Student Name: Brittany Garvey

Subject: Biology
Topic: Protein Synthesis
Grade Level: 10
School and CI Name:
Date of Lesson Enactment:
Duration: 1-2 classes

Essential Questions: How does DNA transfer its genetic sequence from the nucleus into protein in the
cytoplasm?

Virginia Standards of Learning (SOLs):

Bio.5 The student will investigate and understand common mechanisms of inheritance and protein synthesis.
Key concepts include:
h) events involved in the construction of proteins

Objectives:
Students will KNOW
o Transcription is the process by which DNA is copied into RNA
o Translation is the process by which RNA becomes a protein.
Students will UNDERSTAND
o Transcription and translation are key processes in the transfer from DNA to RNA to protein.
Students will be able to DO
o Transcribe information from DNA into RNA.
o Translate information from RNA to protein.

Materials/Resources:
Computer
Cornell Notes
PowerPoint
DNA flashcard activity
Worksheet

Safety
There are no extraordinary safety issues, but it is necessary for all students to keep their hands to
themselves and stay alert in the classroom environment to prevent injury of fellow students.

Procedures:
Phase 1:
Introduction
Ask students to recall what they learned last class about DNA and the importance of it determining our
characteristics.
Students are given time to discuss, as a group, some disorders/illnesses/mutations that they have seen or
heard of.
The students will then be asked to share these ideas aloud and all of these will be written on the board.
The teacher will explain to students that we will come back to this list later in the unit. We know that
we have this sequence of letters that give us characteristics, but what would happen if one letter was
wrong or left out? Think about a sentence where if you changed one word it would completely change
the meaning. Ex: The Beatles are the best rock band
The Beatles are the best rock.
In this example the meaning was completely changed. When we have one small change in our DNA
sequence, our characteristics can change completely and even lead to serious complications or genetic
disorders. Sometimes though, a small change might not make a big difference.
 Ex: Biology is all around you.
Biology is around you
How does DNA use this code to make a characteristic or make something work the way it does?
How does DNA become a protein?
Who remembers what our 4 bases of DNA are
A, T, C, G
During this lesson we will learn how DNA becomes RNA and then becomes a protein. We will also
look at how simple mutations can affect our human bodies and look at what disorders on the board are
actually caused by our genetic information. We will practice two processes today, the process of
transcription and the process of translation.
Motivation: for students to understand the genetic connection to what they see in their characteristics,
but more importantly what could happen if one of the processes has a mistake that occurs.

Presentation of content & Skill

Present the PowerPoint while having students take notes. Students will have two options for note-
taking. The students will either take notes on their own or will be asked to fill in the Cornell Notes
provided by the teacher. Students that are confident in their note-taking ability will be able to apply
their own freedom into how they would like to organize their notes. Students that might need more
support, such as ELLs or students in the special education program, will be given the Cornell notes
sheet to complete during the lesson.
Additionally, the teacher will circulate around the room throughout the lecture to ensure that
students are on task and able to complete the Cornell notes.
Students will have examples of the process of transcription and translation throughout the presentation
Some of the main topics covered in the PowerPoint include
Transcription
Translation
Codons
DNA
RNA
Protein
Amino Acids
DNA vs. RNA bases
5 and 3 strands

Phase 2:
Guided Practice
Students will go through example #1 on their worksheet of transcription and translation as a whole class
with the teacher modeling the process on the board while students write it out for themselves.
The teacher asks students to respond aloud as a class with pairing bases and creating codons as well as
translating to amino acids.
Ensure that all students are engaged by calling on students to answer.
Students should be writing out the sequence of steps as the teacher writes the problem on the board.

Independent Practice
Have students practice the skills of transcription and translation on their own with the attached
worksheet.
Teacher will walk around to answer questions and provide support in the process.
After all students have completed the activity they will check their work as a group by having students
read through the sequence step by step as the process of transcription and translation occurs.
Group Activity
Set the scene by describing the classroom to the students as one big cell, with the front desk as the
nucleus and the student desks as the ribosomes. Students will start at the nucleus by picking a DNA
fragment and transcribing it to mRNA. They should not leave the nucleus for this step. They then go to
one of the ribosomes to write out the corresponding tRNA sequence.
Next they will search the room for the matching anti-codons on the tRNA cards.
 On the back of each card they will find a word (representing an amino acid) and the words should form
a sentence (the protein). If the final sentence does not make sense, they have a mutation and should go
back to figure out where they made a mistake.
After they have completed this activity they should answer the review questions individually without
notes and turn it in at the end to provide the teacher with feedback about the student understanding of
the content.

Assessment:
Students will perform a final activity in which they will be given the opportunity to combine their
knowledge to assess themselves. If students complete the activity accurately, they will have sentences
that make sense. This is a good way for students to think of the process of DNA making up a bigger
picture, just like words make up a bigger idea of a sentence.
Students will each be given flashcards with DNA sequences on them. After the process of transcription
and translation students will use their codons to determine what amino acids they would code for, but in
this fun example the amino acids have been replaced with English words. Students will have a complete
sentence after the process is complete instead of the protein sequence that would normally be displayed.
Students will turn in their completed worksheet reflection to allow the teacher to check if students are
understanding the content and address areas of confusion in later class lessons if necessary. Students
have the opportunity to display their understanding in a different format if they prefer, but must still
answer the questions presented in the worksheet. These formats can be verbal recording of their
reasoning, typed answers, or handwriting on the worksheet. This gives students a chance to display
their understanding in a chosen format.

Closure:
Students will put all notes away and will explain what they learned aloud as a whole class during the
lesson. What is translation? What is transcription? What is the order of the transfer of information?

Accommodations for individual differences:

To ensure that all levels of students are engaged in the material, the lesson was created with differentiated
supports. The students will have a clear set of Cornell notes to complete accompanying the visual PowerPoint.
The worksheets will allow students time to test their own confusion with the process of transcription and
translation, and this is a time when the teacher has the ability to assist students that might need extra attention
and support.

Behavioral and organizational strategies: During the DNA flashcard activity, students will be grouped
appropriately to ensure that students that may distract each other are separated into different groups. Seats will
be changed throughout the lesson to keep the kids awake and engaged. I will prompt students with questions
when I recognize a lack of attention throughout the process and ensure that students have plenty of
opportunities to reflect upon their knowledge.

Resources/References:
https://www.cpet.ufl.edu/wp-content/uploads/2013/03/Protein-Synthesis-Simulation-Activity.pdf
http://www.hamilton-local.k12.oh.us/Downloads/Protein-Synthesis-Practice-Problems.pdf
http://biologyjunction.com/protein%20synthesis2%20ppt.ppt
 Protein Synthesis Practice Problems
Name: ____________________________________ Per: __________ Date: ________________

Directions: For each of the following questions, transcribe the DNA strand into mRNA, section it into
its codons, and translate it into amino acids.

1. DNA: TACTCGGGGCGCATCCAAGAG

mRNA

Amino acids

2. DNA: TACGATCGATAGCTAGCTAGC

3. DNA: TACACGTATCTTGGCTAGCTA
Directions: For each of the following questions, transcribe the DNA strand into mRNA, section it into
its codons, translate it into amino acids.

1. DNA: TAC/TCG/GGG/CGC/ATC/CAA/GAG

mRNA AUG/AGC/CCC/GCG/UAG/GUU/CUC

Amino acids Met-Ser-Pro-Ala

2. DNA: TACGATCGATAGCTAGCTAGC
AUG/CUA/GCU/AUC/GAU/CGA/UCG
Met-Leu-Ala-Iso-Asp-Arg-Ser

3. DNA: TACACGTATCTTGGCTAGCTA

AUG/UGC/AUA/GAA/CCG/AUC/GAU
Met-Cys-Iso-Glu-Pro-Iso-Asp
 Protein Synthesis Simulation
Materials:
20 DNA fragment cards
64 tRNA cards (put the anti-codon on one side and the word on the back)
Worksheets (1 per student)

Preparation:
1. Tape the t-RNA cards around the room with the anti-codons showing.
2. Place the DNA fragments in the nucleus (front desk)

Activity Overview:
Set the scene by describing the classroom to the students as one big cell, with
the front desk as the nucleus and the student desks as the ribosomes (etc.).
Students will start at the nucleus by picking a DNA fragment and transcribing
it to mRNA. They should not leave the nucleus for this step. They then go to
one of the ribosomes to write out the corresponding tRNA sequence. Next
they will search
the room for the matching anti-codons on the tRNA cards. On the back of each
card they will find a word (representing an amino acid) and the words should
form a sentence (the protein). If the final sentence does not make sense, they
have a mutation and should go back to figure out where they made a mistake.

This activity can also be done in groups, with one student doing the
transcription in the nucleus, another student working as the ribosome, and a 3rd
searching the room for the anti-codons.

Note: from "Biology With Junk" (Wartski)

For a 50 min. class period, precede this activity with a brief review of
transcription and translation and follow it with a discussion of mutations.
Some students will have time to complete 2 sentences.
 UAG = Stop (period) CCG = is CGC = water 20
AUG = Initiator (Start) CCU = subject CGG = every
AAA = Your CGA = drink CGU = day
AAC = mother AAG = wears AAU =
dresses
ACG = funny ACC = have ACU = dog
ACA = breath AGA = the AGG = are
AGU = Beatles AGC = best AUA = rock
AUC = band AUU= an
CAA = old
CAC = rubber CAG = breaks.
CAU = pulled
CCA = when CCC = Biology
CUA = I
CUC = love CUG = roll
CUU = music
GAA = all GAC = demented
GAG =
GAU = and GCA = so
puppies
GCG = fun GCU = education
GCC = much
GGC = to GGG = future
GGA = door
GUA = a GUC = dress
GGU = father
GUU = nothing UAA = we
GUG =
UAU= this UCA = together
brother
UCG = be
UGU = little UAC = in
UUG = for UCC = must
UCU = informed UGA =
UGC = you UGG = read around
UUA= DNA UUC = code
UUU= life

Sentences; 10) Biology is so much fun.

11) Education is the door to the future.
1) Your mother wears a rubber band. 12) Your father wears a dress.
2) Your mother dresses you funny. 13) Your brother wears nothing.
3) We have dog breath. 14) We are all in this together.
4) The Beatles are the best rock band. 15) We must be informed every day.
5) An old rubber band breaks when pulled. 16) Rock and roll music is the best.
6) Biology is the best subject. 17) Biology is all around you.
7) Drink water every day. 18) Read a little every day.
8 )1 love rock and roll music. 19) DNA is the code of life. 9) We are all puppies.
20) DNA must be read for life.
1)ATGAAAAACAAGGTACACATCTAG 8)ATGCTACTCATAGATCTG
2)ATGAAAAACAATTGCACGTAG 9)ATGTAAAGGGAAGACGAGTAG
3)ATGTAAACCACTACATAG 10) AIGCCCCCGGCAGCCGCGTAG
4)ATGAGAAGTAGGAGAAGCATAATCTAG 11) ATGGCTCCGAGAGGAGGCAGAGGG
5)ATGATTCAACACATCCAGCCACATTAG 'TAG
12) ATGAAAGGTAAGGTAGTCTAG-
6)ATGCCCCCGAGAAGCCCTTAG
13) ATGAAAGTGAAGGTTAG
7)ATGCGACGCCGGCGTAG
14) ATGTAAAGGGAATACTATTCATAG 18) ATGTGGGTATGTCGGCGTTAG
15) ATGTAATCCTCGTCCGGCGTTAG 19) ATGTTACCGAGATCGTTTTAG

16) ATGATAGACGAGAAGCTAG 20) ATGITATCCTCAG

17) ATCCCGGAATGAGCTAG
 Name (s):

Protein Synthesis Simulation

1. Start at the "nucleus". Pick up a DNA strand and write the number of the DNA strand here:

2. Staying in the "nucleus", transcribe the DNA into mRNA. Write the mRNA sequence here:

3. Go to one of the "ribosomes" and write the tRNA sequence that corresponds to your mRNA here:

4. Split the tRNA sequence into anti-codons (groups of 3 letters)

5. Look around the room for the tRNA cards that match your anti-codons. Write down the words in
order.

If you complete this correctly, you should have a sentence. If it does not make sense, you
have made a mistake and need to go back and start over. Check your
answer with the teacher when you are done and then answer the questions on the back of this
sheet.

If you have time, you may complete another DNA sequence for bonus points.

Questions:
1. Why did you have to stay in the "nucleus" to write down the mRNA?

2. Which part of this activity represents transcription?

3. Which part of this activity represents translation?

4. What happens in the ribosomes during protein synthesis?

5. What does the final sentence represent in terms of protein synthesis?

6. What does each word represent in terms of protein synthesis?

7. All DNA sequences started with ATG and ended with TAG? Why?

8. How does this activity differ to doing protein synthesis problems using the genetic
code?