You are on page 1of 3

EE225/MatSci382/SBIO225 Bio-chips, Imaging and Nanomedicine

Homework #1 Cell Molecular Biology


Due Thursday, January 17,2013
(To be submitted in class or by 5pm to box outside McCullough 351)
1. An organism has a DNA with 60,000 kbp (kilo base pairs). It is known that 21% of the base
pairs contain T residues. Calculate the number of A,C,G and T residues in the DNA of each
cell in this organism. If RNA is transcribed from this DNA, calculate the number of residues
that would be present in the RNA.
2. Examine the following nucleotide sequence from the coding strand of DNA. What is the
mRNA strand that will be transcribed from this DNA and the amino acid sequence of the
encoded protein?
5 G T A A T T C A A A A T G C C T T A C G C C C C T G G A G A C G A A A A G A
AGGGTGCTATTACGTATTTGAAGAAGGCCACCTCTGAGTA
A A T G T G A C 3
After translation, it is observed that the amino acid sequence contains Ala-Pro-Arg. Explain
why and how this can occur.
3. Match each function in Column B with the proper cell structure in Column A.

COLUMN A

COLUMN B

1.

Ribosome

a. A long cell projection used to propel sperm cells

2.

Endoplasmic reticulum

b. Bags of digestive enzymes in the cell

3.

Golgi apparatus

c. Tube-like passages that carry substances through the


cytoplasm

4.

Mitochondria

d. Short hair-like structures on the free surface of some


cells

5.

Lysosomes

e. Chemically process and package substances from the


endoplasmic reticulum

6.

Flagella

f. Directs protein synthesis; the brain of the cell

7.

Cilia

g. Protein factories in the cell, made of RNA

8.

Nucleus

i. Powerhouse of the cell; most of the cell's ATP


(energy) is formed here

4. A biologist has received an optical dye from a friend in a liquid form. The friend did not
indicate what the concentration of the dye he sent is. However, he did mention that the
extinction coefficient of this dye is = 280,000 cm-1M-1 at the peak absorbance point. The
biologist then scanned the sample he received in his labs spectrophotometer using a 1.5 cm
cuvette and received the absorbance spectrum below. Can you help the biologist calculate
the concentration of the dye sample he received?

5.

A cloning vector v1 is 90K base pairs long (90 kbp):

where the two specified locations are recognized by EcoR1 (the restriction
endonuclease). We want to use EcoR1 to insert gene g1 into the vector. g1 is 20 kbp long.
We make 3 samples and run in a gel electrophoresis: v1 only, v1 with EcoR1, and v1 with
EcoR1 and gene g1.

Five bands are seen in the third column. Explain what each band in the third column
represents.
6. A cloning vector that has reporter gene such as lacZ is used to identify bacteria which have
insulin. Human DNA that encodes insulin is inserted into lacZ and this is introduced in the
bacterial colonies in the presence of X-gal. Blue and white colors are observed in the
colonies, explain what these signify.

You might also like