membranes were
soaked for 1 h at room temperature in LI-COR Odyssey blocking
buffer and then incubated with the specific primary antibodies (1:
1,000 dilution of RhoA, ROCK II, pMYPT1, MYPT1, MLC20,
pMLC20, and GAPDH) diluted in LI-COR buffer containing 0.1%
Tween 20 for 1 h at room temperature. After three 10-min wash cycles
in Tris-buffered saline-Tween 20, the membranes were incubated with

G985

the IRDye680- and IRDye800-conjugated secondary antibody (LICOR Biosciences) in darkness [bovine anti-rabbit (1:10,000 dilution)
for RhoA/ROCK II, MYPT1, pMYPT1, and MLC20; bovine anti-goat
(1:5,000 dilution) for pMLC20]. After three more 10-min wash cycles
in Tris-buffered saline-Tween 20, the membranes were kept in PBS
buffer on a shaker for 10 min at room temperature in darkness and
scanned using a LI-COR infrared scanner, and the integrated optical
densities were determined using ImageJ software (National Institutes
of Health, Bethesda, MD). The relative densities were calculated by
normalization of the expression of each protein to that of GAPDH.
Oxidative stress quantification. The oxidative stress measurement
protocol was adopted from previously published studies (36). Briefly,
a CSM layer from the IAS of adult and aging rats was carefully
isolated, and unfixed preparations were incubated in 2 M DHE at
37C for 60 min in light-protected tubes. The whole mounts were
washed three times with Krebs-Ringer HEPES solution (in mM: 130.0
NaCl, 1.3 KCl, 2.2 CaCl2, 1.2 MgSO4, 1.2 KH2PO4, 1.0 HEPES, and
0.09 glucose, pH 7.4; Sigma) and mounted on slides with Prolong
Gold mounting medium (Invitrogen), and coverslips were applied.
Microscopic images were taken using a Nikon Eclipse 80i microscope
and an Olympus IX71 inverted microscope and analyzed using Nikon
imaging software (NIS-Elements, version 3.1, Nikon Instruments,
Melville, NY; Center for Translational Medicine, Department of
Medicine, Thomas Jefferson University). Images were captured with
identical exposure settings and relative intensities were calculated
without adjustments for brightness or contrast.
For assessment of O2 production in the SMCs, SMCs from the
IAS of adult and aging rats were grown on coverslips or in 96-well
plates. SMCs were treated with different agents for different time
periods. SMCs were preloaded with DHE (5 M) in DMEM for 30
min and then washed with medium. LY83583 (105 M) was added to
the DHE-treated cells, which were then incubated at 37C for 10 min.
The effect of 200 U/ml SOD on DHE fluorescence was also determined.

Fig. 2. A: RT-PCR data show significantly lower gene expression of RhoA and ROCK II in IAS tissues from aging (Ag) than adult (Ad) rats. Values are means
SE of 4 animals. *P 0.05. B: Western blot (WB) data show significantly lower expression of RhoA and ROCK II in IAS from aging than adult rats. Values
are means SE of 4 animals. *P 0.05.
AJP-Gastrointest Liver Physiol doi:10.1152/ajpgi.00087.2014 www.ajpgi.org

G986

AGING-ASSOCIATED IAS DYSFUNCTION

To preserve the fluorescence signal, the cells were mounted with

Prolong Gold mounting medium, and coverslips were applied. The
slides were examined under the UV microscope, and photographs
were taken under a Texas Red filter. Intensity of fluorescence (intensity per unit area, normalized to 1 in controls) was measured using
Image-Pro software, and graphs were plotted using Prism version 5.1.
Chemicals and drugs. Bovine erythrocyte SOD and 6-anilino-5,8quinolinedione (LY83583) were obtained from Sigma; tin protoporyphyrin IX (SnPP IX) from Porphyrin Products (Logan, UT); U46619
and Y27632 from Biomol (Plymouth Meeting, PA); MLC20 antibodies from Sigma (St. Louis, MO); GAPDH, RhoA, ROCK II, MYPT1,
phosphorylated (Thr696) MYPT1, and phosphorylated (Thr18/Ser19)
MLC20 antibodies from Santa Cruz Biotechnology (Santa Cruz, CA);
IRDye680- and IRDye800-conjugated mouse, goat, and rabbit secondary antibodies from LI-COR Biosciences; and RhoA activator
(cell-permeable calpeptin, catalog no. CN01-A) from Cytoskeleton
(Denver, CO).
Data analysis. Values are means SE from at least four independent experiments and plotted using Prism 5.1 (GraphPad Software, La
Jolla, CA). Students unpaired t-test was used to compare two different groups. P 0.05 was considered to be statistically significant.
RESULTS

Effect of aging on basal IAS tone. Basal IAS tone was

significantly lower in aging than adult rats: 21.0 3.0 vs.
51.0 0.6 mg/mg tissue wt (P 0.05, n 4; Fig. 1).
Effect of aging on RhoA/ROCK II expression. RT-PCR data
from IAS smooth muscle tissues showed significantly lower

expression of RhoA (0.61 0.021 vs. 0.86 0.031, P 0.05,

n 4) and ROCK II (0.33 0.017 vs. 0.54 0.033, P 0.05,
n 4) in aging than adult rats. Similarly significant differences
in IAS tissues between adult and aging rats were obtained
using Western blot analysis for protein expression levels.
RhoA levels were 0.70 0.032 vs. 0.56 0.02, while ROCK
II levels were 0.54 0.030 vs. 0.43 0.017, in adult vs. aging
rats, respectively (P 0.05, n 4; Fig. 2). These data suggest
that the major molecular determinants of basal IAS tone,
RhoA/ROCK (28, 29, 32, 33, 35), were significantly lower in
IAS from aging rats.
Increase in oxidative stress in IAS tissues and SMCs from
aging rats. We monitored oxidative stress in intact smooth
muscles and SMCs via DHE staining, which is known to
specifically stain intracellular ROS (12). Data revealed significantly higher levels of DHE fluorescence in SMCs from aging
than adult rats (4.0 0.67 vs. 1.0 0.56, P 0.05, n 4;
Fig. 3, A and B). These data suggest significantly higher levels
of O2 in the IAS during aging.
The oxidative stress inducer LY83583 mimics aging-related
decrease in basal IAS tone. LY83583 has been widely used to
induce an increase in O2 production in SMCs (8). Treatment
of IAS smooth muscle strips from adult rats with 10 M
LY83583 significantly increased O2 production, as validated
by a significant increase in DHE staining (from 1.0 0.50 to
4.0 0.45, P 0.05, n 4; Fig. 3, A and B). These values in

Fig. 3. A: immunofluorescent images of dihydroethidium (DHE)-stained IAS circular smooth muscle (CSM) layer from adult and aging rats. B: quantitative data
from images in A. LY83583 (LY) causes a significant increase in oxidative stress in the adult rats, comparable to that in aging rats. Values are means SE of
4 animals. *P 0.05. C: immunofluorescent images of IAS smooth muscle cells (SMCs) from adult rats. D: quantitative data from images in C. Pretreatment
with LY83583 caused a significant increase in oxidative stress that was significantly attenuated by pretreatment with 200 U/ml SOD. Changes in O2 (as a
measure of oxidative stress) were monitored by DHE fluorescence, which shows an increase in O2 by LY83583 and during aging and attenuation of O2 by
SOD (reflecting a decrease in oxidative stress by conversion of O2 to H2O2). Cont, control. Values are means SE of 4 animals. *P 0.05.
AJP-Gastrointest Liver Physiol doi:10.1152/ajpgi.00087.2014 www.ajpgi.org

AGING-ASSOCIATED IAS DYSFUNCTION

G987

Fig. 4. A: LY83583 (3 105 M) produces a significant decrease in basal IAS tone in adult rats (n 5) that is significantly attenuated by pretreatment with
200 U/ml SOD (n 4). Values are means SE. *P 0.05. B: LY83583 causes a concentration-dependent increase in IAS SMC length that is significantly
attenuated by SOD. Values are means SE of 30 40 cells pooled from 4 animals for each set of experiments. *P 0.05. C: RhoA activator results in a decrease
in SMC length that is significantly blocked by LY83583. Values are means SE of 4 animals. *P 0.05.

IAS from adult rats pretreated with LY83583 were not significantly different from values in tissues from aging rats (P
0.05; Fig. 3, A and B). Similar increases in DHE fluorescence
were observed in SMCs treated with LY83583 (Fig. 3, C and
D). The specificity of increases in oxidative stress following
LY83583 was confirmed by significant blockade of DHE
staining by pretreatment of cells with SOD (P 0.05, n 4;
Fig. 3, C and D).
Decrease in basal IAS tone by LY83583 and reversal by
SOD. These studies performed in adult animals revealed that
LY83583 (3 105 M) produced a significant decrease in
basal tone of 31.0 8.0% (from 100% of basal to 69.3
7.8%, P 0.05, n 4; Fig. 4A). To determine the specificity
of the inhibitory effect of LY83583 in IAS smooth muscle,
we examined the rescuing effect of LY83583 by SOD. Data

revealed that SOD significantly reversed the inhibitory effect of LY83583 to levels (90.0 6.5%) not significantly
different from the basal levels (P 0.05, n 4; Fig. 4A).
In the same series of experiments, we found that SOD by
itself had no significant effect on basal tone. These data
revealed that the inhibitory effect of LY83583 on IAS tone
was primarily via an increase in oxidative stress by increased production of O2.
A direct effect of LY83583 on the decrease in IAS tone was
confirmed by its inhibitory effect on IAS SMCs. LY83583
(109106 M) caused a concentration-dependent increase in
IAS SMC length; 107 M LY83583 was the maximal inhibitory concentration (Fig. 4B). In addition, this relaxant effect of
LY83583 was significantly attenuated by pretreatment of the
cells with SOD (P 0.05; Fig. 4B).

Fig. 5. A: U46619 causes an increase in basal IAS tone that peaks at 10 min following its administration. This increase in IAS tone is significantly and similarly
inhibited by LY83583 and Y27632 within 5 min of their administration. Values are means SE of 4 animals. *P 0.05. B: increase in IAS tone by U46619
is similarly inhibited by pretreatment with LY83583 or Y27632. C: traces showing inhibitory effect of LY83583 and Y27632 (Y2) on the U46619-induced
increase in IAS tone.
AJP-Gastrointest Liver Physiol doi:10.1152/ajpgi.00087.2014 www.ajpgi.org

G988

AGING-ASSOCIATED IAS DYSFUNCTION

Inhibitory effects of LY83583 and Y27632 on the increase in

IAS tone caused by Rho activator and U46619. LY83583
(107 M) caused significant attenuation of the SMC contraction produced by RhoA activator (P 0.05; Fig. 4C). Previously published studies from our laboratory in the IAS (11) and
those of others using different smooth muscles (43) showed
that U46619 produces sustained and concentration-dependent
contraction via RhoA/ROCK activation. The present data show
that, following sustained IAS contraction with U46619 (106
M), LY83583 caused an immediate and precipitous decrease in
IAS tone (Fig. 5A); the U46619-induced increase in IAS tone
lasts 45 min. This inhibitory effect of LY83583 on IAS tone
following sustained contraction with U46619 was similar to
that with the ROCK inhibitor Y27632 (Fig. 5A). Quantitative
data in Fig. 5B show the absolute changes in IAS tone in the
basal state following maximal sustained contraction at 10 min
after U46619 and at peak relaxation with LY83583 and
Y27632. Typical traces in Fig. 5C show the inhibitory effects

of LY83583 and Y27632 on IAS contraction caused by

U46619.
Inhibition of RhoA/ROCK and downstream signal transduction in the IAS by LY83583. In these experiments using IAS
smooth muscle strips, LY83583 significantly decreased the
membranous expression levels of RhoA (from a normalized
control value of 1.0 to 0.30 0.05, P 0.05, n 4) and
ROCK II (from a normalized control value of 1.0 to 0.17
0.03, P 0.05, n 4; Fig. 6, A and B).
Similarly, RhoA/ROCK downstream signal transduction
data reveal that inhibitory effects of LY83583 on IAS tone are
associated with significant decreases in the levels of phosphorylated (Thr696) MYPT1 and phosphorylated (Thr18/Ser19)
MLC20 (P 0.05, n 4; Fig. 6, C and D). The abovedescribed data showing decreases in RhoA/ROCK at the membrane level and decreases in pMYPT1 and pMLC20 are similar
to data previously obtained with Y27632 in rat and human IAS
(28, 35).

Fig. 6. Western blots and corresponding

quantitative data [relative expression (Rel
Exp)] for the effect of LY83583 on particulate (P) and cytosolic (C) fractions of RhoA
and ROCK II in the IAS. A and B: particulate
RhoA and ROCK II levels were significantly
decreased in IAS smooth muscle tissue. Values are means SE of 4 animals. *P
0.05. C and D: phosphorylated (Thr696) myosin phosphatase target subunit 1 (pMYPT1)
and phosphorylated (Thr18/Ser19) regulatory
myosin light chain (pMLC20) were significantly decreased in the IAS following
LY83583. Values are means SE of 4 6
animals. *P 0.05. These data suggest
significant inhibition of the RhoA/ROCK
signal transduction cascade with LY83583.

AJP-Gastrointest Liver Physiol doi:10.1152/ajpgi.00087.2014 www.ajpgi.org

AGING-ASSOCIATED IAS DYSFUNCTION

Together, these data suggest that an increase in oxidative

stress (mimicked by LY83583) causes a decrease in IAS tone
by its action directly at the SMC and via RhoA/ROCK inhibition.
DISCUSSION

These studies, for the first time, demonstrate the role of

oxidative stress on the aging-associated decrease in IAS tone
and the underlying control mechanisms, as depicted in the
model in Fig. 7. On the basis of the present findings, we
conclude that 1) AADI is associated with an increase in
oxidative stress, 2) oxidative stress is, in part, responsible for
the AADI that corresponds with disruption of the underlying
molecular control mechanisms RhoA/ROCK and the downstream signaling cascade, and 3) the antioxidant SOD (a O2
scavenger) successfully reverses oxidative damage in the IAS.
Rectoanal or fecal incontinence (RI) is known to have a
devastating impact on quality of life (24). Although the etiology of RI is multifactorial, a recent study demonstrates that age
is an independent predictor of RI after adjustment for the
number of chronic illnesses, overall health status, and physical
activity (50). Pathophysiology of aging-associated RI is not
clearly understood. Knowledge of the molecular mechanisms
and factors leading to AADI may hold the key in the therapeutic management of RI, at least in a certain category of
patients with hypotensive IAS. Using a multipronged approach
of functional and molecular biology, we evaluated the role of
aging-associated oxidative stress in the IAS in adult (4 6 mo
old) and aging (24 30 mo old) rats.
The present data suggest that aging leads to a decrease in the
basal tone of the IAS due to downregulation of the RhoA/
ROCK signal transduction cascade. Previously published studies from our laboratory show the critical role of the RhoA/
ROCK pathway in maintaining the basal tone of the IAS in

Fig. 7. Simplified model for the mechanism of oxidative stress in the decrease
in IAS tone during aging. An increase in ROS is a consequence of imbalance
between levels of antioxidants (e.g., SOD, catalases, and heme oxygenase-1)
and oxidants (e.g., O2, hydroxyl ions, ferryl ions, and heme) that may cause
oxidative damage within IAS SMCs, leading to downregulation of the RhoA/
ROCK and downstream signal transduction cascade. The net effect of these
events leads to decreased IAS tone. We have used LY83583 to mimic
generation of ROS and SOD to attenuate their damaging effect.

G989

humans and rats (28, 33, 35). Accordingly, spontaneously

active RhoA leads to autophosphorylation and activation of
ROCK. The latter leads to phosphorylation of MYPT1, thus
inhibiting MLC phosphatase, and an increase in the levels of
pMLC20. Therefore, it follows that low levels of RhoA/ROCK
in aging may unleash MLCP, causing dephosphorylation of
pMLC20 and, thus, a reduction of basal IAS tone. In support of
our studies, data from rat colon have shown reduced colonic
motility associated with downregulation of the RhoA/ROCK
signaling cascade with aging (40, 41). The present data, however, add a new dimension to the existing knowledge; i.e.,
these aging-associated changes in basal tone are due to increased oxidative stress during aging. Additionally, it is conceivable that aging may also adversely affect neurally mediated
rectoanal inhibitory reflex-induced relaxation of the IAS; this
aspect, however, is not within the scope of the present investigation.
Oxidative stress has been implicated in many diseases,
including the aging-associated decrease in gastrointestinal
smooth muscle tone (17, 37). The increase in oxidative stress
is a consequence of imbalance between an increase in ROS
production and a decrease in the bodys antioxidant mechanisms (1, 16). Evidence in support of a relationship between
oxidative stress and AADI emerges from our experiments with
LY83583, which successfully induced oxidative stress in IAS
smooth muscle tissues and SMCs, as demonstrated by the
increase in DHE fluorescence intensity. The ability of
LY83583 to generate O2 (25) is confirmed by nearly complete reversal of the LY83583-induced increase in DHE fluorescence intensity by SOD. The data further suggest that an
increase in oxidative stress in LY83583-treated adult rats is
similar to that in untreated aging rats. These data suggest that
induction of oxidative stress in adult animals mimics aginginduced effects on the IAS.
Functional data showing a significant decrease in IAS tone
following pretreatment of the smooth muscles with LY83583
and its rescue by SOD further confirm the roles of oxidative
stress and free radicals in the decreased IAS tone during aging.
The present studies provide novel data that the oxidative
stress-induced decrease in IAS tone is associated with downregulation of the RhoA/ROCK pathway within IAS SMCs.
This is revealed by the similarities between the effects of
LY83583 and Y27632 (a ROCK inhibitor) on basal IAS tone
and on the precontracted IAS by a RhoA activator per se, as
well as via Rho/ROCK activation via U46619. Additional data
including the effect of LY83583 on the IAS SMC confirm
concentration-dependent relaxation of the SMC that is rescued
by pretreatment of the cells with SOD.
Western blot analysis of LY83583-treated IAS smooth muscles showing reduced protein expression of RhoA/ROCK and
its downstream targets pMYPT1 and pMLC20 compared with
control samples further confirms involvement of the RhoA/
ROCK pathway in oxidative stress. This was shown by a
significant shift in the levels of RhoA/ROCK from the membrane to the cytosol in IAS SMCs treated with LY83583. This
demonstrates a significant decrease in the activation of RhoA/
ROCK, as it has been shown that basal IAS tone is primarily
dependent on constitutively active RhoA/ROCK (29).
The role of oxidative stress in the decrease in IAS smooth
muscle tone is in agreement with data from other regions of the
gastrointestinal tract (37, 52). Similar data (a decrease in IAS

AJP-Gastrointest Liver Physiol doi:10.1152/ajpgi.00087.2014 www.ajpgi.org

G990

AGING-ASSOCIATED IAS DYSFUNCTION

tone; not shown) were obtained following pretreatment of IAS

smooth muscle strips and SMCs with other superoxide generators, 2,2=-azobis (2-amidinopropane) and 1,1-diphenyl-2-picryl-hydrazyl (2, 18, 30). These data from the gastrointestinal
smooth muscle are, however, different from data from certain
vascular smooth muscles, which showed superoxide-mediated
contraction via RhoA activation (7, 23). The exact reason for
the differences remains to be determined. A possible mechanism for this contraction is ROS-mediated inhibition of nitric
oxide effects (23, 25, 39), since the basal state of smooth
muscle contractility in those tissues is speculated to be a
consequence of a net balance between multiple intracellular
excitatory and inhibitory pathways. This implies that, in those
tissues, nitric oxide synthase (NOS) activation plays an important role in the equilibrium for the basal tone, and NOS
inhibition subsequent to oxidative stress may tilt the balance
toward raising the smooth muscle tone. In support of this
concept, we have observed that, in some experiments,
LY83583 produces an increase in IAS tone that is converted to
a decrease following treatment with the NOS inhibitor N-nitroL-arginine. Conversely, in the human IAS, none of the IAS
smooth muscle experiments displayed such a decrease in IAS
tone (data not shown). Therefore, it is possible that differences
in the responses to ROS may be tissue-specific and may depend
on the redox status of the tissues and the type of maneuvers
used to generate ROS. It is of interest that the effect of
oxidative stress has not been examined in the spontaneously
tonic smooth muscle tissues such as the IAS, which are driven
by upregulated RhoA/ROCK signal transduction machinery
(28, 29, 32, 33, 35), where NOS plays a limited role in the
spontaneous tone.
In summary, the present data suggest that oxidative stress
during aging plays a significant role in the mediation of
reduced basal IAS tone and that antioxidants such as SOD have
an important role in reversing the aging-associated oxidative
damage in IAS. In addition, these studies suggest a therapeutic
potential of such antioxidants in reversing the effect of agingassociated oxidative stress in the hypotensive IAS and, in turn,
in RI.

3.
4.
5.
6.
7.

8.
9.
10.
11.

12.

13.
14.
15.
16.
17.
18.

19.

GRANTS
This work was supported by National Institute of Diabetes and Digestive
and Kidney Diseases Grant RO1 DK-035385 and an institutional grant from
Thomas Jefferson University.

20.
21.

DISCLOSURES
No conflicts of interest, financial or otherwise, are declared by the authors.

22.
AUTHOR CONTRIBUTIONS
J.S., S.K., and C.V.K. performed the experiments; J.S. and C.V.K. analyzed
the data; J.S. and S.K. prepared the figures; J.S., S.K., C.V.K., and S.R. drafted
the manuscript; J.S., S.K., C.V.K., and S.R. approved the final version of the
manuscript; S.R. is responsible for conception and design of the research; S.R.
interpreted the results of the experiments; S.R. edited and revised the manuscript.
REFERENCES

23.

24.
25.

1. Barja G. Updating the mitochondrial free radical theory of aging: an

integrated view, key aspects, and confounding concepts. Antioxid Redox
Signal 19: 1420 1445, 2013.
2. Berrougui H, Martin-Cordero C, Khalil A, Hmamouchi M, Ettaib A,
Mahuenda E, Herrera MD. Vasorelaxant effects of harmine and harma-

26.

line extracted from Peganum harmala L. seeds in isolated rat aorta.

Pharmacol Res 54: 150 157, 2006.
Bharucha AE. Outcome measures for fecal incontinence: anorectal structure and function. Gastroenterology 126: S90 S98, 2004.
Bharucha AE, Rao SS. An update on anorectal disorders for gastroenterologists. Gastroenterology 146: 3745, 2014.
Bi D, Nishimura J, Niiro N, Hirano K, Kanaide H. Contractile properties of the cultured vascular smooth muscle cells: the crucial role played
by RhoA in the regulation of contractility. Circ Res 96: 890 897, 2005.
Bitar KN, Greenwood-Van Meerveld B, Saad R, Wiley JW. Aging and
gastrointestinal neuromuscular function: insights from within and outside
the gut. Neurogastroenterol Motil 23: 490 501, 2011.
Broughton BR, Jernigan NL, Norton CE, Walker BR, Resta TC.
Chronic hypoxia augments depolarization-induced Ca2 sensitization in
pulmonary vascular smooth muscle through superoxide-dependent stimulation of RhoA. Am J Physiol Lung Cell Mol Physiol 298: L232L242,
2010.
Cheng JC, Cheng HP, Tsai IC, Jiang MJ. ROS-mediated downregulation of MYPT1 in smooth muscle cells: a potential mechanism for the
aberrant contractility in atherosclerosis. Lab Invest 93: 422433, 2013.
Choi K, Chen J, Mitra S, Sarna SK. Impaired integrity of DNA after
recovery from inflammation causes persistent dysfunction of colonic
smooth muscle. Gastroenterology 141: 12931301, 2011.
Culver PJ, Rattan S. Genesis of anal canal pressures in the opossum. Am
J Physiol Gastrointest Liver Physiol 251: G765G771, 1986.
De Godoy MA, Rattan N, Rattan S. Arachidonic acid metabolites follow
the preferential course of cyclooxygenase pathway for the basal tone in the
internal anal sphincter. Am J Physiol Gastrointest Liver Physiol 296:
G727G734, 2009.
Demel SL, Dong H, Swain GM, Wang X, Kreulin DL, Galligan JJ.
Antioxidant treatment restores prejunctional regulation of purinergic transmission in mesenteric arteries of deoxycorticosterone acetate-salt hypertensive rats. Neuroscience 168: 335345, 2010.
Firth M, Prather CM. Gastrointestinal motility problems in the elderly
patient. Gastroenterology 122: 1688 1700, 2002.
Freeman BA, Crapo JD. Biology of disease: free radicals and tissue
injury. Lab Invest 47: 412426, 1982.
Fridovich I. Superoxide radical and superoxide dismutases. Annu Rev
Biochem 64: 97112, 1995.
Gemma C, Vila J, Bachstetter A, Bickford PC. Oxidative stress and the
aging brain: from theory to prevention. In: Brain Aging, edited by Riddle
DR. Boca Raton, FL: CRC, 2007.
Halliwell B, Gutteridge JM, Cross CE. Free radicals, antioxidants, and
human disease: where are we now? J Lab Clin Med 119: 598 620, 1992.
Hernandez L, Grasa L, Fagundes DS, Gonzalo MP, Arruebo MP,
Plaza MA, Murillo MD. Role of potassium channels in rabbit intestinal
motility disorders induced by 2,2=-azobis (2-amidinopropane) dihydrochloride (AAPH). J Physiol Pharmacol 61: 279 286, 2010.
Hillemeier C, Bitar KN, Sohn U, Biancani P. Protein kinase C mediates
spontaneous tone in the cat lower esophageal sphincter. J Pharmacol Exp
Ther 277: 144 149, 1996.
Jiang F, Zhang Y, Dusting GJ. NADPH oxidase-mediated redox signaling: roles in cellular stress response, stress tolerance, and tissue repair.
Pharmacol Rev 63: 218 242, 2011.
Jones OM, Moore JA, Brading AF, Mortensen NJ. Botulinum toxin
injection inhibits myogenic tone and sympathetic nerve function in the
porcine internal anal sphincter. Colorectal Dis 5: 552557, 2003.
Khaikin M, Bashankaev B, Sands D, Weiss EG, Zbar A, Wexner SD.
The effect of topical anal captopril on resting anal pressure in healthy
volunteers: the first human pilot study. Tech Coloproctol 18: 139 143,
2013.
Knock GA, Snetkov VA, Shaifta Y, Connolly M, Drndarski S, Noah A,
Pourmahram GE, Becker S, Aaronson PI, Ward JP. Superoxide
constricts rat pulmonary arteries via Rho-kinase-mediated Ca2 sensitization. Free Radic Biol Med 46: 633642, 2009.
Koughnett JA, Wexner SD. Current management of fecal incontinence:
choosing amongst treatment options to optimize outcomes. World J
Gastroenterol 19: 9216 9230, 2013.
Kumagai Y, Midorikawa K, Nakai Y, Yoshikawa T, Kushida K,
Homma-Takeda S, Shimojo N. Inhibition of nitric oxide formation and
superoxide generation during reduction of LY83583 by neuronal nitric
oxide synthase. Eur J Pharmacol 360: 213218, 1998.
Lazarescue A, Turnbull GK, Vanner S. Investigating and treating fecal
incontinence: when and how. Can J Gastroenterol 23: 301308, 2009.

AJP-Gastrointest Liver Physiol doi:10.1152/ajpgi.00087.2014 www.ajpgi.org

AGING-ASSOCIATED IAS DYSFUNCTION

27. Macias B, Gomez-Pinilla PJ, Camello-Almaraz C, Pascua P, Tresguerres JA, Camello PJ, Pozo MJ. Aging impairs Ca2 sensitization
pathways in gallbladder smooth muscle. Age 34: 881893, 2012.
28. Patel CA, Rattan S. Spontaneously tonic smooth muscle has characteristically higher levels of RhoA/ROK compared with the phasic smooth
muscle. Am J Physiol Gastrointest Liver Physiol 291: G830 G837, 2006.
29. Patel CA, Rattan S. Cellular regulation of basal tone in internal anal
sphincter smooth muscle by RhoA/ROCK. Am J Physiol Gastrointest
Liver Physiol 292: G1747G1756, 2007.
30. Peluso I, Campolongo P, Valeri P, Romanelli L, Palmery M. Intestinal
motility disorder induced by free radicals: a new model mimicking
oxidative stress in gut. Pharmacol Res 46: 533538, 2002.
31. Rao SS. Pathophysiology of adult fecal incontinence. Gastroenterology
126: S14 S22, 2004.
32. Rattan S, Benjamin P, Maxwell IV. RhoA/ROCK-kinase: pathophysiologic and therapeutic implications in gastrointestinal smooth muscle tone
and relaxation. Gastroenterology 138: 1318, 2010.
33. Rattan S, De Godoy MA, Patel CA. Rho kinase as a novel molecular
therapeutic target for hypertensive internal anal sphincter. Gastroenterology 131: 108 116, 2006.
34. Rattan S, Singh J. Basal internal anal sphincter tone, inhibitory neurotransmission, and other factors contributing to the maintenance of high
pressures in the anal canal. Neurogastroenterol Motil 23: 37, 2011.
35. Rattan S, Singh J. RhoA/ROCK pathway is the major molecular determinant of basal tone in intact human internal anal sphincter. Am J Physiol
Gastrointest Liver Physiol 302: G664 G675, 2012.
36. Roberts JA, Durnin L, Sharkey KA, Mutafova-Yambolieva VN,
Mawe GM. Oxidative stress disrupts purinergic neuromuscular transmission in the inflamed colon. J Physiol 591: 37253737, 2013.
37. Shi XZ, Lindholm PF, Sarna SK. NF-B activation by oxidative stress
and inflammation suppresses contractility in colonic circular smooth
muscle cells. Gastroenterology 124: 1369 1380, 2003.
38. Singh J, Maxwell IV, Rattan S. Immunocytochemical evidence for
PDBu-induced activation of RhoA/ROCK in human internal anal sphincter smooth muscle cells. Am J Physiol Gastrointest Liver Physiol 301:
G317G325, 2011.
39. Snetkov VA, Smirnov SV, Kua J, Aaronson PI, Ward JP, Knock GA.
Superoxide differentially controls pulmonary and systemic vascular tone
through multiple signalling pathways. Cardiovasc Res 89: 214 224, 2011.
40. Somara S, Bashllari D, Gilmont RR, Bitar KN. Real-time dynamic
movement of caveolin-1 during smooth muscle contraction of human

41.

42.
43.

44.
45.
46.
47.
48.
49.

50.
51.

52.

G991

colon and aged rat colon transfected with caveolin-1 cDNA. Am J Physiol
Gastrointest Liver Physiol 300: G1022G1032, 2011.
Somara S, Gilmont RR, Martens JR, Bitar KN. Ectopic expression of
caveolin-1 restores physiological contractile response of aged colonic
smooth muscle. Am J Physiol Gastrointest Liver Physiol 293: G240
G249, 2007.
Speakman CT, Hoyle CH, Kamm MA, Swash M, Henry MM, Nicholls
RJ, Chir M, Burnstock G. Abnormal internal anal sphincter fibrosis and
elasticity in fecal incontinence. Dis Colon Rectum 38: 407410, 1995.
Strittmatter F, Gratzke C, Weinhold P, Steib CJ, Hartmann AC,
Schlenker B, Andersson KE, Hedlund P, Stief CG, Hennenberg M.
Thromboxane A2 induces contraction of human prostate smooth muscle by
Rho kinase- and calmodulin-dependent mechanisms. Eur J Pharmacol
650: 650 655, 2011.
Thannickal VJ, Fanburg BL. Reactive oxygen species in cell signaling.
Am J Physiol Lung Cell Mol Physiol 279: L1005L1028, 2000.
Van der Vliet A, Tunistra TJ, Bast A. Modulation of oxidative stress in
the gastrointestinal tract and effect on rat intestinal motility. Biochem
Pharmacol 38: 28072818, 1989.
Voukali E, Shotton HR, Lincoln J. Selective responses of myenteric
neurons to oxidative stress in diabetic stimuli. Neurogastroenterol Motil
23: 964-e411, 2011.
Wade PR. Aging and neural control of GI tract. I. Age-related changes in
enteric nervous system. Am J Physiol Gastrointest Liver Physiol 283:
G489 G495, 2002.
Wald A. Faecal incontinence in the elderly: epidemiology and management. Drugs Aging 22: 131139, 2005.
Wang C, Houghton MJ, Gamage PP, Collins HE, Patel BA, Yeoman
MS, Ranson RN, Saffrey MJ. Changes in the innervation of the mouse
internal anal sphincter during aging. Neurogastroenterol Motil 25: e469
e477, 2013.
Whitehead WE, Borrud L, Goode PS, Meikle S, Mueller ER, Tuteja
A, Weidner A, Weinstein M, Ye W. Fecal incontinence in US adults:
epidemiology and risk factors. Gastroenterology 137: 512517, 2009.
Wiley JW. Aging and neural control of the GI tract. III. Senescent enteric
nervous system: lessons from extraintestinal sites and nonmammalian
species. Am J Physiol Gastrointest Liver Physiol 283: G1020 G1026,
2002.
Winston JH, Li Q, Sarna SK. Paradoxical regulation of ChAT and nNOS
expression in animal models of Crohns colitis and ulcerative colitis. Am
J Physiol Gastrointest Liver Physiol 305: G295G302, 2013.

AJP-Gastrointest Liver Physiol doi:10.1152/ajpgi.00087.2014 www.ajpgi.org