Journal of Archaeological Science 40 (2013) 465e470

Contents lists available at SciVerse ScienceDirect

Journal of Archaeological Science

journal homepage: http://www.elsevier.com/locate/jas

Ancient-DNA reveals an Asian type of Mycobacterium leprae in medieval

Scandinavia
Christos Economou a, *, Anna Kjellstrm b, Kerstin Lidn a, Ioannis Panagopoulos a
a
Archaeological Research Laboratory, Stockholm University, Wallenberglaboratoriet, Lilla Frescativgen 7, 114 18 Stockholm, Sweden
b
Osteoarchaeological Research Laboratory, Stockholm University, Wallenberglaboratoriet, Lilla Frescativgen 7, 114 18 Stockholm, Sweden

a r t i c l e i n f o a b s t r a c t

Article history: Leprosy is a chronic infection of the skin and peripheral nerves caused by the pathogen Mycobacterium
Received 9 March 2012 leprae. Its impact on human populations and societies of the past as well as its phylogeographic patterns
Received in revised form around the world e at least in modern times e has been well documented. This slow growing bacterium
10 July 2012
has been shown to exist in distinct SNP types that occur in relatively dened parts of the globe. The
Accepted 11 July 2012
routes that the disease followed in the past are, however, still uncertain. This study of ancient-DNA
typing of archaeological human remains from Sweden dated to early Medieval times provides genetic
Keywords:
evidence that a transmission of M. leprae SNP subtype 2G e found mainly in Asia e took or had already
Ancient DNA
Leprosy
taken place at that time from the Middle East to Scandinavia. This nding is unique in the history of
Scandinavia leprosy in Europe. All human specimens from this continent e both modern and ancient e that have
Palaeopathology been tested to date showed that the one responsible for the infection strains of M. leprae belong to SNP
Phylogeography type 3, whereas our results show that there were some European populations that were hosts to bacteria
Microbial disease representing SNP type 2 of the species as well.
Middle Ages 2012 Elsevier Ltd. All rights reserved.

1. Introduction Manchester, 1984; Sabbatani and Fiorino, 2010). More concrete

The dramatic effect that leprosy and its symptoms had on past
human societies can easily be deduced from the various references
to the disease found in texts dating back to 600 BC from India, from
descriptions by ancient Greek and Roman physicians, from refer-
ences in Biblical stories, and from the leprosaria that were founded
during the Middle Ages in Europe. The stigmatization of its victims
is evident from the way they were treated as the common belief of
the time would ascribe supernatural reasoning to the phenomenon.
People who had been diagnosed as lepers by the various religious
authorities through the centuries were obliged to live in exile, wear
special insignia and were isolated from social life. It can often be
disputed, however, whether the disease-states described in these
ancient accounts can in fact be attributed to leprosy, either because
the description of the symptoms is too general, as in the case of the
Old Testaments zaraath, or because they better conform to other
diseases with similar symptoms such as psoriasis. The latter is
thought to be the case for the Hippocratic term lepra where
leprosy takes its name from (Browne, 1975; Carmichael, 2008b;
* Corresponding author. Tel.: 46 08 16 2176.
E-mail addresses: christos.economou@arklab.su.se (C. Economou),
anna.kjellstrom@o.su.se (A. Kjellstrm), kerstin.liden@arklab.su.se (K. Lidn).
evidence for the presence and prevalence of actual leprosy through
the ages can now be obtained from the eld of palaeopathology;
either by the macroscopic or biomolecular examination of human
remains. The oldest physical evidence of leprosy probably comes
from skeletal remains in India dated to 2000 BC (Robbins et al.,
2009). Historically, the disease is thought to have reached the
Mediterranean with the returning army of Alexander the Great,
although this view has been criticized (Grimm, 2005 by Monot
et al., 2005). Alternative explanations, such as leprosy reaching
Egypt somewhat earlier through young slaves from India (Mark,
2002) have also been advanced. Leprosy became prevalent in
Europe in the 12the13th centuries AD. The disease subsequently
declined in continental Europe, but in some areas of Scandinavia it
persisted until the late 19th century, with cases being reported
during the 20th century as well (Stone et al., 2009; Sundelin and
Srman, 2004). The decline of the disease in Europe may be
attributable to the rise of another disease, tuberculosis, which
provides cross-immunity against leprosy (Donoghue et al., 2005).
In other parts of the world such as central/south Asia, Brazil and
Africa, however, leprosy remains a health problem with over
200,000 new cases reported per year.
The physiology of leprosy (also known as Hansens disease after
the Norwegian physician who identied its causative agent in 1873)

0305-4403/$ e see front matter 2012 Elsevier Ltd. All rights reserved.
http://dx.doi.org/10.1016/j.jas.2012.07.005
466 C. Economou et al. / Journal of Archaeological Science 40 (2013) 465e470
has e also e been extensively studied during the last century.
Caused by the slow growing bacterium Mycobacterium leprae,
leprosy is a chronic granulomatous infection that damages the skin
and peripheral nerves causing characteristic disabilities and
deformities (Lockwood, 2003; Britton and Lockwood, 2004). The
pathogen prefers to colonize the cooler parts of the hosts body and
due to its usual transmission through inhalation one of the com-
monest affected parts is the nasal area. The categorization of the
clinical manifestations of the disease is based on the hosts immune
system reaction against the M. leprae bacteria and ranges from
tuberculoid, where the immunological response is high and the
bacterial load low, to lepromatous form, where low immunity leads
to heavy bacterial load. A number of intermediate borderline forms
that vary according to the patients treatment towards one of the
two stable poles have been described by Ridley and Jopling (1966).
In severe cases, leprosy even affects the bones leaving characteristic
lesions (Boldsen, 2001) that can be identied by osteo-
archaeologists (Fig. 1). This makes it possible to infer the presence
and prevalence of the disease in centuries past e even when no
written documentation or other historical evidence exists. In the
last couple of decades an even more sophisticated method for
tackling with diseases of the past has emerged; that of ancient DNA
(aDNA), meaning it has become possible not only to certify the
presence of pathogens in archaeological material by targeting
species-specic nucleotide sequences but also to comment on their
various strains and types at each particular place and time and,
thus, get new insights into their spread and evolution (Drancourt
and Raoult, 2005; Zink et al., 2002). Several studies have also
tackled the evolution and adaptation of the human genome in
terms of the immunity it provides to the host against the infection.
A number of loci, such as human leukocyte antigen (HLA) genes
(Geluk and Ottenhoff, 2006), Toll-like receptor 1, HLA-DRB1/DQA1
(Misch et al., 2008; Wong et al., 2010) and PARK2/PACRG (Bakija-
Konsuo et al., 2011) have been identied as major determinants
of leprosy susceptibility. M. leprae is considered to be a genetically
monomorphic bacterium with extremely low levels of genetic
diversity (Achtman, 2012). An evolutionary bottleneck
(Frothingham, 1999) has left the bacteriums genome severely
reduced in length to just 3.3 Mb, only half of which is comprised of
functional genes (Singh and Cole, 2011 by Cole et al., 2001). This
genome reduction has negatively affected the metabolic features of
the microbe making it an obligate intracellular pathogen whose
only natural reservoirs are humans and wild armadillos in America;
a continent where the disease was absent before its colonisation by
Fig. 1. An adult male (S.I. 3159) showing pencilling deformities of the left fourth and
fth metatarsals.
Europeans (Truman et al., 2011). Another consequence of this
limited metabolic function is the long incubation time of the
bacterium; in the case of lepromatous leprosy it can take more than
ten years from the time of infection for the disease to develop.
Comparative genomics studies, such as the ones mentioned above,
have shown that very low levels of genetic variability do exist
among different strains of M. leprae around the globe. Our current
tools for inferring the phylogeographical patterns of the microbe
are mainly based on the model by Monot et al. (2005) where four
combinations of three Single Nucleotide Polymorphisms (SNPs)
distinguish between four different SNP types (type 1, 2, 3 and 4)
of the pathogen, each strongly associated with a distinct
geographical area. SNP type 2 in particular seems to be connected
with central Asia/Middle East and East Africa, whereas Europe is
plagued by SNP type 3. Later studies (Monot et al., 2009) added
more markers (SNPs and InDels) to the model, thereby increasing
this informative differentiation by further dividing the four SNP
types into sixteen SNP subtypes, which retained their geograph-
ical connections. Analyses of archaeological material suggest that
these geographical connections apply to ancient distributions of
the pathogen as well as the modern one (Taylor et al., 2006; Taylor
and Donoghue, 2011; Watson and Lockwood, 2009). All of these
studies agree on the pattern that ascribes SNP type 3 as the sole
type of M. leprae found in Europe, both in the past and the present
day (Fig. 2).
In this study aDNA methods were employed to type skeletal
remains that had previously been examined for skeletal signs of
leprosy and had been differentially diagnosed as having suffered
from the disease (Kjellstrm, 2010). The skeletons came from Sig-
tuna, Sweden, and dated to 10the14th centuries AD. Sigtuna was
a commercial and administrative centre at the time. Various grave-
goods and other nds imply that the town had trade connections
with places as far away as the Middle East, as has also been
established for the preceding Viking Age for this area of Scandi-
navia (Fig. 2). Previous studies have provided biomolecular
evidence of leprosy in Sweden at that time (Nuorala et al., 2004;
Donoghue et al., 2005).
2. Materials and methods
2.1. Samples
In total ten skeletons were analysed for M. leprae genomic
sequences (Table 1). Eight of them had previously been charac-
terised as showing bone lesions indicative of leprosy. The speci-
mens were excavated in 2006 from two cemeteries in Sigtuna
dating to early Medieval times. Radiocarbon and stratigraphy
methods have calculated skeletons S.I. 34 and 19 to date from 900 to
1100 AD while the rest were dated to 1100e1300 AD (Kjellstrm
et al., 2005, Kjellstrm and Wikstrm, 2008). Six different bones
e mainly metatarsals, metacarpals and vertebrae e from each
skeleton were sampled (w100 mg per sample) in order to increase
the likelihood of targeting the preserved mycobacterial DNA and
check which parts of the skeleton would be best targeted in future
leprosy projects. Of those six bones per skeleton, three were
sampled twice and three once, totalling nine samples per
individual.
2.2. Methods
The samples were incubated at 37  C for three days in a solution
of EDTA, Triton X and Proteinase K in order to release the nucleic
acids from the bone minerals and proteins. The extraction was
performed according to a slightly modied (increased volume of
reagents) version of Yang et al.s (1998) protocol and using the
 C. Economou et al. / Journal of Archaeological Science 40 (2013) 465e470 467

Fig. 2. Map of Europe and the Middle East depicting the eastward trade-routes and connections of Scandinavians at the time (Viking age/ early Medieval), as well as the distribution
of the M. leprae SNP types that have been detected so far (from both modern and archaeological samples).

QIAquick PCR Purication Kit by Qiagen for the purication step. 2.3. Contamination prevention measures
The initial analysis targeted the RLEP repetitive element that is
considered specic to M. leprae, in order to test which of the Both extraction and PCR negative controls were used in order to
specimens exhibited preserved DNA sequences of the bacterium ensure that no contamination from the laboratory would interfere
and thus attest the osteological interpretations. This was performed with our results. In addition, no previous research on the SNP
by nested-PCR using primers (LP1, LP2, LP3, LP4) and cycle types of M. leprae had ever taken place in our department before.
parameters previously described (Donoghue et al., 2001) giving All sampling and extraction steps were performed at the dedicated
products of 129bp and 99bp fragments of the RLEP element. For the to ancient-DNA laboratory of Stockholm University. All the
SNP types and subtypes we used primers (Table 2) designed common practices for such areas (UV-irradiation of the workplace
according to Monot et al.s (2005 & 2009) supplementary material and samples, mechanical removal of the outer surface of the bones,
papers and guidance from one of their authors. All the PCR products cleaning with NaOCl bleach, wearing protective suits and
exhibiting specic band upon agarose (3%) gel electrophoresis were disposable gloves and masks among others) were followed. Post-
sent to be sequenced at Karolinska Institute, Stockholm, after being PCR analysis was performed at another department (Zoology) of
treated with ExoSAP-IT that would remove any unused primers the university so that the areas would be physically separated.
and nucleotides. The DNA sequences were analysed using the
BLAST program. All steps from specimen-drilling to amplicon-
sequencing were performed twice in order to ensure the repro- 3. Results
ducibility of the results.
Nine out of ten of the skeletons tested yielded the expected
Table 1 bands and DNA sequences for the RLEP element (Table 1). One of
Osteological (based on previous study e Kjellstrm, 2010) and aDNA results of the
ten skeletons tested.
Table 2
Skeleton Sex Age Osteological M. leprae Positive SNP type (a) Primers used for amplifying the three M. leprae SNP type loci. (b) Primers used
I.D. signs of DNA samplesa & subtypeb for amplifying the four SNP subtype loci.
leprosy resultsa
3320 e Adult 3 e Primer Targeted SNP Primer sequence 50 -30 Product size (bp)
3159 M 20e23 5 e (a)
3092 e 11e12 4 2G SNP14O-F 14676 ACGAATTCGTTGAACAGTCTC
3093 M 20e25 7 3I SNP14O-R 14676 TGGTAATAAACAATGCATGCT 141
34 e 14e26 2 e SNP16O-F 1642875 CGGCATGTGCGGCTTCATGG
10 F 40e60  2 e SNP16O-R 1642875 ACCGTCGGGGGTAGTAGTCTTCC 143
32 M 20e40 3 e SNP29O-F 2935685 AGGTACGGTGGTGTCGGTCTCC
19 F 17e22   0 e SNP29O-R 2935685 CGAGCGTGACCGGCCGTTAAT 148
3401 M 35e50 2 e
(b)
3077 F 20e30 9 2G
SNP31F 3102778 CGGTGACTTCGCTAAGCAGTA
Total 8 9 9 (samples 3 SNP31R 3102778 ACTGATTGCCTTCCCGAGT 233
per skeleton) SNP110F 1104232 TCGACCACGTTACCACGTTA
a SNP110R 1104232 CAGGCTTGCAGTCTGTTGAA 254
Nine samples in total were used from each individual. Column indicates which
SNP27F 2751783 ACTCACCCGTGGATCATAGC
and how many of those samples yielded the expected gel-band and RLEP sequence.
b SNP27R 2751783 GTGAAGCTGGTCGATGTGC 205
Only the samples that yielded all three SNP type amplicons are included in this
SNP113F 1133495 ATCGATACGTGATTCCCACGACAAC
column. The rest yielded results for none, one or two loci only thus were not
SNP113R 1133495 TGAGCAGTCACAGTCGTTACACACC 121
informative.
468 C. Economou et al. / Journal of Archaeological Science 40 (2013) 465e470
them yielded positive results for all of the bones tested, with the
rest showing various degrees of signal strength. All extraction and
PCR blank controls were negative. Of the bones tested, the ones that
proved to yield the best results for M. leprae DNA were the meta-
tarsals. Amplicons of all the three loci used to distinguish between
M. leprae SNP types were successfully amplied from three of the
skeletons, one (S.I. 3093) characterised as SNP type 3 and two (S.I.
3092 and 3077) as SNP type 2 (Fig. 3). The SNP type 3 skeleton
yielded the SNP combination of SNP14676-C, SNP1642879-T and
SNP2935693-C, whereas the SNP type 2 skeletons yielded the
following combination: SNP14676-C, SNP1642879-T and
SNP2935693-A. The rest, probably due to the relatively long
(w140bp) DNA templates required, yielded amplicons for only two,
one or none of the loci. Attempts to design pairs of primers tar-
geting shorter parts of the sequence of interest werent fruitful as
the candidate oligos were either non-species specic or showed
high self-complementarity. The three positive skeletons were
successfully tested as well for their SNP subtype and the results
ascribed them to SNP subtypes 3I and 2G respectively. The SNP
combinations and the results obtained for the SNP subtype were
as follows: For the 3I SNP subtype the locus taken into account was
SNP1133495-T, which in combination with the SNP2935693-C
result, differentiates between SNP subtype 3I and the rest of the
subtypes of SNP type 3. For the two SNP subtypes 2G the results
that allowed them to be ascribed as such were SNP3102778-C,
SNP1104232-G and SNP2751783-A. The PCR product for SNP2935693
of skeleton S.I. 3092 that distinguishes between SNP types 2 and 3
were sent to the Molecular Systematics Laboratory at Swedish
Fig. 3. The three SNP loci that distinguish between the different types of M. leprae. Here are presented the DNA sequences obtained from sample S.I. 3093 (SNP type 3) and S.I.
3092 (SNP type 2).
Museum of Natural History where they were processed by GS 454
Sequencing System in order to check whether that outcome was
due to a sole strain of M. leprae. The results supported this inter-
pretation, as all sequences exhibited the characteristic A of SNP
type 2 (Fig. 4), although some inconsistencies that dont affect the
outcome were present. Sequences 2, 6 and 7 showed deletions of
nucleotides that could be attributed to amplication or sequencing
errors whereas sequence 8 exhibited a G to A substitution that
could be a result of hydrolytic deamination of cytosine (Willerslev
and Cooper, 2005).
4. Discussion
Our results on the presence of M. leprae DNA in the skeletons
tested strengthen the previous osteological interpretations of the
lesions that were present. The skeleton (S.I. 10) that yielded positive
results without showing obvious bone lesions ascribed to leprosy is
interpreted as having been infected by a less severe form of the
disease such as tuberculoid leprosy. On the other hand, lesions that
had been ascribed to tuberculosis were present, implying that the
leprosy infection did not have time to develop further in this
individual prior to death. Due to the scientic interest in cases
where leprosy and tuberculosis co-exist (Donoghue et al., 2005)
three aliquots of DNA extracts of skeleton S.10 were typed for the
presence of markers (IS6110 and IS1081) used for the identication
of Mycobacterium tuberculosis complex (MTBC) (Stone et al., 2009).
Neither of the markers targeted yielded any positive PCR products.
This outcome does not however exclude the possibility that that
 C. Economou et al. / Journal of Archaeological Science 40 (2013) 465e470
Fig. 4. A characteristic collection of sequences obtained from GS 454 Sequencing System for the SNP2935693 PCR product of skeleton S.I. 3092. The nucleotide of interest is
highlighted in bold.
particular individual had been indeed infected with tuberculosis for
reasons such as that there are strains of the bacterium that lack
copies of the repeat element IS6110, as well as the stochastic nature
of molecular palaeopathology when it comes to sampling parts of
the skeleton likely to have hosted the specic microbe species. The
other skeleton (S.I. 19) that lacked bone lesions served as negative
control and, together with the extraction and PCR blanks as well as
the rest of the bones that didnt yield any result, strengthens our
condence that contamination from the environment or cross-
contamination in the laboratory could not have taken place.
M. leprae is known to not survive outside of its hosts for more than
a couple of months (Desikan and Sreevatsa, 1995) being an obligate
intracellular parasite (Britton and Lockwood, 2004) and is unlikely
to form endospores that could survive for long periods (Traag et al.,
2010). The specicity of the markers used is once more supported
by this study as otherwise we would expect to have amplicons from
all the bones from the same cemetery regardless of whether they
had been infected by leprosy or not. In addition, the results show
two different SNP types to be present, a pattern highly unlikely if
an external source of DNA had interfered.
Although no skeleton was typed in its entirety in this study and
the most common region (rhinomaxillary) affected by leprosy was
not available for analysis, we could, nevertheless, see a pattern of
stronger signals of the pathogens DNA in metatarsals and meta-
carpals, followed by the vertebrae. This is in line with the haema-
togenous spread of the microbe through the hosts body to bones of
hands and feet where the bacterial load causes alterations
(Lockwood, 2003).
The outcome of the M. leprae SNP types and subtypes was
most unexpected as all previous leprosy studies on European
material, both modern and ancient, had constantly found that SNP
type 3 was exclusively responsible for the disease on this conti-
nent. Although a previous nding (Taylor et al., 2009) had detected
an SNP type 3 in central Asia in a skeleton dated to 1ste4th
century AD, something considered uncommon or even unique for
that area of the world, this is the rst time that an SNP type 2 is
reported from anywhere in Europe, and e to the best of our
knowledge e it is the rst time it is reported in archaeological
material worldwide. The SNP sub 3I of one of the skeletons tested
seems to be in accordance with what had been previously reported
(Monot et al., 2009) as its occurrence has been conrmed in anal-
yses of archaeological material found in Europe of roughly the same
period of time. The SNP subtype 2G that the other two samples
were ascribed to had so far been reported only in Nepal, interest-
ingly very close to Uzbekistan where the odd SNP subtype 3 was
found. Scandinavians at that time had already established trade
routes and had been involved in campaigns that reached as far east
as the Caliphate, thus a transmission of different M. leprae strains
could have taken place between these distant places of the world.
Taking into consideration the fact that leprosy can have a very long
incubation time, a seemingly healthy person could travel for years
before any symptoms of the disease would appear. The question of
whether the SNP type 2 pathogen was already present in Scan-
dinavia and/or in lands on the road to the East at this time, or
whether the affected individuals had travelled to and contracted
469
the disease in Asia cannot be addressed by the present study. It is
also possible that the infected individuals were not of a local origin
but of one that corresponds to the current distribution of SNP
subtype 2G and had travelled to Sigtuna as merchants or similar.
Future analyses could help shed light on the matter as the variety of
grave goods and cultural ndings associated with that particular
cemetery imply that the individuals buried there could had
belonged to several ethnic groups. Whatever route this disease
followed however, our results show that transmission of various
strains of leprosy did take place in antiquity, and between lands
that are very far apart even by todays means of transportation. Of
course this isnt something new in the history of medicine; other
diseases, such as the Plague, have been shown (Carmichael, 2008a)
to have been transmitted from far away in times past. It is, however,
an interesting addition to the phylogeography of leprosy that a rare
type previously found only in central Asia was also present in
Scandinavia. This raises the interesting question as to whether the
lengthy persistence of the disease in Scandinavia was due only to
the poor living conditions of the time, or whether the different
mycobacterial strains do indeed activate the host immune system
in different ways (Wong et al., 2010).
5. Conclusions
In this study we successfully used aDNA methods to type
medieval human remains from Scandinavia exhibiting bone lesions
characteristic of leprosy. The samples yielded positive results of
M. leprae DNA, thus supporting the conclusions of the previous
osteological study and enhancing the role that molecular biology
can play in the eld of palaeopathology, especially when there are
forms of disease that do not leave diagnostic marks on the skeleton.
By sampling various bones from each skeleton we concluded that
metatarsals, metacarpals and vertebrae can be useful alternatives
to crania when studying leprosy. Our results on the SNP types of
the pathogen are informative regarding its phylogeographic
patterning, and provide evidence that a transmission of a particular
type of the disease agent from central Asia/Middle East to Scan-
dinavia had taken place during the Middle Ages; something unique
for that area of the world according to what has been observed
so far.
Acknowledgements
We would like to thank S. Cole for his help on primers and
comments on our results; P. Singh for comments on the analysis;
DIALPAST for providing the chance to discuss our preliminary
results; M. Oikonomou for helping with the design of Fig. 2; R.
Howcroft for helping with language editing and presentation of the
article.
References
Achtman, M., 2012. Insights from genomic comparisons of genetically mono-
morphic bacterial pathogens. Philos. Trans. R Soc. Lond. B Biol. Sci. 367,
860e867.
470 C. Economou et al. / Journal of Archaeological Science 40 (2013) 465e470
Bakija-Konsuo, A., Muli c, R., Boraska, V., Pehlic, M., Huffman, J.E., Hayward, C.,
Marlais, M., Zemunik, T., Rudan, I., 2011. Leprosy epidemics during history
increased protective allele frequency of PARK2/PACRG genes in the population
of the Mljet Island, Croatia. Eur. J. Med. Genet. 54, 548e552.
Boldsen, J.L., 2001. Epidemiological approach to the paleopathological diagnosis of
leprosy. Am. J. Phys. Anthropol. 115, 380e387.
Britton, W.J., Lockwood, D.N., 2004. Leprosy. Lancet 363, 1209e1219.
Browne, S.G., 1975. Some aspects of the history of leprosy: the leprosie of yesterday.
Proc. R Soc. Med. 68, 485e493.
Carmichael, A.G., 2008a. Bubonic plague. In: Kiple, K.F. (Ed.), The Cambridge World
History of Human Disease. Cambridge University Press, pp. 834e839.
Carmichael, A.G., 2008b. Leprosy. In: Kiple, K.F. (Ed.), The Cambridge World History
of Human Disease. Cambridge University Press, pp. 834e839.
Cole, S.T., Eiglmeier, K., Parkhill, J., James, K.D., Thomson, N.R., Wheeler, P.R.,
Honor,, N., Garnier, T., Churcher, C., Harris, D., Mungall, K., Basham, D.,
Brown, D., Chillingworth, T., Connor, R., Davies, R.M., Devlin, K., Duthoy, S.,
Feltwell, T., Fraser, A., Hamlin, N., Holroyd, S., Hornsby, T., Jagels, K., Lacroix, C.,
Maclean, J., Moule, S., Murphy, L., Oliver, K., Quail, M.A., Rajandream, M.A.,
Rutherford, K.M., Rutter, S., Seeger, K., Simon, S., Simmonds, M., Skelton, J.,
Squares, R., Squares, S., Stevens, K., Taylor, K., Whitehead, S., Woodward, J.R.,
Barrell, B.G., 2001. Massive gene decay in the leprosy bacillus. Nature 409,
1007e1011.
Desikan, K.V., Sreevatsa, 1995. Extended studies on the viability of Mycobacterium
leprae outside the human body. Lepr. Rev. 66, 287e295.
Donoghue, H.D., Holton, J., Spigelman, M., 2001. PCR primers that can detect low
levels of Mycobacterium leprae DNA. J. Med. Microbiol. 50, 177e182.
Donoghue, H.D., Marcsik, A., Matheson, C., Vernon, K., Nuorala, E., Molto, J.E.,
Greenblatt, C.L., Spigelman, M., 2005. Co-infection of Mycobacterium tuber-
culosis and Mycobacterium leprae in human archaeological samples:
a possible explanation for the historical decline of leprosy. Proc. Biol. Sci. 272,
389e394.
Drancourt, M., Raoult, D., 2005. Palaeomicrobiology: current issues and perspec-
tives. Nat. Rev. Microbiol. 3, 23e35.
Frothingham, R., 1999. Evolutionary bottlenecks in the agents of tuberculosis,
leprosy, and paratuberculosis. Med. Hypotheses 52, 95e99.
Geluk, A., Ottenhoff, T.H., 2006. HLA and leprosy in the pre and postgenomic eras.
Hum. Immunol. 67, 439e445.
Grimm, D., 2005. Global spread of leprosy tied to human migration. Science 308,
1040e1042.
Kjellstrm, A., Tesch, S., Wikstrm, A., 2005. Inhabitants of a sacred townscape: an
archaeological and osteological analysis of skeletal remains from late Viking age
and Medieval Sigtuna, Sweden. Acta Archaeologica 76, 87e110.
Kjellstrm, A., Wikstrm, A., 2008. Osteologi och fltantropologi. In: Wikstrm, A.
(Ed.), P vg mot Paradiset e arkeologisk underskning i kvarteret Humle-
grden 3 i Sigtuna 2006. Meddelanden och rapporter frn Sigtuna museum, vol.
33. Sigtuna museer, Sigtuna, pp. 165e216.
Kjellstrm, A., 2010. Possible cases of leprosy and tuberculosis in medieval Sigtuna,
Sweden. Int. J. Osteoarchaeol. 22, 261e283.
Lockwood, D.N., 2003. Leprosy (Hansens disease). In: Warrell, D.A., Cox, T.M.,
Firth, J.D., Benz, M.D. (Eds.), Oxford Textbook of Medicine, fourth ed. Oxford
Press, pp. 611e618.
Manchester, K., 1984. Tuberculosis and leprosy in antiquity: an interpretation. Med.
Hist. 28, 162e173.
Mark, S., 2002. Alexander the Great, seafaring, and the spread of leprosy. J. Hist.
Med. Allied Sci. 57, 285e311.
Misch, E.A., Macdonald, M., Ranjit, C., Sapkota, B.R., Wells, R.D., Siddiqui, M.R.,
Kaplan, G., Hawn, T.R., 2008. Human TLR1 deciency is associated with
impaired mycobacterial signaling and protection from leprosy reversal reaction.
PLoS Negl. Trop. Dis. 2, e231.
Monot, M., Honor, N., Garnier, T., Araoz, R., Coppe, J.-Y., Lacroix, C., Sow, S.,
Spencer, J.S., Truman, R.W., Williams, D.L., Gelber, R., Virmond, M., Flageul, B.,
Cho, S.N., Ji, B., Paniz-Mondol, A., Convit, J., Young, S., Fine, P.E., Rasolofo, V.,
Brennan, P.J., Cole, S.T., 2005. On the origin of leprosy. Science 308, 1040e1042.
Monot, M., Honor, N., Garnier, T., Zidane, N., Shera, D., Paniz-Mondol, A.,
Matsuoka, M., Taylor, G.M., Donoghue, H.D., Bouwman, A., Mays, S., Watson, C.,
Lockwood, D., Khamesipour, A., Dowlati, Y., Jianping, S., Rea, T.H., Vera-
Cabrera, L., Stefani, M.M., Banu, S., Macdonald, M., Sapkota, B.R., Spencer, J.S.,
Thomas, J., Harshman, K., Singh, P., Busso, P., Gattiker, A., Rougemont, J.,
Brennan, P.J., Cole, S.T., 2009. Comparative genomic and phylogeographic
analysis of Mycobacterium leprae. Nat. Genet. 41, 1282e1289.
Nuorala, E., Donoghue, H.D., Spigelman, M., Gtherstrm, A., Hrding, B.,
Grundberg, L., Alexandersen, V., Leden, I., Lidn, K., 2004. Diet and Disease in
Bjrned, a Viking-early Medieval Site in Northern Sweden. Theses and Papers in
Scientic Archaeology. In: Paper II, Molecular Palaeopathology. Ancient DNA
Analyses of the Bacterial Diseases Tuberculosis and Leprosy, vol. 6. Archaeo-
logical Research Laboratory, Stockholm University.
Ridley, D.S., Jopling, W.H., 1966. Classication of leprosy according to immunity:
a ve group system. Int. J. Lepr. 34, 255e273.
Robbins, G., Tripathy, V.M., Misra, V.N., Mohanty, R.K., Shinde, V.S., Gray, K.M.,
Schug, M.D., 2009. Ancient skeletal evidence for leprosy in India (2000 B.C.).
PLoS One 4, e5669.
Sabbatani, S., Fiorino, S., 2010. The plague of the Philistines and other pestilences in
the Ancient World: exploring relations between the religious-literary tradition,
artistic evidence and scientic proof. Infez Med. 18, 199e207.
Singh, P., Cole, S.T., 2011. Mycobacterium leprae: genes, pseudogenes and genetic
diversity. Future Microbiol. 1, 57e71.
Stone, A.C., Wilbur, A.K., Buikstra, J.E., Roberts, C.A., 2009. Tuberculosis and leprosy
in perspective. Am. J. Phys. Anthropol. 140, 66e94.
Sundelin, A., Srman, A., 2004. Skammens hud. Bokfrlaget DN, Stockholm.
Taylor, G.M., Watson, C.L., Bouwman, A.S., Lockwood, D.N.J., Mays, S.A., 2006.
Variable nucleotide tandem repeat (VNTR) typing of two palaeopathological
cases of lepromatous leprosy from Mediaeval England. J. Archaeol. Sci. 33,
1569e1579.
Taylor, G.M., Blau, S., Mays, S., Monot, M., Lee, O.Y., Minnikin, D.E., Besra, G.S.,
Cole, S.T., Rutland, P., 2009. Mycobacterium leprae genotype amplied from an
archaeological case of lepromatous leprosy in Central Asia. J. Archaeol. Sci. 36,
2408e2414.
Taylor, G.M., Donoghue, H.D., 2011. Multiple loci variable number tandem repeat
(VNTR) analysis (MLVA) of Mycobacterium leprae isolates amplied from
European archaeological human remains with lepromatous leprosy. Microbes
Infect. 13, 923e929.
Traag, B.A., Driks, A., Stragier, P., Bitter, W., Broussard, G., Hatfull, G., Chu, F.,
Adams, K.N., Ramakrishnan, L., Losick, R., 2010. Do mycobacteria produce
endospores? Proc. Natl. Acad. Sci. U S A 107, 878e881.
Truman, R.W., Singh, P., Sharma, R., Busso, P., Rougemont, J., Paniz-Mondol, A.,
Kapopoulou, A., Brisse, S., Scollard, D.M., Gillis, T.P., Cole, S.T., 2011. Probable
zoonotic leprosy in the southern United States. N. Engl. J. Med. 364, 1626e1633.
Watson, C.L., Lockwood, D.N., 2009. Single nucleotide polymorphism analysis of
European archaeological M. leprae DNA. PLoS One 4, e7547.
Willerslev, E., Cooper, A., 2005. Ancient DNA. Proc. Biol. Sci. 272, 3e16.
Wong, S.H., Gochhait, S., Malhotra, D., Pettersson, F.H., Teo, Y.Y., Khor, C.C.,
Rautanen, A., Chapman, S.J., Mills, T.C., Srivastava, A., Rudko, A., Freidin, M.B.,
Puzyrev, V.P., Ali, S., Aggarwal, S., Chopra, R., Reddy, B.S., Garg, V.K., Roy, S.,
Meisner, S., Hazra, S.K., Saha, B., Floyd, S., Keating, B.J., Kim, C., Fairfax, B.P.,
Knight, J.C., Hill, P.C., Adegbola, R.A., Hakonarson, H., Fine, P.E., Pitchappan, R.M.,
Bamezai, R.N., Hill, A.V., Vannberg, F.O., 2010. Leprosy and the adaptation of
human toll-like receptor 1. PLoS Pathog. 6, e1000979.
Yang, D.Y., Eng, B., Waye, J.S., Dudar, J.C., Saunders, S.R., 1998. Technical note:
improved DNA extraction from ancient bones using silica-based spin columns.
Am. J. Phys. Anthropol. 105, 539e543.
Zink, A.R., Reischl, U., Wolf, H., Nerlich, A.G., 2002. Molecular analysis of ancient
microbial infections. FEMS Microbiol. Lett. 213, 141e147.