ARCHAEOLIN(iUA

Central European Series 1

Archaeometry 98
Proceedings of the 31st Symposium
Budapest, April 26 - May 3 1998

Volume I

Edited by

Erzsebet Jerem
Katalin T. Biro

BAR International Series 1043 (I)

2002
Archeometrie

ARCHEOMETRIE
Collectifs
 ARCHAEOLINGUA

Central European Series 1

Archaeometry 98
Proceedings of the 3 lst Symposium
Budapest, April 26 May 3 1998
-

Volume I

Edited by

Erzsebet Jerem
Katalin T. Bir6

Assistant editor l>oKPE

Edina Rudner

T5C

l Jo::i-1/-1

\
\
BAR International Series 1043 (I)
2002

\
 Archaeometry 98
Proceedings of the 31st Symposium, Budapest, 1998
ThiS title Pbl
ll

{lcl. b
ArchaeaP:t Y
pablishers ss sponsored by
Gordon Bol.{ l.Jf }3 .
276 Banbu ry R.1:1
8 l'Itish Are haeolo
gical Reports
oxford i:l.q
E
oX2 7 D
En gland
www.archaeop
rs
s
l;allt

BARS1043
A r c haeolinPi.
O 'f.a \::
l1.tta.1 Europ
ean Series 1
Arcltaeometry 9
&: J.:.>r
Oceedz Hungarian National Museum
n s
g of the 31st Symposium, Budapest, April 26 May 3 1998. Volume J
t he indivir1
'-' \i
-

q_ l
qH.
....,t, o r s 2
002
ISBN 1841711<
ISBN 1841711< l 15
.
Enl
(
ti c::o.rnP1ete set of tw vol
h (t i
s Volum
o umes) {r
Pri.!lted m e)
C\
cl b
y The Ba .

n1
Word process:i.n singstoke Press
Im.re Szabo, Q . cl
E nglish text rYlq_ ;skt op ed t ng
\1
Kova, c I i and layout: Andras Kardos with contributions of
.

e sztu s and Jozsef Gonda _,;;::. ilJ .::;;_

.

Ida J(er rz . cl b '

Y. Gerry Bnsch , David Davison, Alice M. Choyke, Geza T th and

.

o
cover illustr a0

.
Ministry of Cultural Heritage
F. pulszky 188\3 :t\: <::::o
' .f:t-IJ PPer Age t ooI k .
"Th i t from Szeged-Sziller ca. 3rct rnillenium BC after
e Copp er A
ge in Hungary"

J3AR title s ;:,.._

All 't r
<:i. v
<\'l i a
Hadrian Book l ble from
:
y R'=> 't:q_
122 ]3anbur
Oxford C\
ox27BP
England Archaeolingua Foundation
The current B
A...R
le free
availab f\-- "'-t
""'- ):_,.
Oh_ Cl.Jo gue
"1. Cl. With det a11sof a 11 htles m prmt, pnces and means of payment is
.
'

d. r
. .

lan Books
.
 EDITORIAL PREFACE

we are honoured to present to the interested reader the Proceedings of the 31st International Symposium on
Archaeometiy, held in Budapest between April 26 and May 3, 1998.
ARCHAEOLINGUA Bringing the conference to Budapest was a major achievement. The possibility of inviting the meeting was raised first
during the Heidelberg meeting (1990). Although Hungarian archaeometiical research did not have at that time, and still
Central European Series does not have, a firm institutional background, the largely informal circle of scientists dealing with the broad field of
archaeometry was enthusiastic about the idea and ready to bring the meeting to Hungmy by 1994. Due to the significant
social and political changes of the early nineties, affecting also the scientific institutional network, this was not possible
at that time. In the course of the 1994 Ankara meeting and the 1996 Urbana/Champagne conference, however, we took
up the challenge and shouldered the task. The Hungarian National Museum agreed to undertake the role of main
organiser providing the infrastructure and institutional background for the conference. The Hungarian Academy of
Sciences provided the conference with a magnificent setting in the Ceremonial Room of the Headqumters of the

: ! hre
yea.rs ago, t e edi.tos of Archaeopress nd Archaeolingua first considered launching a
Academy. Several scientific institutions of the Academy - among them, in the first place, the Archaeological Institute
of the HAS - played an essential patt in organising the meeting. We also received impo1tant help from scientific
0 .J intly published series within BAR, under the
. title of Archaeolingua Central European Series institutions and associations working in different fields of archaeological science, which were mentioned in the
u

ea was o provide n w multidiscipl inary
forum for monographs and/or edited volumes
ope Abstracts volume published in 1998. A large Local Organising Committee was formed, partly to help the daily tasks of
to: chaeolog1sts and sc1ent1sts . _
involved in related studies. The series sees its beginning organisation and, even more impmtant, to disseminate information about the multidisciplinmy event among scientists,
.
present publicat . in the
ion . archaeologists, museum professionals and many other interested people. The number of registered pmticipants for the
Conference was 260, including 60 Hungarian members. As special arrangements were made for Hungarian students and
The Senes is
to have the fullest possible archaeological remit daily visitors, the number of persons who were able to benefit from the meeting can be estimated at twice the number of
.

. . . in terms of subject matter and

period, g

ograph1ca ly 1t will focus on Central Europe.
This area is a very special entity both in
registered participants.
geo raph1cal
f and histor.ical terms, and is distinct in many
ways from northern and southern It is not by chance that we try to point out the benefit to Hungarian research of the Archaeometry Symposium. Our main
==
rn nd estern countries In Ce
.
tral Europe are integrated a huge range of influen
ces fro purpose in organising the conference was to promote related studies in Hungary, to convince scientists as well as
?
e a 1rect1ons which .
lead to a multicoloured and very specific cultura
l picture. The present-day archaeologists that it is worthwhile collaborating with each other, to show students a possible avenue of research and
geo ohtical

effe s Pos1t10
y
roc sses of 'New Europe' are also showing
these complicated and long-lasting also to demonstrate the possibilities and strength of an interdisciplinary approach to the management of museums and
.
caref I evaluation

in the heart of the contin nt lends both advan
tage and disadvantage and needs research centres. The efforts proved to be clearly successful, as reflected by papers presented to the conference (many
throughout the whole history of the past ten
related to one thousand years . All contributions of them written in the framework of international collaboration projects), the initiation of archaeometiy-orientated
or other aspects of the above subject will be workshops and seminars at different universities in Hungary, and last but not least, the high attendance of Hungarians at
welcome.
the ISA Symposia in Mexico and Amsterdam.
; ?
h eometry 98 is the inaugural title in the Archa
eolingua Central European Series This first title
its two large and impor
A chaeometr
!
tan volumes is based on papers presented

at the 31 t Internationa l
There are, however, still many problems as yet unsolved in Hungary, such as the lack of a proper institutional
background and the need for a standard periodical dedicated to questions of archaeometry. The minds of traditional
y Conference held 1n Budapest.
archaeologists/scientists, though ce1tainly softened by the gleaming perspectives, are changing slowly. It is clear that
the inclusion of costly analyses in the modest budgets of excavations without the hope of direct applicability cannot be
expected within such a short time. The building up of reference collections and the working out of methodology is a
time-consuming process. Neve1theless, we are confident that the 31st International Symposium in Archaeomet1y,
organised in Budapest, was a very important step in this direction.

Similarly, bringing the Conference to Budapest was a good oppmtunity for many Cential and Eastern European
countries to get involved in archaeometiical studies in general. The organisers made special effo1ts to support scientists
and students facing financial hardship with grants. The supporting institutions offered accommodation in guestrooms as
well as fmancial help which is greatly appreciated by the organisers. The Budapest meeting attracted, naturally enough,
people from Cential and Eastern Europe in large numbers as well as from countiies where archaeometry is tiaditionally
stiong. As we have observed, the venues of past and oncoming ISA meetings were represented by large number of
participants: Great Britain, as home of the idea, Greece, Gennany, Turkey and from the New World, the United States,
Canada and Mexico (Fig. 1, Fig. 2).

2 3
 Participants by country (1 ), 31 ISA Budapest Main topics of 31 ISA, Budapest

6
17

[]Hungary

Ill United Kingdom

Ell Germany 1 biomaterials

DUSA lll2 dating

[] 3 field archaeology
ISlltaly
Ell 4a tech/prov metals
i;::J France
llD4b tech/prov ceramics/glass
CJ Greece
32 4c tech/prov stone/pigment/plaster
BTurkey
8 5 theme session experimental ..
D Austria
Ogeneral
!II Canada

IZIMexico

Others

20

Participants by country (2), 31
Conference '98
h the proceedings of the Archaeometry
of papers, the editors decided to publis
Due to the great number
ISA Budapest
ins the writte n versio ns of the prese ntations and
I conta
the structure of the meeting. Volume
in two volumes, following consists of the
5, and 6. Consequently Volume II
posters presented in sections 1, 2, 3,
the texts accompanying the
in section 4 a-c.
studies and material analyses presented
papers discussing provenance
Belgium

D Israel
first place,
onsuming technical difficulties. In the
the editors had to face several time-c
II Romania

During the editing procedure lingui stic revisi ons. Numerous

required repeated
Ell Spain
speakers of English in many cases
[]Switzerland
papers written by non-native se of missi ng abstra cts, key words , references
ed several times to the contributors becau
authors' proofs had to be return Therefore
!SJ Russia
ing of the paper s could be organ ised.
however, that no professional review
and so on. It is to be noted,
E:lSweden
unfortunately
nsibility. Illustrations sent in colour,
in the texts are the authors' own respo
remaining enors and mistakes
CJ Denmark
ially tables and
t of the series, illustrations, espec
and white format. Due to the fixed layou
Ell Slovakia

had to be conve1ted into black to be scann ed and

sively in a hard copy version had
D South Africa
in size. Tables and graphs sent exclu
pictures needed to be reduced all these incon venie nces
layout. We apologize for
EB The Netherlands
affected the quality and unity of the
treated as graphic files, which
IZIBulgaria

ication.
related to the layout of the publ
r1China

l:'l Czech Republic

by to the
of the final manuscript was borne
whole expense of the production
12lLatvia
In addition to this, nearly the rt.
cial suppo
received only minimal of external finan
IE Norway
Poland Archaeolingua Foundation, which
es for the
for their support in preparing the volum
DYugoslavia

following institutions and individuals

The editors are grateful to the rtmen t of Historic
ssing of the texts, to the Depa
ation for the word and picture proce
press: to the Archaeolingua Found Natio nal Muse um for the
ial aid, to the Hungarian
of National Cultural Heritage for financ
Monuments of the Ministry ained relatio ns
5
Rudner, the techn ical editor , maint
as well as for financial aid. Zita Edina
organization of the conference is gratefully ackno wledg ed. Alice M.
her work
inated the preparation of the proofs,
with the contributor s and co-ord on and the correction of the proofs.
Jozsef
Toth under took the lingui stic revisi
Ida Keres ztlirszki and Geza
Choy ke, es. Last but
prepared the final layout of the volum
Szabo and especially Andras Kardos
A..ich
aeometry symposia
in .;, in
general are organised according to four main to ics :gatmn
. .
of bmlog>eal materials, Gonda, Gyula P. Kovacs, Imre
are due to David Davison of Archaeopre
ss for constant advice and help at all
stages of the
clat
>ng methods, field 3'chaeology, technology and prnvonance of "chaeologi al . not least, our special thanks
its final publication.
production of the text and for
)'h .
e
s e Buda est meet ng selected experimental archaeology as its special field of interest, as this had seen some
p i . I
ctac ula ne
Pte achievements in the past few years. The distr bution of topi
:nt t the 31st I A meeting is

itQ
:
ll()s
ted in 1g. 3. As is typical for Archaeomet1y symposia, most of the con b i
'
is. Lookg back now from a fe w years distance, the Budapest Archaeometi m et n exc lled
.
we1e presented in the form of
.
the q ua ity and Katalin T. Biro
():r
/
o1:nce o its poster resenttions. This is of special impo1 tance to us as th Hu g nan practic
.
'
. e in lectur g and
in
Erzsebet Jerem

b t a lllsmg scientific meetings st!ll focuses on oral presentations and an It

u
less ;' ell-slected, words and images is badly needed. Being ' n poster' t : : : ;f'ct
.
f
; , e,
w of expressing results in a few,
not mean by any standards a
. .
uality or lack of interest. pait' this was one of the reaso ns why we cou Id not set an ad mmis
ac,.. ' q In trat1ve lurut to the
"'eptance of papers and also accounts for the delay in the publication of the proceedings.
.

5
4
 TABLE OF CONTENTS

VOLUME I

1. Biomaterials

S.
BERD NIKOV, s L.) bones from excavations
analysis ofelk (Alces alce . .. .. . .. .. . .. . . .. . . . .. ... . 15
An osteological . .. .. .. . .. . .. ... .. .. ... .. .
.. .. .. ... .. .
.. .. . .
.. ... .. .. ...
.. .. . ..

a
.. .....

Latvi
..... ...

, Eastern
. .. ..
.....

Basin
.. .. ...

a
.. ..

Lake
.

na
. ... . .
..

in the Lub
.. . .. ..
....

S. & HERRMAN,N B.
SKOPF, B., HUMMEL, ...................................................
.......................... .............. 19
BURGER, J., GROS ......... ..............................................
lmiques in archa eome try ..... ........
DNA tec
& BARTOSIEWICZ, L.
KISS, ZS., CSAPO JR., J. ........................................................
......................... 23
CSAPO, J., CSAPO- 11th Dynasty Egypt......................
sis of bovin e soft tissu e from
Tue chemical analy
A.
A. M. S. & CHAMBERLAIN,
NIKIN, D. E., COPLEY, M. S., AHMED,
GERNAEY, A. M., MIN reported tuberculosis frequ ency sugg ests
mycolic acid prevalence and .. . . . . ... .. ... .. 27
A correlation between .. . .. .. .. . .. ... ... . .. . . .
.. . .. . . .. . . .. . . .
.. ... .. ... .....

..
.....

s
.....

lation
..... ...

popu
..

nt
.. ...

ancie
..

rty in
.. ....... ..

or pove
....

f
.

'
. . .. ...

'
..

arker
.. ..

biom
.. .. .

a
.. ..

G., SCHROTER, P. & MID
PRICE, T. D., GRUPE,
of huma n bone
Strontium isotope studies
QUEVEDO LARA, T., CORONAD
QUEVEDO ROBLES, P.,
ofmetals in hmnan and anim
A preliminary determination
locen e perio d in two
from Pleistocene-Ho
DLETON, W. D.
er ................................................
.............................. 33
and tooth enamel: the European Bell Beak
,
O, G. 0. & ERICK REBORA H.
al bone s
...................................... .41
........................................................
regions of Mexico ........................

RUDNER, E. Z. & JEREM,

E. ......................... 45
........................................................
tigati ons at Sopr on-K rauta cker (NW-Hungary) ........................
Anthracological inves
R. & VARGAS-SANDERS, R. .. .. . .. .. .. .. . .. .. ... . 55
SALAZAR, C. Z., ARRELLIN, . ... . ... . .. . .. . .
lations by using DNA analysis
. . ..
.. .. . .. ......
. ...

popu
.

c
......

spani
.. ..

Prehi
.. ...

can
. . ..

Mexi
...

in
..

A study ofmigration
..

A, G.
L., VALADEZ, R.,& ZARAZU ...................... 59
TEJEDA, S., MANZANILLA, n site ................................................
ns of estron tium and zinc in animal bones from the Teotihuaca
Paleodietary applicatio
, E. 0. & MARTINEZ, R. D.
VARGAS-SANDERS, R., DIAZ
Identification ofancie nt prote ins from a ceramic sculpture .......................................................
63
ess ................................................
ictlan tecuh tli at the Temp lo Mayor, Mexico - News and progr
ofM

2. Dating

W., DEREVIANKO, A. P., TSEV

EENDORJ, D.,
BLACKWELL, B. A. B., OLSEN, J.
SKINNER, A. F. R. & DWYER, M. .. .. .. .. . .. . . .. . . .. . 67
, Mongolia . .. . . . . .. .. .
the Paleolithic site at Tsagaan Agui
... .. .. .. ..
.. .. .. .. ..
. .

ESR (Electron Spin Resonance) dating

... .. . . .......
.. .. .. ...

CSAPO-KISS, ZS. & CSAPO, J.

JR.
CSAPO, J., NYBERG, J., MALMGREN, B.,
In what way, what for and what limits can amino
acids . . . . 77
. . .. . . .. ... . .. .
.. . .. . .. . .. .. .. .. . .. .. .. ..
.. .

try? . .. .. .
.. ...... .. ...
.. . .. ..

and amino acid racemisation be used in archaeome

.. ... .. .. ..
.. .. . .. .
.. ... . .. ..
.. ... .. ..
.. .. .. ......
....

DAYTON, J. E. ................
................
........... 83
................

The problem ofchronology

................
................
................
................
................
................
................

HEDLEY, I. G., & BILLAUD, Y. ................. 91

........................................................
error ................................................
Deformation ofburnt structures and archaeomagnetic
LASZLO, A. .................. 9 5
........................................................
prehistory ........................................
Towards a radiocarbon chronology ofthe Romanian
ZS. & CSAPO, J. JR.
NYBERG, J., MALMGREN, B., CSAPO, J., CSAPO-KISS, ........................................................
... 99
acid comp ositio n ........ ........................................................
Age estimation ofcoral based on amino

3. Field Archaeology

AIDONA, E., SARRIS, A., KONDOPOULOU, D. & SANAKIS, Y.

A detailed study ofthe archaeological site ofKitros (N. Greece) .. 103
....................................................
........................................................
by combined magnetic and spectrometry methods ........................
.. .
UR, S. & ESIN, U.
.

ERDOGAR : N J., OZER, A. M., YILDIRIM, H., OZEL, M. E., GUL<;

enhance ment teclmiques

Application ofprincipal components analysis and edge ............... l 09

...................................................
.

r the detecti on ofprehistorical sites in Centr al Anato lia ........................................................

fo

9
 ERGENE
An eth\ \l}..i
an d th \)!I t 'tl
e l\) l:!l1 .
GARRlSG l)ll. o1og
e ical comparison: the Kerkenes archaeological survey WOLF, S.
:a: :

<\ (j
f erkenes city and the Keykavu
s castle ..........................................................................................................
.................113
.
Questions, answers and limitations: chemical, mineralogical and petrographic d1stmct10n
. . . .

bet ween three Medieval brick productions in Switzerland..........................................................................................................................257

l\\p <:i&ic & SC HNEIDER, K. A.
KADERBi'l' Ill ft a l con
ng, usmg cryoprobe techniques
oViil 'A.., l<:lllJ. the American Southeast...............................................................................
.................................................................119
a \ \\ G, A. & WAGR, G A. General Archaeometry

RAi<:i ;: :
PAVLIS
. \'l:!\ <l \\i:t<:l
(
8{
g
:
ts near archaeological sites as a key to the past landscape evolut10n under human
d fr m the Kraichgau Hills in southern Germany .............................................
impact.
.

..........................................123 FERENCZ, CS., FERENCZ-ARK.OS, I. & FEHER, A.

e , . . Application ofstructure analysis in archaeometry .... .. . . .. .. ...... .... .... ... .. . . .. ... .. .... . . . .. ...... .. 263
Investig l'lti\\
" ).. <:ia rchaeo1og1ca .
lvsz'f 1 report Te 1 Kedwa, sma1, Egypt ........................... , .......................................
. .. . ... . ... .. .... ... ..... .... . .... .... ..... .... ... .... ..... ..... ..... ..... ..

ofaeri l ..............................................131

a . SZABO, G. & SZONOKY, M.

(
.

A, S., CZAJLIK, Z., HOLL, B. & MARTON, A.

SARRIS ' I\,P\\ )<:if arch Experimental data to the trade ofraw materials in Europe during the Late Bronze Age ............................................................................267
llt(),,_ aeological sites with the integrated application
A geop1, ):\ <'\t,l
'-l s <>a phY,
magnetometer surveys and archaeological excavation ............................................
................................................135

s s , A., l i;: l\ I ' ?EORGILA, K., KOKKINOU, E., KARIMALI, E. & MANTZOURANI, E.
.,
GE
ca
1 gn at the Neolithic settlement ofKandou- Kouphovounos (C rus)
yp ......................................................................145
VOLUME II
The Isl S, Qi U, L., GKIOUROU, A., KARATHANASIS, CH., STEFOULI, M.,
q <\ l\ "KARIMALI, E., GIANNOULI, E., GAVALAS, G., ASVESTAS, G.,
SARRIS 'A \)f
4.a. Pr ovenance metals
A :' lOANNou' D & VRONTAKI E.
MAN \ V A "...'-lll.0rgos: micro-scale & macro-scale
.
'
. Al:<\" remote sensing ......................................................... ..
Ancient "\j '12
lDis, A., MERTIKAS, ST., GUY, M., VRONTAKI, E., ............................................
.149 .
ADRIAENS, A., EARL, B., OZBAL, H. & YENER, K. A.
SCURTU ' \. ct \) & KALP AXIS, TH. Tin Bronze Metallurgy in Transformation : Analytical Investigation ofCrucible Fragments

The geop t rirnoupolis, Lasithi): an archaeological site as a remote sensing laboratory............... from Tell al-Judaidah, Amuq (Turkey) Dating to circa 3000--2900 BC......................................................................................................273
.. l .....................................................157
SUMEGI, p i BALASSONE, G., BONI, M., DI MAIO, G., FARIELLO, M. & VILLA, I. M.
EllVlfO
at the
., i:l}:
i ,
tl\ :a1 s::::: ;
I
illa

E
oman town Porohssum m Dacia ................................................................
.
.
..................... l65
Analysis ofthe rings found in the Samnitic necropolis of Saticula (Sant'Agata Dei Goti, Benevento, Italy) .............................................279
BENVENUTI, M., STRILLOZZI, B., MASCARO, I., COSTAGLIOLA, P.,
ange and human adaptation in the Carpathian Basin
<l1:: if ROMUALDI, A. & TA.NELLI, G.
1Postg lacial transition.................................................................................. Tin-rich slags from a 6 th-4th century BC Etruscan settlement at Populonia (Tuscany, Italy) ....................................................................285
.....................................................................171
BEzUR, A.
What's beneath the surface? Metal working techniques in the Upper Mantaro Valley, Peru .................................................................... 291 .

BECK, c. w BOLLINGBERG, H. J. & STRAUME, E.

5. Experimental Archaeology
Perlrandbecken from Western Norway and Belgium: A trace element comparison ...................................................................................297
Ancient p ,\
CLAYTON, R. E., GALE, N. H. & STOS-GALE, Z. A.
i ! \.\, Ill t'l'oh
EC LE S O
<lt T, E. C., LEE, K., TODTENHAUPT, D. & KURZWEIL, A. . . . . .
Isotope fmgerprmtmg ofancient tm: prel'=ary stud'1es ......................................................................................................................... 301
FAB::\\{I:'\ 8'e1;;: l ons between manufacturing methods and composition.....................
.......................... .....................179 COSMA, C., DARA.BAN, L., SUCIU, D., FIAT, T., TARSU, T., BOROS, D. & RISTOIU, D.
..

Analysis ofsome Ancient and Medieval coins by neutron activation and X-ray fluorescence ...................................................................311
1: ;;,t
o
0 )J ing ofcopper and bronzes in sand moulds .......................................................
...............................................................185 CZAJLIK, Z. & G. SOLYMOS, K.
e
.\' ' 'flERI, S., & SANTORO, S. Analyses ofingots from Transdanubia and adjacent areas ........................................................................................................................ 317
GYULAI t he firing atmosphere in the
. "' ' F.
..

'O f production
Bwwstory. DILLMANN, P., FLUZIN, P. & CHEVALLIER, P.
Cs With ca1c1'te and chamotte mc1 us1ons ...............................................................
................................ .............................191 Application ofsynchrotron microdiffraction coupled with X ray fluorescence microprobe for the determination
IOVINO, l\' at 11.
ofthe iron making processes by identification ofinclusion in archaeological artefacts ..............................................................................327
Processiu
Szarvasgede (Hungary): a case 1cor b 10 ' rs1ty c onservat'1on .............................................
' d1ve ............. ............................. l97 ENIOSOVA, N.
MAR TON, l E"'
:'11!ilt h obsidian tools: the micro-wears ...................................................................
.................................................. ............203
Casting moulds from the Upper Dnieper Region (10--1 l th centuries AD) ..................................................................................................335
EREMIN, K., GRAHAM-CAMPBELL, J. & WILTHEW, P.
t' vl{_yArn' T Analysis ofcopper-alloy artefacts from pagan Norse graves in Scotland ...................................................................................................343
, , L, 'll
PAVLISH ._ % tect .

Loom in the Carpathian Basin (Hungary)

Experun t he Archaeolo GALE, N. H. & STOS-GALE, Z. A.
gical Park, Szazhalombatta) .....................................................................
.................................................207 The characterisation by lead isotopes ofthe ore deposits ofCyprus and Sardinia
PAVLISH, L. . \vt
t and its bearing on the possibility ofthe lead isotope provenancing ofcopper alloys ..................................................................................351
::: s lb a bow and arrow
213 GEGUS, E.
..........................................

PA . . . .
..............................................................

. . . .
...........................
. ........ .................

Achievement m spectroscopic mvestlgat10n ofarchaeological metal objects m Hungary ..........................................................................363

Frozen ho
PAVLISH, L
\\e in
ll t:V
1:;;:;;. ;....:..
an
...... ..... .... .. . ... .. . . ... .......
. .. . .. .. . . . ... .... ... . . . ... ... ... . .
..... ... .. . . .
. ...... ..... . . .. .219 GONDONNEAU, A., NICOLET-PIERRE, H. & GUERRA, M. F.
ER
... ... ... . ...... .

...... . .... . ..

al< The Persian and Macedonian gold from Croesus to Alexander the Great.. .................................................................................................369
Flume e)(p :'.'\., P. .
ge e xpenmen ts ...........................................................................................................

!7':'.::t
' a ..................................................225 OOMORI, J. & TOROK, B.
PAVLISH, L. ""' ''l.BlNDIE NST , M. R. & SHE
PPARD, P. J. Technical examination ofthe Early Medieval ferreous metallurgical finds from Hungarian sites ..............................................................375
0 ZJ ond bone ..................................................................................................
...................................................231 INGO, G. M., DE CARO, T., ANGELINI, E., BULTRINI, G., CHIOZZINI, G. & MICHELETTO, E.
P
Copper plating on an iron artefact from the early medieval site ofPeveragno (Piemonte, north-western Italy) ......................................... 383
l.' brea kage from bow-driven arrowpoints in
VO=
Experimen"
two white tailed deer carcasses ...................................................
....................239 INGO, G. M., DE CARO, T., TUCCI, P., BULTRINI, G. & CHIOZZINI, G.
Early iron artefacts and slags from Tell-Afis (north-western Syria):
}.. SU.It s from the Sza'zha1ombatta

' Archaeolog1cal Park......................................................................... microchemical studies for locating the iron ore source ...............................................................................................................................389
.................................243

: J.
'M. & MAGGETTI, M. KASZTOVSZKY, ZS., REVAY, ZS., BELGYA, T., FAZEKAS, B.,
g ofclays using salt water ............................................................................
..................................................................249 OSTOR, J., MOLAR; G., VADAY, A. & FIGLER, A.
.
Prompt-gamma activation analysis ofRoman brooches ............................................................................................................................ 399 .

10 11
 KOLTO, L.,K. \>
Analysis of h_i
i \
XRF analys is% \j"\
LINKE,R.,
ll
SCJ..\f :I.\1,1.\ % . llti.y
(Q: MACL
t L., v AN DER WESTHUIZEN,w. A. & THUYSEN,J. oos
\Ill }.1.' '. \ll ti. concentrat10
Non-destmct\ EAN, P.
. JACOBSON,
LIVERSAGE, D
lily ,isY bronzes ..........................................................................................................................................
.....................585
n finds with various method material for inter- and intra-laboratory calibration ............................
z l\1l\
s sann certified reference
4' ceramic- I: a new pottery
G. V. & BEUKENS, R. P.
69

\ )\ S
An industry ................... 405
PAVLISH,L. A., FARQUHAR, R. M., HANCOCK, R.
H. & ALRAM, M. KOCH,C. P.,
JNAA ofpottery from ll Lokeridede and Jarigole, Koobi Fora
" W1N1ER, ......587
OZBAL H AD Region,Kenya ....................................................................................
. , ., h_'I 1 /lh." or
'l'llcl<A. .
A.ustr ian Medieval .

MCCRAY,W. P. &
Minor metal!\ '\ sliver coins by energy dispersive X-ray fluorescence ..................................................

0
E.
...4 9 WARREN, A. K.
indications of
ll llp ,
l\l\ ll <\.Per alloy impurity patterns near the end ofthe Hungarian Bronze Age .............................................................4 Strangers in a strange land? - Renaissance glassmaking in Amsterdam ............................
......................................................................... 593

PROHASZKA,
&
,R.
MISONNE,B.,LADURON, D.,BRULET
Technical asp . ti l.\lltsBA.RL, B.
17
GEDIK, B. h ofLate Samian ware from Argonne,
t l\r Provenance study and technolo gical approac
REHREN, TII. s
asso 599
NW Gaul and Burgundy
ciat ed with Anatolian copper and bronze artifacts

llln of
.....
..........................................

VANTINOS,V. & MARAN, J.

..........................................

The developU\ ll \\
MOMMSEN, H.,ANDRIKOU,E.,ARA
polymetallic ores ..........
..........................................
..........................................

...........................................................................................................................
..433
RYNDI NA, N. V Ill\('.\'l:N
\Ji.!;)!(
Ile
pottery
. Neutron activation analysis results ofBronze Age
a '. ................... 607
Eneolithic c st jars ofThebes .....................................................................................
lllirrors from Southern Italy ....................................... . . . . .... . . . . . ... .. ..... .... .. ...... ... ... ... ..... . 439 from Boeotia including ten Linear B inscribed stirrup
' \>,. l I<.. ITER, S. & KENYON,I.
,
ZS., 1' ''

. . . . ...... . . .... . . . . . . . .. . . .. ... .. .

SANDOR, " Y tical c

upellatwn . . MOREAU,J.-F., HANCOCK, R. G. V., AUFRE
BERTOK K (\);_ l\\
Ill the Middle Ages English (1750-1 800) Regime white glass trade beads
. .. .. .. ..... .. ...445 Late French (1700-1750) to Early
ll ushuan site (Eastern Central Quebec), Canada ............................
..........................613
.................... ....................
. . ...... . ......

&,.,
Ashuapm
.

at the
. ..

from a presumed decorated bag found

; ;
"'
Q"'li, li,
l,
\"' t he North-East Balkans............................
........................
.IUHAsz
ofKing Mathi OKYAR, F.
"' KAP LAN- . .. .. . . . .. .. . .. 621
, M. '
.. .. . .. . . . .... . . . .. . .. .. . . ..
1., \ t 1., IARos1, . . . . . . . .. .... . .
.

SEGAL, HAL! Characterization oflznik ceramics .. . ..... . . .. .... . . .

RE TSI S,
. ...

L.,
.... . . . ..... ..... . .
. .. .. . ... . . .. . . . .. . .
. . . .. .... . . .
.. . . . . . .. . . .... . . .. . ... . ..

llt,t l\ iv
l'.l;; ) 'li)t e analys s ofmedieval coins
The metallurgj ONGYOS SY, M. PALAGUTA, I.

: :
.....................627
SERTOK, K., S "' l ' gy dis
techniques ....................................................................................
from the reign Some results ofstudies on Cucuteni-Tripolye decoration
HANCOCK, R. G. V. & B'NAITY, J.

Q\). ay fluorescence method.................................................................................................

rc aeo met ............455 PAVLISH,L. A.,FARQUHAR,R. M.,REDFORD, D. B.,
,
......631
\ handle jars from Mendes, Egypt ........................................................
, .
, of basket
"0 111 Ashkelon Afridar,Israel,
ical analyses
"'t "\\:)
Archaeological, historical and geochem
sz
PEREZ-ARANTEGU1, J. & CASTILLO, J. R.
-
t
and their source ........................ .........................................................
F F & PALMIERI A M
Archaeometan ............461
WAGER' E C W\ . l'.l;il
. .
,
..

s, '. Chemical characterisation ofclear lead glazes on Islamic ceramics

\ \)
.. . .. .. . .. . .. . . . .. .. . ... . ... . ... . . 635
mining area ofHadim-Bozkir (KonYa ' Turkey) .........................................
.. .. . . ... . .. .
Portable X-ray' h-. \\.\ .
"fVey m the ancient . . . . . . .... .
produced in Northern Al-Andalus (Muslim Spain) ........ .. . .....
'
. ... . . ... . . . . . . ..
. .. . . .

THIERRIN-MICHAEL,G.,MASSEREY,C. & GALET

. .. . . . . . .... . . .
. . . . . .. . ... . .. ...

475
... .

1-Q.v
Of Copper Ore :!'\:\
. . . . . . . .. ..... .

TI,G.
Macroscopical,mineralogical and chemical characterization
"'"""'' b.
b s the Carpathian Basin ........................................................................... 481
&
Jura, Switzerland:
W e
ofpottery from an Early La Tene settlement at Alie (Noir Bois),
;li)ll :
a
. "-. "" e analysis as a tool for the identification
:; : s tion of 'low-' and 'high-tec h' methods ...............................................................................................
...........64 1

,r <::. S ites o
An example for the combina
'

n the Great Orme, North Wales, UK ... . . . ... . ...... ...................................................

\\ . t'
\)l .
TUNA,N. 649
CtJ A SE, A4 at Tekir, Turkey ..................................................................
....................491
Spatial analyses ofdifferent ware types from Knidian pottery workshop
<lei( 11'\
. ... .. . . . ... ......

W. T.
TULUN, T., UZGIL,E., GULE<;:, A., TEKIN, A.,BATUR, A.,
laye s ERDEM,A.,KAHYA,Y.,
A.,ALTUN, A.,ARLI, B.,
r on Qucun bronzes ...........................................................................
......................................................497
, G.,SAGLAME R, G., TANYEL I, G., TUTENG IL,
ARLI, H., <;:OBANOGLU, V. & EREL,C.
KOKSAL
DE LA FUENTE
A multidisciplinary study of ancient :iznik ceramics .. .. .. . . .
.... .. .. . . 655
.. ...... . .. . . . . . . . ... . .. ... . . .. . .. .. ... ... ... .. . . . . .
f,
. . .... .

Application o
. .. . . ... . . ... ..

4.b. Provenance pottery

. . . .. .. . . . . .
.. .. . .. . .. .. . .. .. .

YELLIN,J. & CAHILL, J. M.

. . . .. .. .

in archaeolog ic {\
DEMIRCI, S., C \ Origin ofthe rosette-stamped storage jars from ancient Judah: ...667
P
..................................................................................................
Technologica l l \' '-l on preliminary results ofthe neutron activation analysis ............................

&
,.. ,
S, <:>lCalan :ixaly .

DURUZ,M. fvL\ \)
1s
. ' (provenance)
Mde
Cs:

penmental approach ...................................
An Early e i . \>t<\t ............................................................................................ 501
4.c. Provenance stones
G & B..
l'
EGGERT & \;.._ ' '\
'),._ II<. , E. N.,
Of s0111
TURKME NOGLU, A
.
OKE, H.
ft, e Medieval glazed pottery in Anatolia .........

The Eni gma o f : ..................................................................... ... ...... ...... .513

,

M
x ATTANASIO,D., PLATANIA, R., ARMIENTO,D. & EMANUELE,
o
M L&. '\
.,. ."'t 'tty .
. . ... ..

M. C.

Q
EILAND
Infr ;ed :;rkshop from the 9th century at Reinach, Switzerland ................................................................. ..519 A New Electron Spin Resonanc e Marble Database : General features
... 673
c to selected cases ....................................................................................
GARCIA-HERAS \f- tl\i and preliminary application ofstatistical discriminant analysis
..............

H
Green - Medieval lead glass vessels la Heraclius a ,F. & SCORZELLI, R. B.
BELLOT-GURLET, L., DORIGHEL,0., POUPEAU,G.,KELLER
'

New developm
, :.,.. t >obQ.
525
by tot! "'""'\ '

First characterization ofobsidian from Colombian

'
................677
..................................................................................................
GASSNER, V. S
aeolog.cal ceramics
& 'tQ.e , 1 ....................................................................................................................................... and Ecuadorian sources using ICP-AES and ICP-MS ..............
BENEA, M.,MULLER, H. W. & SCHWAIGHOFER, B.
531
R. & TORNERO , J D
-
Archaeo metrical\
ANnEZ RUIZ,
)' '
a . . . ... . .685
.. ..... . . ......... .. .. .. .. . . . .. . . . .. .. .. . . . . .. .. . .
GEBHARD, R., GD''\-
na1ysis ofarchae
The single Roman marble quarry in Romania . . .. . . .. .. . . .
\\->' fluoresce

ological ceramics
. .

PESSINA, A. & STARNINI,E.

. . ... ... .... .. . .. . . .. ... .. . .
.. . . . . .. .. . . .. . ....
. .. . . .. .. . . . . . .
.... . .

RIEDERER,J.,
nce (TXRF) ..........................................................................................
\"I. , .................................................54 1 D'AMICO, C.,BERNABO', M. B.,BIAGI, P., PEDROTTI, A. L.,
Miissbauerstudy te '. Archaeometrical analyses ofpolished stone tools ..............691
..................................................................................................
GRATUZE, B., Dz
l'lsation and provenance studies from the Neolithic to the Bronze Age in Northern Italy ..............
,C.,BORODI,G.,FIAT,T. & DARABAN,L.
!Ctn
on pottery found at Velia (Southern Italy) .......................................................
(_)..,,, :u_,ER,E. , HAUSLER, W .,
547

tZ K
A study ofHung DARABAN, L.,COCIU,L., ZNAMIROVSCID,V.,COSMA
& WAGNER, U.
........697
WAGR,
and semiprecious stones......................................................................

' ltic ott' Some physical control methods for the study of the precious

DARABAN,L.,COSMA,C.,COZAR,0., SIMON,V., ZNAMIR

HAYASHIDA,F., '-
:.,

ery-ma k ing kiln Ill Lower Bavaria.......... OVSCID,V.,

l
z., Ki ,A z.
Technology ,
&
555
JACOBSON, L., v +; d1;1's, . & MESTER. E.
and ".\.
,. ss
..

GIURCA,I.,SALAGEAN, M. PINTILIC A, A.
.. . ..... .... . . .. .. .. . . . . . . ... .. .... ... ..... ....... .. ... . ... ... . . . . .. . .. 705
a glass composition Obsidian provenance studies . .... .. . . .. . . .. .. .. . . .. .....
. .. . .. . .. . .

: preliminary results ................................................................ ....................................565

. .. . . . ... .

XRF anal ysis o f

.

C) .
. . . . .. . ..

DE FRANCESCO,A. M., CRISCI,G. M. & LANZAFAME, U.

. . .. . ..... . . . .
. .. . . . .

w
.... .. . . . .. ..

M.,
.. .

'
.
NEFF, H., RIEDERER,J. & WAGNER U
arion of Jnk
C I< ,
'
.

. HAUSL ER
I-- ,
"
::
ttery production: archaeometric perspectives ........... ....." ..................................... X-ray Fluorescence analysis ofobsidian tools . .. . .. .... . .
.. . .. .. . .. . .. . . .. ... . . .. . . . .. . . .. .... .. . . .. .. .. . . .. .. .. . .. .... . . . . . 709
.. .

'.
. . .. . . . . . .. . .
. ... .. . . .. . . . .. . .
. .. . .. .

DOMINGUEZ-BELLA, S. & MORATA, D.

.... .... .... ... 573
... .. . .. . .. . . . . ....
. .

uciuucN, W. A. & MORRIS, D.

' \VEs'rllT
.... ..

'-
.. .

tlotte
ry from the Riet River Area, Northern Cape, South Africa ............................................................. Mineralogical and chemical characterisation ofRoman wall painting 715
.............. 581 . .. .. .. ... . . .. . ... . . . . . . . . . . .. .. . .. . .. . .. . . . . . .. . . .... ... . .. ..
from Medina Sidonia, Cadiz,Spain . . ..... . .. .. .
. .. . .. ... . . ...
.. . .. . . . . . . . . .. .. . . ... .
.. . . .. .... .. . . . .. . .... ... . ..
.. .. . . . . . ...... .
 I. Biomaterials
bo
ae\V tttQllBte z. BELLA, S., PEREZ, M., RAMOS, J.,
t
Ga
o s <ltlcta als' souce areas and technological relationsh
MORATA, D. &
ips
CASTANEDA, V.
AN OSTEOLOGICAL ANALYSIS OF ELK (ALCES ALCES L.) BONES
l . . between minerals,
\l rehistonc non-fhn
\! t stone tools from the Atlantic Zone, Cadiz Province, SSW Spain FROM EXCAVAT IONS IN THE LUBANA LAKE BASIN, EASTERN LAT V IA
.............................................................. 72
'l'Qe
. . , N ASTICHENKO, 0., PSHEN
ICHNOV A. Y.,
3

14uh.la1y;ENSKY, D., RUTSCHOWSCAYA, M.-H. & BENAZE TII,D.

t> 4{s S,
s of dyeing technology ofpolychro
me Coptic textiles from th e L ouvre collection ...............
................................................... 729
BERDNIKOV, S.

<lC)y ."lllell
, CASEY, J., PAVLISH, L. A. & HAN
COCK, R. G. V. Faculty of Biology, University of Latvia, P.O.Box 66, Riga-JO, 1010, LATVIA
l neutron activaton analysis of siliceou
N e .
s mudstone from the Birimi Site, Ghana ....................................
011 lS ttqcj
., & ILLASOV A, L.
................................ 737

JUt,1 o\\the
A.eneolithic artefacts made from peculiar rock-types: finds
PrQ' l>.
The Lubdna marshy meadows are one of the most important Stone Age investigation regions in the East Baltic area. This
tQ foothills and in valleys ofthe Western Carpath
ians ....................................................................... ............. study deals with elk bones from the Abora, Zvejsalas, Zvidze and Malmuta River Estuary sites, dated from the Mesolithic and
J ............................ 743
Ofl:ll.l'LONG,D. G., HANCOCK, R. G. V. & PAVLISH L. A.
F.
Dt 0% sti.dies fLate Pala:o-Indian quartzite artifa
Neolithic periods. A total of I2,I20 animal bone, tooth and antler fragments were unearthed during excavations led by J. Loze
cts in the Great L akes Region
p t: enc a usrng destructive a nd non-destructive techniques .. ... .................
in I964-1990. Elk was the animal species that was most exploited by the human population. Its bones occupy the first place

ovel cDJ!NGOVA, R., AUDOV, M. & GERGOVA, D . . .

ARN
......... .........................................................................
749 among all herbivores in this material, as well as in materials fmm the entire Eastern Baltic, allowing the creation of a complete

Ge
SJ:! e Study ofIron Age amber from Bulgaria......................................................................................... .................................... ...
'
osteological analysis of this species. Some problems related to quantification are examined, such as the estimation of the

lo!?;ica rvANOV' N., AHLEY, G. .M., ?AL, R., GLASCOCK, M. D. & H. NEFF,
. .. 757 numbers of individuals of elk for each site. Two quantitative methods are used here: counting of the numbers of fragments and

p lt; - g eochellllcal sourcrng ofprehistonc chert

artifacts northwestern Alaska
of the minimum numbers of individuals (MN/). Bone measurements were made for all fragments. These results were compared

ovellew. .
, ........................................................................
........ 761 with K. Paaver's analyses ( 1965) of previously excavated materials from Lubdna and with bone data from other Eastern Baltic
,
. Mesolithic and Neolithic sites. The results are additional to K. Paaver's data. The ecology of the area is discussed with respect
p A deteflalll tlon ofRoman marble sculptures from Pannon ia .............
............................ ...........................................................
l>t;'l'll-()l!?;. zA!<MANY, GY. & T. BIR.6, K. . 767 to the vegetational history and the adaptation of elk.

lh. )3:)(: chemical stues ofNeolithic stone tools from Tolna county, ungary
H ............................................. ................. ............. 777
KEYWORDS: ELK (ALCES ALCES L.), OSTEOLOGICAL ANALYSES,
, M., HO!lVATH, T. & KOVACS-PALFF Y, P.
-
A
ation ofthe stone llllplements
of a Bronze Age earthwork in Hungary ........................................
MESOLITHIC, NEOLITHIC, LUBANA LAKE BASIN.
.................................................. 783

l\.rS()ltlhia c Workshop site

, l\_
Sc;!i:l .
for adze and axe blades near Kottenheim,
Introduction - to estimate the economic value of elk for the Stone Age

e human population.

l>e l:::n,, Y n-Koblenz, Germany ........................................................................................

slt\.C:tf.1t>()lh<.'c Zs., T. BIR.6, K. & SZAKMANY, GY. ........................................................................ 793 Since 1960, the Lubana marshy meadows have become one

l>re t:Yl a stud'1es ofneol'thic stone tools from Baranya County, South Hungary.......... ......................................................... ..............
<>
1 1 .
of the most important Stone Age investigation regions in the Materials and methods

S<
. East Baltic. In 1960-1980, the Lubiina Lake excavation
S()lQeS1()e , erM. S. 797

}:l
l V ssus accuracy in the XRF analysis ofarchaeological obsidian: material has been studied by archaeozoologists, including Geographical characteristics of the sites

e 0n for archaeometry and archaeology .... ............................... ..................... K. Paaver (Tartu, Estonia) and V. Danylchenko (Moscow,
. ................. .............. ................................................ 805

i... Russia). K. Paaver's osteological study of the Stone Age fauna Lubana Lake is situated in the north-western and central
l', l),()<l :& STARNINI, E.
GY.
\! e?s
l>
r r
cal analysis ofpolished stone tools from some Neolithic sites of ungary ......
.
H ........................................................................ 811
(ITaaBep 1965) surveyed materials from the entire East Baltic
area, including Lubiina Lake Basin materials. In the Lake
East Latvia Lowland. The area is covered by wetlands. The
organic layer is commonly 1-4 m deep, in some places
St() . & T. BIRO, K.
v tic l:;: and classical stone quarries ('mines') in the
Carpathian Basin .......................................................................
Lubana material, elk takes the first place among all animals in reaching 6 m (Jlo3e 1979), a condition supporting bone
C: li; EELE, P., WEHLING, B., MOENS, L., DE REU, M.,
............. ............. 819 the Early Mesolithic. During the Late Mesolithic, Early and preservation. This study deals with elk bones from the Abora,
\! b:y e <l ct ?oNK. G., VON BOHLEN, A. & KLOCKENK
. AMPER, R.
Middle Neolithic, elk dominance gradually decreased, in Zvejsalas, Zvidze and Malmuta River Estuary sites, dated
()l t <l l tizat1n ofpigmen ts in Mercatellis manuscripts creasing again in the Late Neolithic. According to K. Paaver from the Mesolithic and Neolithic periods.

;::;::;::v;
,r
t croscopy .................................................................................... (ITaaBep 1965), the Early Holocene elk had larger body size
, ................. ............. 825
, . in comparison with the Middle Holocene elk. In the Middle Chronology
S(J Ce
: di s f prehistoric flint from the Gargano mines (Puglia, Italy): Holocene (from the Atlantic climatic period till the Sub
1'" c ensat10n ......... ....... ............. ........................................................................... Boreal period), elk body size gradually decreased, increasing Results of 14C-dating for all four sites are given in Table 1.
..................................................................... 82 9
.
\Vts t!?;Uu C., NIJAGUNAPPA, R. & PA VLISH, L. A. again only in the Late Holocene. Radiocarbon data were obtained from the St. Petersburg
:t;-l'e mound: provenance of unusual glassy materials ....... .... .................
. . .................................. ........................................ The present osteological material was collected in Technological Laboratory of the Institute of Archaeology,
............. 833
c() tli ' S., SARIN, P., OUSTER
HOUT, R., DE SENA, E. & WILLIAMS, W. 1964-1990 from all Stone Age archaeological excavations of Russian Academy of Sciences (JIE) and in the Geobio
gillents from Byzantine Cappadocia, part II ........... ......... ............ .....
... . . .............................................................................. Lubana Lake, including elk teeth, antler and bone fragments. chemical Laboratory of the Institute of Zoology and Botany,
....... . . 839
There are many known zoomorphic sculptures, which Archaeological Age, R.P. Age. fl.C. Arclwcological Cl.imatic period
represent elk, and hunting tools, made of elk bones and site period
antlers. The high percentage of elk in this material allows
complete osteological analyses of this species.
Zvidrc 7650+/-IOO - 57(Xl-2800 i
M ddle The end of Bnreal- the end
This type of study can help to determine changes in the
4750+/-60 Mesolithic- of Atlantic
population and morphology of Lubana Lake Basin elk during
Middle Neolilhic
the Stone Age in relation to climatic and vegetation
Zvejsalas 4905+/-70 2955 Early Ncolithic Atlantic
conditions, and to determine Stone Age hunting strategies in
Middle Neolithic
the East Baltic area.
The objectives of the study were: Malmma River -2500 Middle Neolithic The end of Atlamic

- to detennine from osteological material the number of elk Estuary

fragments and the minimum number of individuals; Aboral 3860+/-100 1890 Late Neolithic The second pml of the Suh
- to determine quantitative changes in the elk population Boreal
and morphology changes during Stone Age pe1iods;
- to compare our results with K. Paaver's work (1965) and Table 1. Chronology of Lub<ina Lake Basin
with other bone data in the literature; archaeological sites.

14
Proceedi11gs of the 31" Imernational Symposium 011 Archaeomet1y, Jerem, E. & T. Biro, K. (eds.), Archaeopress-Archaeolingua, BAR- Centi: Ew: Se1: I.
 Berdnikov, S.
Estoni a11.
An osteological analysis of elk ( Alces alees L.) bones from excavations in the Lubana Lake Basin, Eastem Latvia

carbon cl Acac1e
('t at e lll y of Sciences (TA). There are layer and 46 (9.79%) for the Middle Neolith
them sf 40 radio- ic layer of during the Stone Age Conclusions
r the Zvidze site (ll 03e 1988), Zvejsalas site, 169 framents (30.95%) for M01phological changes of elk
occup t l
:\- 72 but only two of the Malmuta River
z t()ll. () and TA-180 l ) reflect the entire time period of Estuary, 823 fragments (12.91%) for the Abora
f h l site. Results
vejsa a (1'A.-
s e Zvidze site. There is only one date fo r using measurements of the first phalanx, it was possible to I.Minimal number of individuals of elk is 20 individuals
of MI e timation using various methods (the
largest value) in elk for the Zvidze site, 8 for Zvejsalas, 12 for the Malmuta River
(llo3e 1
. 988) 95) (JI03e 1988) and 3 for the Aborasl site are given m Table 2. estimate elk body size. The results indicated a decrease
, beginning of Atlantic period (Zvidze site) till the Estuary and 29 individuals for the Abora l site.
1972) ts
bu t on1y one (JIE-749) (Semyon The values depend on the method used, size from the
from K llsec1 h tsov et al. the Fieller &
ere. The dating Turner method yielding values significantly end of Sub-Boreal period ( Abora l ) (Table 3). 2. The elk population size gradually decreased from the
a
l> ave of the Malmuta site is taken lower then the
Pal The reasons for such morphological changes are not Middle Mesolithic till the end of the Middle Neolithic and

. Yll.()l() . r 0 965). other three methods. A total of 7130 elk

bones (58.82%)
with ve g1ca1 known. However the decreased body size may be due to increased in Late Neolithic again.
et research helped to relate cultural site layers representing 69 individuals were examined.
Zv1'dze sg a t1() climatic (during the Atlantic period) and vegetational 3.Elk body size gradually decreased during from the
t e, n and climate development periods. At the
Mesolit! the Archaeological sitf changes, since body size in a cold climate is larger then in Middle Mesolithic till the Late Neolithic.
Qc
la following vegetation periods were recognized: 4 . The obtained results mostly agree with previous works.
Co1Ylus y er . Zvcjsalas warmer climates.
1 With Betula, Pinus, Picea and some Ulmus,
layer w ll()lle 1. 5.Elk was one of the most important Stone Age game
lth f moreal climatic period), the Early Neolithic
C0 ryl Us U hiz-1 MelhoriforMNI z,idze The Enrly The Middle Malmuta Abora1 Total Category Archaeolog ical Climatic Number Min-max Mean St nndard Coefficiefll tlf
animal and it was the most exploited by the human
with Q ll()lle11. s,
Quercus, Trapa natans and some Pinus, period population.
fiile r;111ge'ii de\'imion variety
i:timation Nt:olithk luytr
( t
Neolithic

(the en e ,..clt s
A. Intic period), the Middle Neolithic layer l:iyer ml!lli)Ures
Caskel's
Quercus A n .
() f t nd T1lia pollen with Picea and Pinus additions
ttc (Jl03e 1988). At the Zvejsal Formulae
20
II 25 64
Greatest length Z\'ilJzc Atlantic I 7 I .8-89,3 79,86+!- l.46 s.7 6.85
References
period
Pi
e ?
(()<l c Pmus and Alnus occurred in the as site, Tilia, Ahoral Suh-Bore11I 18 7.l.5-81.l 77,52+/0.70 2,99 3.86
MN! ll
part of e 1 Atlantic I 8 58
Bridault, A., 1992, The status of elk during the Mesolithic,
88). The Aboral site was dated to the second GMT 19 12 29 60 K. Paaver's 32
(JI03e 1 Sllb-l3
Atlantic 72-90 79.16t/O,x7 4,9 6.19
Anthropozaologica 16, 151-160.
979). ' ()real period (Picea and Betula pollen) Fieller & Turner method
Casteel, R. W., 1977, A consideration of the behaviour of the

A to
y
tal 1
<Ima

f h e Pollen data are shown in Table l .

were St <i? 1 2 minimum number of individuals index: a problem in
Sub-Horen I 26 70-XS 78, fl)t/.Q,93 4,74 6.06

ll 1 120 animal bone, antler and tooth fragments Table 2. Elk minimum number of individuals
Zvidze ec1 Greatest Zvidze 39 28,5-35.l 5,33
fauna! characterisation, OSSA 3/4, 129-151.
(
Atlarnk 31.68+/0.27 1.69

S57 6377. bones for the Abora l site, 3895 for Chaplin, R. E., 1971, The study of Animal Bones from
and 47 f f
0 from the Lubdna Lake Basin sites. hn::-.ad1h of
()
r()tll. r ZveJsalas [97 from the Early Neolithic layer proximal end
Archaeological Sites, Seminar Press, London and New
Malmu t a th e
The ltiv Middle Neolithic layer], and 546 for the Elk population quantitative changes during Abo1...il Suh-fiorl.'al 4] 22.S-35.5 :lf .41}+/.-0.32 2.07 6,59
York, 170 pp.
llte s er Estuary)
the Stone Age
Estuary er v r Daugnora, L. & Girininkas, A., 1996, Osteoarcheologia
a
l <ln<l z .10n of bone material is good (Malmuta River The elk percentage in the material was used

to indicate
K. Paaver's 31 3.91
sites) (Lithuanian Osteoarchaeology), Savastis,
A1lantk ]9.]5 32,,U+/-0.22 1,27
Lietuvoje
e Vt ze sites) or average (Zvejsalas and Aboral population fluctuations during the period from
Syste \Jst e d the end of V ilnius, 171 pp.
data

t c l g . cal Early Holocene till the end of Middle Holoc

material is stored in the Museum of
Latvia. <l t <ll z 1J 1J 1 ene (from the Driesch, A., von den, 1 976, A guide to the measurement of
Sub-Rc>reol 26 28-35 31,13+/.Q,37 t,88 6.05

IJ1Jl1Jgy at the Faculty of Biology, University of Atlantic climatic period till the Sub-Boreal)
. Elk numbers animal bones from archaeological sites, Harvard
gradually decreased from the beginning to
Quantir the end of the University.
Atlantic period (from 13.48% in Zvidze Middl
Qtive e Mesolithic Table 3. Osteometrical analyses of elk first phalanx Dming, E., 1986, The fauna of Alvastra, OSSA 12, 210.
analyses of Middl Neolithic to the 13.40% and 9. 79% in
Some
the material Zvejsalas Early from the materials of Lubiina Lake Basin. Fieller, N. R. J. & Turner, A., 1982, Number estimations in
ll and Middle Neolithic). Elk numbers increa
such as tb. l'IJbl e s sed again during vertebrate samples, Journal of Archaeological Science 9,
e es lll . related to quantification were examined, the transitional period from the Atlantic climatic
each sit l'\l; tilllat period to the Comparison with K. Paaver's data 49-62.
the nutn () t o of the numbers of individuals of elk for Sub-Boreai (up to 30.95% at the Malmuta
River Estuary, Lougas, L., 1994, Subfossil Vertebrate Fauna at Asva Site,
quantitative. .
e rs methods were used: counting of Middle and Late Neolithic). During the Sub-Boreal
individu \Jf
f a climatic There were no significant differences between our Saaremaa, Reports of the Estonian Archaeological
<ll s
(Chapli n (lvf r gments and of the minimum numbers of period the elk population decreased again (to
12.91% in the measurements and K. Paaver's data (Table 3) and the trends 5, 71-93.
N l).
Society
Counting of the number of fragments Abora l Late Neolithic). Population quantitative
other s ecl 97 l)
changes are observed were generally similar. According to K. Paaver Semyontsov, A. A., et al., 1972, Radiocarbon dates of the
e s \\las used for estimating elk quantity among shown in Fig. 1:
The t e ... a ct f . . . . (1965), the number of elks increased in Sub-Boreal period, Institute of Archaeology 3, Radiocarbon 14, 336-367.
p e n or companson with other quantitative data. Middle Mesolithic - Middle Neolithic;
changes ta 1-2:
2-4: but our data suggested that elk numbers increased JI03e, M. A., 1979, Il03gHHR HeOJIHT H paHmn1 6poH3a
e
duti ng of elk was used to indicate population transitional period from the Middle Neolithic
estimati() to the Late significantly only during the transition period from the [Late Neolithic and Early
g t he Stone Age. Four methods for MNI
Jly6aHCKOR paBHHHhl,
ll. Neolithic; 4-5: Late Neolithic.
formula "-'ere Middle to Late Neolithic. This may be explained by the larger Bronze Age of the Lubana lowland], Pura, 3uHaTHe,
Used: MNI, GMT (Chaplin 1971),
(Fieller (f2a8
l'ut t ee1 1977) and Fieller & Turner's method
Casteel's The decrease of elk numbers during the Atlant
associated with declining food supply (Betul
ic period is scope of Paaver's material (entire East Baltic), compared to 211 c.
n er 19 a, Alnus , Picea, the Lubiina Lake Basin data, since the elk populations may JI03e, M.A., 1988, IloceJiemrn KaMemmro BeKa Jly6aHcKoli
82) Pin'.1s) due to climatic changes. During the have been different.
Osteo,11 Sub-Boreal pe1iod, IDI3IIBhI. Me30JIHT, paHHHR H cpegHHR HeOJIHT, [The
et,,. coruferous and successional (birch, alder)

lcql tree coverage Stone Age Habitation Sites of the Lubana lowland.
a nalyses of the materi increased at the expance of Quercus and Ulmus
Standa ct. b al , and wetland T he value of elk for the Stone Age human population Mesolithic, Early and Middle Neolithic], Pttra,
t expanded, creating good conditions for elk.
using the ()n e 3HHaTHe, 211 c.
A.. b . llleasurements were made for all fragments,
This sys t 35,00 , The high number of elk fragments (58.82%) in the Lubiina IlaaBep, K. JI., 1965, <l>opMupoBaHue Tepuo cpayHhI u
t e Q b. ttesch measurement system (Dries
ch 1976). iii
.....

allowing Lake Basin osteological material indicates that elk was the
.....
...... ......... ......... . . . . .. ..
.. .. . . . ............................ ...............................................
.... . ....... .......... . .... ...... ..

a8
.. .

B3MeHqBBOCTb MJieKOJIHTaIOBX IlpH6aJITHKB B

Nt C l'll. p b e en used 30.00
1994).
() . routine ly by East Baltic authors, most exploited by the human population species, together roJiou;eHe, [The formation of the1iofauna and variation
eal s :1son (Daugnora & Girininkas 1996; Lougas e 2s.oo
l. .5 with wild boar (Sus scrofa L.) and red deer (Cervus of mammals in Baltic during the Holocene period],
ere compared using student t
criteria. :!!: 20,00 elaphus L.). The osteological features of the bones (all the TapTy, 494 c.
.,
'O 15,00
., bones of the skeleton are represented, many pair bones)
Numbe,,.
esults and discussion Cl
!l 10.00 suggest that elk was hunted near the site and transported as
Offrq .,c whole body, not by parts of body as in sites from Western
5,00
8177ents and MN! estimation .,
The fol 0.. Europe (During 1986; Bridault 1992). Elk bones and antlers
l 0,00 -- .. . .. . ..
-............... .... j
among all..i()"-' ill Stone Age period were used for tool-making, and elk may have been a religious
---------
-;:;----- :. ---... ............
..................___

(13.48%) l'll.a18 g numbers of elk bones and their proportions symbol for the Stone Age people (Bridault 1992) .
' 13 f \\lere obtained: 525 bones at the Zvidze site Fig. 1. Elk population quantitative
changes
r agrnents (13.40%) for
the Early Neolithic during the Stone Age.

16 17
 DNA TECHNIQUES IN ARCHAEOMETRY - NEWS AND PROGRESS

BURGER, J., GROSSKOPF, B., HUMMEL, S. & HERRMANN, B.

Historical Anthropology and Human Ecology,

Buergerstrasse 50, 37073 Gottingen, Germany, e-mail: jburger@gwdg.de

Over the last 15 years, a series of molecular-genetic investigations has shown that, under favorable conditions, DNA can be
preserved for even thousands or millions of years. In the beginning, research focused on well-preserved soft tissues (e. g. Thomas
et al. 1989), but ancient DNA research soon shifted emphasis toward investigating skeletal components (e. g. Hage/berg et al.
1989; Hummel & Hernnann 1991; Hummel et al. 1996). Other archaeometric sources of organic origin or with organic
components were only sporadically or unsystematically checked for DNA content (e.g. Hardy & Raff 1997; Reese et al. 1996).
An archaeometric project at the Dept. of Historical Anthropology and Human Ecology, University of Gottingen, is now largely
devoted to detecting and analyzing DNA in cultural-historical and archaeological objects. The following remarks are intended
to show in examples the materials for which and the extent to which ancient DNA analysis can be used in archaeometric studies.
Three fields can be distinguished. An example will be given for each.

KEYWORDS: ARCHA EOMETRY, ANCIENT DNA (ADNA), SPECIES IDENTIFIC ATION,

DNA DEGRADATION, ROCK ART, BONE, HIDE.

Identification for species identification. Fig. 1 shows a DNA sequence

of the species/genus of origin
The initial question is whether a find with organic
components is a plant or an animal remnant. Then comes
molecular-genetic taxonomic identification. Here, the goal is
to determine what species of plant or animal is responsible for
the organic record. For example, this method can determine
the content of archaeological cooking or storage pots.
A nother practical application comes from archaeozoology:
in osteoarchaeology, it may be difficult to discriminate
fragments of bones of closely related species, for example
ibex, chamois, or saiga antelope if the fragments are small or
in bad condition. The same is true for many other species, for
example, in discriminating between cattle and bison or
between all sorts of Ovicapridae. DNA sequencing of highly
polymorphic loci is the common molecular genetic method
obtained from a bone fragment from the Lower Pecos River
Region, Texas, USA. W hile morphological analysis assumed
it to belong to the suborder Ruminantia, DNA analysis
unambigously shows that it was a Odocoileus viriginianus
(white tailed deer).
In most cases, we found DNA sequencing much too costly
and time-consuming, at least compared with classical mor
phognostic methods. We therefore developed a Restriction
Fragment Length Polymorphism PCR (RFLP-PCR) method
that allows species identification from the smallest organic
traces at low expense. Fig. 2 shows results from osteological
samples and explains technical details. The agarose gel shows
that it is easy to distinguish between sheep, goat, cattle, and
human. For the first time, this method has been applied to
archaeological remains. The method is suited for high through
put and helps where morphological identification is unsure.

10 20 30 40

c C .t\ ;;, A. C '!' C G G A 'l' T A C P. '1' ;.. C C C C A C '1' A T G C T rr A G C C C T A A A C A Odocoileus viriginianus

sample sequencel
aamplu scquence2

pl.'ime:t rR4.a

50 60 10 ao

T A A A T ('>. G T T A T A T '\ l' .,\ c ;. A ,, A c T ,, T T c G r. c A G 'A G T A c T A c c G Odocoi leus viriginianua

sample sequencel

sample sequ
_ ence2

90 100 110 120

GCAATAGCTTAAAACTCAAAGGACTTGGCGGTGCTTT Odocoileue viri9inianue

. c .
sample sequencel
. . . . (' .
sample sequence2

c primer rR4c-rc

Fig. 1. An aDNA-sequence from the archaeological bone was obtained twice from independent PCRs.
The comparison to reference sequences from GenBank shows that the sequences are identical
to the species Odocoileus viriginianus. Only at position 89 the anciemt sequences differ
from the GenBank sequence in one nucleotide (C-T).
DNA was obtained from bone powder by phenol!chlorophonn extraction. PCR primers that amplified a portion of 12S
ribosomal RNA gene were: rR4a: 5'AAC TGG GAT TAG ATA CCC CAC TA 3' and rR4c: 5'GAA GCA CCG CCA AGT CCT
3' Sequence analysis was carried out on AB! 310 Prism automated sequencer:

o,.____ ,.,,,. __ -'"''"I" lnornnt;ro,,nl ,<;,mmro<i11m nn Arrhnenmetrv. Jerem. E. & T. Biro, K. (eds.), Archaeopress-Archaeolingua, BAR- Centi: Ew: Se1: I.
 Burge 1; J., Grosskopf, B., Hummel, S. & Hemnann, B. DNA techniques in archaeometry - News a11d progress

I)) I)) I)) I))

primers are labeled with fluorescent dye. ns in PCR tubes lead to mistakes in sequence P.. -0.. -0.. -0..
contanunatio . . E E c
Analysis was carried out on a 8% denaturing to the genera t10n of PCR artefacts. Fig. 5 <'d Cd <'<! ....
....

ana 1 s
ys1 or even . . . "'
-
VJ VJ VJ
s::
..

al case of a PCR amplificat10n of a m_ito- c t:

......
polyacylamide gel using a Ll-COR Gene ReadIR typic c c
sho ws the I)) u . .
u

sequence. With 35 cycles, one of

4200 automated sequencer. the ancient u ' () u u ,,;
chondrial c
@ <'<! ro <'<! 0..
c s:: c

ws a positiv e signal, but increa sing the number of

samples sho
Production techniques, u sage, and that this result is not re li a bl e, smce b an ds appear
cycles shows

functionality sampl es as well as m the no-tem plate controls.

n the ancient
a sampl e, an amplifi ed contam ination could 35 cycles
; the presence of
Identifying the plant or animal that delivered the organic as DNA from the organic portion of the
:e misinterpreted
portion of a find or a work of art in a certain context can reveal sample.
inants in PCR tubes must be
information on the entire context. For example, a plant residue In consequence, all contam
on a stone tool can mean different things: if the residue is on the tubes for the highly-sensitive PCR
destroyed to clean
an essential prerequisite for ensuring the
the blade, this means that the plant was processed with the reaction. This is
when workin g with ancient DNA.
F"ig
. 2. The
tool, if the residue is found on the back of the tool, this can authenticity of results
a ar
g ose g el s 40 cycles
presumedly indicate a shaft.
b<'\.<>J 96 bp PC diffi I ere n t si hows fragments
of
zefi There has been a lot of discussion about organic Ancient DNA answers questions
<> Jie R. Prod
uct 0rfiour spec
(pri111er froni the . components in rock art pigments. This kind of sample stands of provenance
C
ies.
CJ32b: 5' s B2a: 5 '-T niltochondrial cytochro
paradigmatically for all materials exposed to the air.
T A.TTr me
_

C
lly type
Our experiments show that it is possible to genetica
With re ..c':ATTCA.T GCA T ACGCA TCCT-3';
, The question is: how were paints mixed a couple of
st ictio crcA.
. A
GTGTTA-3') was cut thousand years ago ( Reese et al. 1996)? A superficial down to the systema tic level of an
an ancient sample
n en do
nucl e
a s es Dd ng that it is possible to
e! or Ndell. inspection of a Texas pictograph by SEM shows plant-like and individual. It is extreme ly fascinati
Assig microrganismic strnctures (Fig. 4). These superpositions material back to the animal or the plant
A. s i trace anthropogenic
\vl...<
t iell

s gna t
i on f t o
natio
n deposited on the surface at a later time can have crncial that delivered it. Questions of provenance can be answered
on

t w is d with populatio n 50 cycles

<ll , or i nsta o lated consequences for the genetic identification of possible organic a qualitatively new level. With this, combine
l.:l t h_.,. , 997), o ce' Pans of a P eces i s a question of interest
i .
binders. genetic data, genetic classifica tion has paved the way to
Ct '-'t. C r other so w Or k of a t, a
."-ll e ompan ur ces a r skeleton ( Schultes Thus, removing the superpositions and possible mineral certain natural or cultural environments. The exploration not
sr ng re f o
-lt)_cl. 10n Wh e STR-profi
les
u nd separated from each coatings are essential prerequisites for the archaeometric only of production techniques but also of trade routes, and
e t:> ther i
q_t'tl.ib e ndent solate can answer the frequent
. Th d pa analysis of the pigments, including absolute dating by 14C. with them of economic systems, is close at hand. This opens
l.J r ts
:i..."'-i:- <\ti. ll. t1' 0n o f i 1 s' gra pholo be1ong together or are
u
Amplification of a segment of the chloroplast rbcL-gene perspectives for a great variety of questions and for materials
s 0 a g
"'-1 th_ ear ly
mode
te d a
P rchn i lSts often deal with the from the organic portion of Texas pictographs from the Lower previously unimaginable.
e nt
lti. scro11 e rn scroll an
d a fra r Us Fig. 3 shows a part
sc o . Pecos River Region revealed various plantal sequences which 60 cycles
, gm t
l.J
R flle ca ses,
s e n that is assumed to fit could be identified on the family or genus level. Nevertheless, References
' -l' di{ fragme
nts ca because of possible plantal contamination of surfaces as
er ent
q_ s p .e nb
n a s (see
excluded because they are stated above, no conclusion can be drawn on the composition Hagelberg, E., Sykes, B. & Hedges, R., 1989, Ancient bone
\vi t c n :
not t abo v
e a fo
l m o
r m ag s r example a cowhide of the pigment or the binders. DNA amplified, Nature 342, 485.
:t() l b Identical s oat s .
pecies,
tlli y fllicrosa the f k in scroll. Hardy, B. L. & Raff, R. A., 1997, Recovery of mamalian DNA
h.. te l tellite rag m Fig. 5. Segment of the 16S ribosomal RNA gene
"'l iti.dj . o c i i Ii analysi ent is attributed to the Methodological considerations from Middle Paleolithic stone tools, Journal of
sa s. A.
l ed. The
co mb
e of 12 different micro- Archaeological Science 24, 601-611. (approx. 140bp).
DJ!
V1dua1
lSA. - profile
. i n
s
atio of these loci
reveals After PCR amplification, some of the negative controls, Hummel, S. & Herrmann, B., 1991, Y-chromosome-specific
G . n
l3lvJ Pnm ers: E DNA amplified in ancient human bone, Naturwissen Schmidt, T., Hummel, S. & Herrmann, B., 1995, Evidence of
TB which are regularly carried out in the genetic analysis of older
;
113 i161:i'lI
TGLA 225, ETH 10, BM 2113, schaften 78, 266-267. contamination in PCR-laboratory disposables, Natur
objects, show distinct bands of the expected size. In 1995, our
' 115, ' GLA. 122, TGLA wissenschaften 82, 423-431.
53, SPS group presented a paper clearly demonstrating that PCR tubes Hummel, S., Burger, J., Lassen, C., Rameckers, J., Schultes,
HRA_ 23 Schultes, T., Hummel, S. & Herrmann, B., 1997, Zuordnung
A., and MTG 4b: forward are regularly contaminated (Schmidt et al. 1995). These T. & Herrmann, B., 1996, DNA typing of highly
degraded DNA from human teeth and bone samples by isolierter Skelettelemente mittels aDNA-typing, Anthrop.

multiplex PCR, Amplifications 14, 1: 7ff. Anz. 55, 2: 207-216.

Reese, R. L., Hyman, M., Rowe, M. W., Den-, J. N. & Davis, Thomas, R. H., Schaffner, W., Wilson, A. C. & Paabo, S.,

S. K., 1996, Ancient DNA from Texas Pictographs, 1989, DNA phylogeny of the extinct marsupial wolf,
Journal of Archaeological Science 23, 269-277. Nature 340, 465-467.

Fig
lvith . 3. Earl
a fra 111ode
gme nt as u rn scroll
/ nied t
Fig. 4. Example of a plant s11pe1position on a Texas
0 fit in the scroll. pictograph. Picture made by SEM (Jeol JSM-5400).
 THE CHEMICAL ANALYSIS OF BOVINE SOFT TISSUE
FROM 11th DYNASTY EGYPT

CSAPO J. 1 CSAPO-KISS ZS. 1 CSAPO JR. J.2 & BARTOSIEWICZ L.3

, , , , , ,

1 Faculty of Animal Science, Department of Chemistry and Biochemistry

Pannon Agricultural University, Guba S. u. 40., 7401 Kaposvar, Hungary

2 Department of P hysical Geography, Janus Pannonius University, 7624 Pees, lfjusag u. 6, Hungmy
3/nstitute of Archaeological Sciences, Eotvos Lorand University, Muzeum krt. 4!b, 1088 Budapest, Hungary

Animal remains identified during the excavations of the hilltop Temple of Montuhotep Sankhkara (Thoth Hill, Thebes) included
the mummified remains of a young heifer's leg. It was recovered from the north-western foundation deposit and originated from
the right thoracic limb of an animal that was approximately 2 years of age. Pieces of dry tissue (including skin and tendons) were
removed from the pa/mar side of the metacmpal region. Chemical analyses of the 4000 years old sample revealed a remarkably
good preservation of proteins and high concentrations of sodium. The amounts of ammonia and free amino acids, indicators of
protein decomposition were low. Of the amino acids, sulphur containing cystine and remains of keratin were barely detectable.
Cystine is one of the least stable amino acids, and as such is known to have decomposed even in significantly younger samples
of wool. While soft tissue preservation in the dried cattle leg was most probably due to spontaneous mummification in the windy
and arid hilltop environment, the meat's pre-depositional treatment with salt cannot be excluded.

KEYWORDS: CAT TLE, SOFf TISSUE PR ESERVATION, AMINO ACIDS, EGYP T.

Introduction 3 - amino acids were identified using a LKB 4101 amino

acid analyser (Csap6 et al. 1986)
Ancient Thebes (present day Luxor) in Upper Egypt is well 4 - free amino acids were identified using a LaChrom high
known for its sacral architecture. The temple of Montuhotep performance liquid chromatograph.
Sankhkara is located 492 m asl atop Thoth Hill rising over the
arid, Eocene limestone landscape above the Valley of the
Kings on the west Bank of the Nile (Fig. 1). Excavations by
Gy. Varos brought to light a 11th Dynasty mud-brick temple
built here sometime between 2010 and 2003 BC (Voros &
Pudleiner 1997). Presumably, offerings were placed at all four
Bu bastis
comers of the building which largely had an eastern
Heliopolis
orientation. In addition to archaeological artifacts, the remains Giza. .
of sacrificial animals were best preserved under the north
,
Saqqarae
C a1ro
.
Memphis
western comer of the temple. Of these, of most interest was Dahshur

the dried foot of a young, presumably female cattle, whose

The Fniyum
preserved soft tissues were subjected to a number of chemical
analyses. Herakleopolis

Material and methods

Oxyrhynchus

A 7.1 g sample from the right front foot of a young cattle

Hermopolis Beni Hasan
identified as a heifer (Bartosiewicz 1984) recovered in this
al-Amarna
particular foundation deposit of the temple was processed. Tuna al-Gebel
The bones in this articulated find included the distal half of
the metacarpus and all the phalanges. Preserved soft tissue
was removed from the palmar side of the metacarpal region
(Fig. 2). The aim of this study was to shed light on the factors
b ehind the preservation of this rare find. The basic chemical
Abydos
composition was identified for dry matter on the basis of
Denclara
Thebes necropolis
Hungarian Standard No. 3744-67. The following equipment
Deir ul-B aharQ.
was used in the analysis: Karnak, Lux or
Deir al-Medina
1 - crude protein was identified using a Kjel-Foss nitrogen Esna
al-Kab
analyser, (Foss Electric Danmark) Hierakonpolis
2 - macro (calcium, magnesium, phosphorus, sodium, Edfu
potassium) and micro elements (manganese, copper, zinc, 100 km
iron) were identified using: a Pye Unicam Atomic Absorption
spectrophotometer and Thermo Jarrel Ash Inductively Fig. 1. The location of the Thoth Hill site (open circle)
Coupled Plasma Emission photometer in Upper Egypt.

Proceedings of the 31" International Symposium on Archaeomet1y, Jerem, E. & T. Biro, K. (eds.), Archaeopress -Archaeolingua, BAR - Centr. Ew: Sei: 1.
 CsaP ,
o, J., Csap
6-Kiss, Zs., Csap6 Ji:, J. & Bartosiewicz, L. The chemical analysis of bovine soft tissue from 11th Dynasty Egypt

Quantity that would characterise the de- References

bte rial amino acids
Component
Cmde protein % 1988, 1995a; Csapo &
89.l n of proteins (Csapo et al.
,

cornposiuo . .
Baintner, K., 1976, Takarrna nyozastan (Animal nutrition), in
Calcium, mg/kg 6880.0 . however no such substance s could be identified
Hemes 1991), . .
Hom, A. (ed.), Allattenyesztes (Animal Husbandry) 1.,
Phosphoms, mg/kg 1330.0 fl U.
'
e excellent preservation of the. tissue..
reng th
Magnesium, mg/kg 430.0 s of total ad free ano acids, an attempt Budapest, Mezogazdasagi Kiad6, 295-414.
Aft er the analysi .
Potassium, mg/kg 1020.0 identify the D-ammo acids m the sample. The D- Baitosiewicz, L., 1984, Sexual dimorphism of long bone
was rnade to . . .
Sodium, mg/kg 11000.0 were identified both by 10n exchange growth in cattle,Acta Vet. Hung. 3213-4, 135-146.
anuno acids
.
Manganese, mg/kg 6.0 (Csap6 et al. 1989, 199) and by high Csap6 J. & Ms. Csap6, J., 1986, Ion exchange column
chrom atography
Copper, mg/kg 12.8 chromatography (Csapo et al. 1994). chromatography for the determination of keratin in meat
performance column
Zinc, mg/kg 40.4 meals,ActaAlimentaria 2, 137-150.
Iron, mg/kg 130.0 Free amino acid Csap6, J. & Henics, Z., 1991, Quantitative determination of
Amino acid samEle % bacterial protein from the diaminopimelic acid and D
Table 1. T he chemical composition of bovine soft tissue. Aspartic acid 37.936 8.92 alanine content of mmen liquor and intestines, Acta
Threonine 4.661 1.10 Agronomica Hungarica I-2, 159-173.
10 11.730 2.76
cm not contain ammonia, so that measurable amounts are usually Serine Csap6, J., Ms. Csap6, J. & Ms. Toth, L., 1986, Optimization
5.974 1.40
produced during protein hydrolysis in the laboratory. The
Glutamic acid of hydrolysis at determination of amino acid content in
31.261 7.35
decay that leads to the formation of glutamic and aspartic food and feed products, ActaAlimentaria 1, 3-21.
Glycine
87.888 20.66
acids, however, may result in some ammonia build -up even Csap6, J., T6th-P6sfai, I. & Csap6-Kiss, Zs., 1991, Separation
Alanine
Valine 35.516 8.26
during the most carefully conducted hydrolysis (Csap6 & 11.013 2.59 of D- and L-amino acids by ion exchange column
Methionine
Csap6 1986). The same holds true for fresh meat in general. 14.018 3.30 chromatography in the form of alanyl dipeptides, Amino
Isoleucine
Compared to fresh skin and hair, on the other hand, the Leucine 17.710 4.16 Acids l, 331-337.
amount of keratin identified (Csap6 & Csap6 1986) in the Tyrosine 27.619 6.49 Csap6, J., Ms. Csap6, J., Penke, B. & T6th-P6sfai, I., 1989,
sample may be considered negligible (Table 2; in spite of its Phenylalanine 26.345 6.19 Separation and determination of D- and L-amino acids
good preservation, no remains of hair could be detected on the Lysine 97.748 22.98 by ion exchange column chromatography in the form of
3.819 0.90 diastereomer dipeptides,Acta Alimentaria 4, 399-417.
surface of this find). That keratin was formerly present is only Histidine
12.502 2.94
shown by the very low weight ratio of cystine, which is too Arginine Csap6, J., Gombos, S., Henics, Z. & Ms. T6th, L., 1988,
Sum of total 425.380 100.00
small to make any reasonable quantitative estimate. Cystine is Modified method of diaminopimelic acid determination
one of the least stable amino acids, and it is likely that it in samples of biological origin, Acta Alimentaria 2,
completely decomposed (oxidised) during the four millen n ia Table 3. Free amino acid ratios by mg/JOO g sample and 159-167.
of deposition. For example, measurable quantities of such total free amino acid content in the bovine soft tissue. Csap6, J., Nemethy, S., Folestad, S., Tivesten, A., Martin, T. G.
Fi g. 2. Palmar view of the heifer sulphur-containing amino acids could not even be detected in & Csap6-Kiss, Zs., 1994, Age determination based on
'sfi .
.
samplmg area. oar sh owzng t he 2000 years old wool carpets (Csap6 et al. 1995b). Only D-histidine (93.79 mg/100 g sample, 16.7% of the amino acid racemization, A new possibility, Amino
The small amount of free amino acids (Table 3) also indicates total i. e. D+L histidine), D-phenylalanine (291.3 mg/100 g, Acids 7, 317-325.
Results a low degree of protein decomposition. The 78.92% gross amino 11.7%) and D-aspartic acid (438 mg/100 g, 7.4%) were found Csap6, J., Csap6-Kiss, Zs., Csordas, E., Folestad, S., Tivesten,
acid content corresponds to only 425 mg, most of these acids in the sample. The concentration of the other D-amino acids A., Martin, T. G. & Nemethy, S., 1995a, Rapid method
() 1'he good preservation of crude for the determination of diaminopimelic acid using ion
protein . being tied up in peptide bindings. Nevertheless, even this small lay at the limit of identification.
111Pl ete dehydration of the materials Ev is due
to the near quantity is indicative of initial decay. The sample was also tested exchange column chromatography, Analytical Letters
u was e so-called "soft"
bone dry, however, the org lli 28, 2049-2061.
}) anole . Conclusions
ecunen during dissection revealed
a so ptic study of the Protein total Collagen Keratin Csap6, J., Csap6-Kiss, Zs., Folestad, S., Orwar, 0., Tivesten,
() other remarkable feature is the ve ;h at gluey smell.
:-n Amino acid sample % In conclusion, it may be said that the artificial treatment A., Martin, T. G. & Nemethy, S., 1995b, Age estimation
g h c o ntribution of
"b() 1urn to the sample. The average Na c Aspartic acid 5.92 7.5 5.4 6.7 and subsequent mummification of this find preserved most of of old carpets based on cystine and cysteic acid content,
te t o
::i.IS cly is around 0.16% (Baintner 1976: 3
)

n f the animals' Threonine 2.12 2.7 2.1 7.0 the original amino acids in the soft tissue of the heifer's foot. Analitica ChimicaActa 300/1-3, 313-320.
1 naturally, uneven. Even cattle bloo bu t its distribution
Serine 3.06 3.9 2.9 10.4 No bacterial amino acids indicating decay could be identified. Csap6, J., Csap6-Kiss, Zs., Wagner, L., T::ilos, T., Martin, T.
d
() 0.37% sodium, w hich in no way W 0We ver, contains Glutamic acid 10.70 13.6 9.7 14.3 In addition to the small degree of decomposition, however, an G., Nemethy, S., Folestad, S. & Tivesten, A., 1997,
o 1

ex.p lain the high
""'" <liurn content of the sample presente . Proline 9.16 11.6 13.0 6.6 unusually high proportion of Na was also detected. This Hydrolysis of proteins performed at high temperatures
ain that d
this foot was salted or soak mth le I. It appears
and for short times with reduced racemization, in order
Glycine 15.67 19.9 22.5 5.4 suggests the application of some sort of salt, a substance in
di e
b Um-rich rind. The Na conten t of lUo d in s ome form of Alanine 8.19 10.4 8.2 4.2 great demand in the ancient world. It is not yet possible to tell, to determine the enantiomers of D- and L-amino acids,
de
0-25 times higher than that of u n rn-d a y bacon may Cystine 0.30 0.4 0.0 10.0 however, whether this treatment was part of normal food Analytica ChimicaActa 339, 99-107.
t e te
Q.i_IS\.:tthgte 1978: 90, 95) and the a ch
r a o
: beef (Paul & Valine 2.43 3.1 2.9 5.6 conservation (the salt content must have been very high by Gyulai, F., 1993, Environment andAgriculture in BronzeAge
cuss1on here is similarly rich in salt 0 gi cal find under Methionine 0.63 0.8 0.7 0.5 modem standards) or served specific ritual purposes. Hungary, Budapest, Archaeolingua, Series Minor 4.
Y A.nuno acids in the ancient sampl Isoleucine 1.98 2.5 1.5 3.7 The excellent preservation of organic materials is a joint Paul, A. A. & Southgate, A. T., 1978, McCance and
olysing the protein w ith 6M hy dr r i d ntified after
Widdowson ' s The composition of Foods, London, Her
l_ l oc Leucine 3.75 4.8 3.5 8.8 result of salting and the extremely arid climate. In Hungary, it
h.. C (Csap6 et al. 1997). The free anu nc a c id for 24 h at Tyrosine 0.90 1.1 1.2 has no yet been possible to detect sodium in prehistoric food Majesty's stationery Office.
.Q n o aC . 5.4
<:{'" Pl was determined without hydroly . id content of the Pheny!alanine V6ros, Gy. & Pudleiner, R., 1997, Preliminary Report of the
e sis a 2.50 3.2 2.2 4.0 remains, a fact more attributable to bleaching than to the
::tr. the s ample with 12.5% trichlor-ace _ fte r the treatment Lysine 3.29 4.2 3.9 3.3 actual lack of salt in the diet (Gyulai 1993: 43). Excavations at Thoth Hill, Thebes. The Temple of
tIC a
t ate the
c1Pl c id m order to
a protein present. Within th fr Histidine 0.56 0.7 0.7 1.1 Montuhotep Sankhkara (Season 1995-1996), Mittei
.

e a rne wo
surements, the quantity of lUI rk of these
a Uo . Arginine 6.25 7.9 7.6 9.5 Acknowledgements lungen des Deutschen Archiiologischen Instituts, Ab
tei n decomposition, was also ide a indic ator of
' nti d n Ammonia 1.51 1.8 teilung Kairo 53, 283-287.
1:'no a c ids during the amino acid an among the
aly s basic Sum of total 78.92 100.1 This research was carried out with the support of Grants
e ammoni a content of the samp le : . OTKA T 14916 and OTKA T 18179 of the Hungarian
is a
larl y to the material analysed ie rnarkably low.
here fr Table 2. Amino acid ratios by sample and protein content in National Science Foundation. The English text was revised by
esh h a
ir and skin do Dr. Alice M. Choyke.

bovine soft tissue (g/100 g).

24 25
 A CORRELATION BETWEEN MYCOLIC ACID PREVALENCE AND

REPORTED TUBERCULOSIS FREQUENCY SUGGESTS A "BIOMARKER"

FOR POVERTY IN ANCIENT POPULATIONS

GERNAEY, A. M., 1 2 MINNIKIN, D. E.,2 COPLEY, M. S., 1 2

AHMED, A. M. S.,2 & CHAMBERLAIN, A.3

Fossil F uels and Environmental Geochemist1y, University of Newcastle, Newcastle upon Tyne, NEJ 7RU, UK,
1

2 Department of Chemistry, University of Newcastle, Newcastle upon Tyne, NEJ 7RU, UK,

JDepartment of Archaeology and Prehisto1y, Northgate House, West Street, University of Sheffield, Sheffield, SJ 4ET, UK

Mycolic acids, specific for Mycobacterium tuberculosis, have been found in archaeological human ribs from a 150-300 year
old infirmary cemete1y site. Sensitive detection of mycolic acids used an unequivocal combination of reverse and normal phase
high-pe1formance liquid chromatography (HPLC) coupled with fluorescence detection of anthrylmethyl ester derivatives. The
HPLC profiles of mycolic acids from ancient bones correlated almost precisely with those extracted from modern
M. tuberculosis, but differed from those derived from other mycobacteria. The number of ribs positive for mycolic acids
correlated with the documented tuberculosis prevalence and all soil samples were negative. Mycolic acids are biomarkers for
tuberculosis, and perhaps can be used to trace the palaeoepidemiology of tuberculosis, providing valuable information for
epidemiologists examining the resurgence of this disease. Biomarkers for tuberculosis frequency could also be "biomarkers"
for poverty in ancient populations.

KEYWORDS: MYCOLIC ACID BIOMARKERS, ARCHAEOLOGICAL BONE, MYCOBACTERIUM TUBERCULOSIS,

PALAEOEPIDEMIOLOGY, HIGH-PERFORMANCE LIQUID CHROMATOGRAPHY.

Introduction which are amenable to sensitive chemical and chromato

graphic detection (Minnikin et al. 1993). These materials have
Tuberculosis - the ancient disease the potential for long-term survival; indeed, in an initial study
(Gemaey et al. 1998a), some of these compounds (mycolic
Globally, tuberculosis (TB) is on the increase, so much so acids) were demonstrated in a 1,000 year old medieval rib.
that it is now the leading cause of death from a single infectious MTB-specific mycolic acids are high molecular weight 2-
agent (Reichman 1996). This increase has been linked to an hydroxy fatty acids, substituted at the 3- position with a
increasing drug resistance (Shuter & Bellin 1997) and co moderately long aliphatic chain. They are esterified (Besra &
infection with HIV (Opravil 1997). TB is on the increase even Chatterjee 1994) to an arabinogalactan polysaccharide
in individuals with apparently competent immune systems attached to a relatively conventional peptidoglycan backbone
(Bhatti et al. 1995). If cyclical changes in the epidemiology of (see Fig. 1), these together comprise the mycobacterial cell
TB underlie these developments (Davies et al. 1997), then it wall (Minnikin 1982; Brennan & Nikaido 1995). The
may be valuable to study the disease in ancient populations distribution of mycolic acid types shows a variety of patterns
since TB is believed to be of great antiquity (Evans 1994). among species; these patterns are of value in classification
Palaeopathological studies become possible if reliable TB and identification (Dobson et al. 1985). MTB shows a
diagnosis can be made from archaeological human remains. relatively simple pattern of a-, methoxy- and ketomycolates
Currently, diagnosis on the basis of gross osteological (see Fig. 1); this broad pattern is shared with a number of
examination is the accepted method, since 1 % (Farer et al. other species, including environmental mycobacteria
1979) to 5% (Steinbock 1976) of modem untreated adult TB (Minnikin 1987). The ever present mycolic acids, being the
results in bone changes. It is uncertain, however, whether any most abundant long-chain components in the cell, must have
extrapolations may be made concerning disease frequency an essential structural role. Mycobacterial mycolic acids can
from the prevalence of these changes in ancient populations be distinguished from those of related actinomycetes by their
to the ancient population as a whole. When such extra chain length (C70-C90), their long side-chains, their
polations are made, the disease frequencies are always much unsaturations, their additional oxygen functions and their
less than expected from historical sources (Robe1ts & methyl branches (Minnikin et al. 1984; Dobson et al. 1985).
Manchester 1995 ).
Site Selection
Mycolic Acid Biomarkers
As mentioned above, a previous study (Gemaey et al.
The use of chemical biomarkers for TB diagnosis is 1998a) had demonstrated mycolic acids in a human rib, with
probably more dependable than the gross examination of no changes consistent with tuberculosis (Roberts et al. 1994),
skeletal remains. TB in humans is caused by members of the from a 1000-year-old medieval individual. This promising
"Mycobacterium tuberculosis complex" (MTB), which initial result required substantiation by the analysis of
comprises two main species, Mycobacterium tuberculosis and archaeological rib samples from a site with records detailing
Mycobacterium bovis. Mycobacteria produce a range of very the incidence of tuberculosis. The rescue-excavation of the
unusual long-chain compounds (Besra & Chatte1jee 1994), former Newcastle Infirmary (AD 1753-1906), and its

0"0""""'""" ,1,0 I" Tntprnntinna/ Svmvosiwn 011 Archaeo111et1)', Jerem, E. & T. Biro, K. (eds.), Archaeopress -Archaeolingua, BAR -Ce1111: Ew: Sei: I.
 Gernaey, A. M., Minniki
n, D. E., Copley, M. S.,
Ahmed, A. M. S. & Cha
mberlain, A.
ween mycol"ic acid prevalence and reported tuberculosis frequenc y suggests a "biomarker" for poverty
A correlation bet

Alpha hexane an ap
d Plied to a normal phase 5 m Merck clearly from those of other mycobacteria (Butler et al 991, i/ .

dissolvedlll . to
.
S 60 cartn ctge (150x4. 6 mm)for separation m Glickman et aI 1994' Ramos 1994) that share t is a-,
L1chfospher i-
methox y-, an
d ketomycolate fractions usmg methoxy- and ketomycolic acid pattern ( mmki 1987)
component -, .
a

etra hy drofuran (982) Individual fractions were 4) of

( see al s F'ig 5) The further rpHPLC analysis (see Fig.
hexane:t _

futther reverse phase chromatography, usmg a 5 the mdivi ? .du ! -, methoxy- and ketomycolate classes (see
;
analysed bY . RP l8 cartridge (150x4.6 mm) wit .
L iCh rosph er h Fig. 3) provides incontrovertible evictence that the long
m Merck . .
m tet rahy drofuran (1:1). . .
chain mycolates ongma te from M tuberculosis (Mmmkin et
acetom
1e

al. 1993).
Data
Correlation with osteological examination
47) of the twenty-one ribs testd
R Five (SK31, 33, 40.' 41 and .
h own to contam co mponents corresponding to mycohc MycoIi ac1ds, characteristic of M. tuberculosis, have been
were s . e _
. ( F.ig. I) on iru "t"al
i reverse-phase HPLC (rpHPL C) , as co nf
iirmed m 5/ 2 I ribs under investigation (23.8%) and this
acids
. b SK33 (Fig. 2). Subjecting the total myco 1ate correlates with the recorded incidence of 27. Io or the
Alpha exemplified y

. s to normal-phase HPLC Newcastle Infirmary. The sample selection was random; those
fractio n from these fiive nb
. .
(np HPL C) showed the exp ected MTB profile of a- meth xy- mdividuals sampled were those that had been freshly reveled
?
an d ke o y colates, as seen .
m ig. 3, for SK33. Analysis of
F" on the days th at one 0f us (AMC) visited the site. Osteolog1cal
.
the m. dividual a-, methoxy and ketomycolates from these nbs examination followed site clearing; examination sh owed that
.
is given,
for SK33, m . F"ig. 4 and the other four n"bs gave one md"1v1"dual sampled for mycolate analysis (SK31) also had
. . h TB. All b samples
Fig. 1. Representatio s1mt1 ar patterns , but w1"th varying amounts of myco 1ate changes of the spine consistent w1t
_
n of the linkages of a-, . .
Methoxy- and Keto-m detected. The retention times f or the archaeological myco1ates tested for mycolates hd n bone lesions ( oberts t al. 1994).

supporting cell wall stru ycolates, to the mycob
ctures. The remainder acterial arabinogalac . ?
moiety does not necess
of the supporting ara
binogalactan is repres
tan of the
correlate almost prec1e1y with those from the modem MTB Osteological exammation showed on y 2/ 210 (0.95%)
arily have two a- and ented by R. Each pen . . . .
homologues, and the
single methoxy- and keto
mycolates. Each myc
tarabinose
(Fig. 4). The retention times of the a-' methoxy and individuals with skeletal changes consistent with tubercu!sis
methoxy- and ketomyc olic acid class consist
olates also include com s of several
ketomycolates from other mycobacteria (Minnikin 1987) can (D . J . Robertson, persona 1 commuruc ation) . Extrapol at1on
methyl branches, in add ponents with tra ns-cyclop
ropane rin gs and adj . .
be seen to be very different (Fig. 5) . All soils were negative
ition to the cis-cyclop
ropane rings which are acent from the numbers of bones positive for MTB mycolates
_
represented in the Fig
ure by triangles.
l
associated burial gro for mycolic acids. 88o/t0 of recorded literature values, but there is a margm o
und (AD 1753-1845
), provided an 1998) of a method dev error. It is interesting to note that the 23.8% prevalence f or
excellent opportunity eloped for clinical ma
to evaluate mycolic terial (Minnikin .
acids as reliable Interpretation mycolates, recorded here' is higher than ant1c1pa . ted for the
biomarkers for ancien et al. 1993). Samples
t tuberculosis. The Infi of bone (1.0 g), soil (1.0
rmary records, g), lyophilised .
1 opulation at that time (HardY 1994) ' but a hospital
for 1803 to 1845, sho M. tuberculosis Strain
tuberculosis (J. Nolan
wed that 27. I% of pat
, personal communic
ients died with 1984) (50 mg) and oth
C (Dobson et al. 198
er mycobacteria were
5; Minnikin et al.
heated at l00C
Is it really MTB? ==:; site could be expected to yield higher than average
ation), during a overnight in 8 ml Pyr disease frequencies.
time when tuberculo ex tubes, sealed by a
sis was thought to hav PTFE-lined screw
e been a major cap, with l ml 15% aqu Reverse-phase HPLC separates mycolic acids primaiily
cause of death in Bri eous tetrabutylammoni
tain (Hardy 1994). Bet .
ween November um hydroxide. according to their overall chain 1ength, with a lesser
1996 and March 199 After cooling, I ml wat Comparison with other biomarkers
7, skeletal remains from er was added and, afte .
210 articulated r centrifugation, contribution from the various mctional gro (Minnikin
individuals and at lea the supematants wer _

st 407 dis-articulated e mixed with I ml
individuals were 0.05% 9-chloro 1982) In the case of the mycolic acids from B , rpHPLC To date , the biomolecular analysis of archaeological uma
recovered (J. Nolan per methyl-anthracene in
sonal communication). dichloromethane and
;h
;J; .

the tubes mixed result in a characteristic "tight envlop " of peak (see F
.
remains f or TB has been restricted to the demonstration o
by rotation for I hou
r at room temperatu _

re. The lower which enable MTB specific mycolic acids to be stmgu DNA fragments from the insertion element IS6110, wit h some
dichloromethane layer
Methods was washed successive
ly with I ml
10% aqueous hydrochlo
ric acid and twice wit
h Im! water and
then removed, under
Sample collection and nitrogen flow, to giv
storage e crude mycolic
esters which were diss
olved in toluene (25
I) and the
Forty-two soil sample solutions adsorbed ont 1st
reverse 1st
reverse
s from 21 skeletons lab o toluene-pre-washed
elled SKI, 3-5, I ml BondElut MTB MTB
12, 21, 27, 31-33, 40- C-18 reverse-phase col
42, 4tH.8, 52, 102, 103 umns. The columns wer phase HPLC phase HPLC
, 107 and 108, e washed with
were collected. Two soil acetonitrile (4.0 ml),
samples were taken for followed by acetonitril
each individual; e:toluene (4: I)
one from the chest cav (4. 0 ml) and the
ity of the freshly exp washings discarded
osed, articulated . The purified
skeleton, prior to any anthrylmethyl esters
cleaning or lifting pro were eluted with ace
cedures and one tonitrile:toluene
from the area distal to (I:I) (3.0 ml) and eva
the skull. Soil samples porated to dryness.
were collected into
sterile polyethylene-ca
pped glass containers
and autoclaved
(121C, 15 min.) piio High peiformance liqu
r to storage at room tem id chromatography
perature. During
soil sampling, face ma of mycolic acids
sks and plastic gloves
were worn; plastic SK33 SK33
gloves alone were wo
rn for soil sample pro
cessing. Mid-shaft
rib samples were take Anthrylmethyl mycol
n from the 21 skeleto ates were analysed by
ns after lifting, HPLC using a
cleaning and osteologic Merck Hitachi L6200
al examination; plastic pump and a Gilson
gloves were worn 122 fluorimeter;
at all times during the excitation at 252 nm
se procedures and sub with a 435 nm interfer 5 5
sequent handling. ence filter. The 0 10 15 20 25 0 10 15 20 25
Bones were crushed usin flow rate was I ml
g a mortar and pestle min1, and the colum
to a fine powder; n temperature was
soil samples were air 37C. Hexane solutio
dried and powdered. ns of purified anthiy Time (minutes) Time (minutes)
lmethyl esters of
mycolic acid extracts
were applied to a rev
erse-phase 5 m Fig 2. Initial reverse-phase HPLC separatwns
Merck LiChrospher of Fig. 3. Normal phase HPLC separations
RP 18 cartridge (15
:
Mycolic acid extraction
and derivatisation 0x4.6 mm ), eluted .. .
with acetonitrile:tetra anth1ylmethyl esters of myco1.ic aCld s fironi MTB and SK31. of antluylmethyl esters of fractions collected a tial
hydrofuran (1:1). All
data were collected

The powdered bone using X-Chrom v. 2.0 Only the results from one rib sample are shown here and . '. n reverse phase HPLC (Fig. 2) from MTB an .
and soil samples wer 4k (Labsystems, Fis
e examined for ons pi .) software F. _ acid
mycolic acid, using data collection system e
zgs. 3 and 4, fior clarity. The total fraction of mycoltc Eluates corresponding to a-, Methoxy-
a modification (Gema . Fractions, correspon
ey-Child et al. ding to mycolic
acid derivatives wer
derivatives was collected for subsequ nt a al ys1s
b and Keto-mycolic acid derivatives were collected.
e collected, blown

down to dryness, normal-pIiase HPLC Conditions are given 111 Metho s. Conditions are given in Methods.
28
29
 Gemaey, A. M., Minnikin, D. E., Copley,
M. S., Ahm ed, A. M. S. & Chamberlain A
een mycolic acid prevalence and reported tuberculosis frequency suggests a "biomarker" for poverty
A correlation betw

Salo et al. 1994; Nerlich et al. 285-306, American Society for Microbiology,
(Taylor et al. 1996;
C78 success
ificity of usmg this e1 ement has been Washington.
The spec
199?):

ucet -Populaire et al. 1996). Although evidence Bhatti, N., Law, M. R., Morris, J. K., Haliday, R. & Moore
Alpha C80 quesuoned
(Do . .
rese nce of the IS6110 msert10n sequence has been Gillon, J., 1995, Increasing incidence of tuberculosis in
for th e P . .
d l n virtually all modem isolates belongmg to the MTB England and Wales: a study of the likely causes, British
detec te
dam et al. 1994), a homology between a 181- Medical Journal 310, 967-969.
comp1eX (McA .
bp fragment
of DNA from mycobactena other than MTB as Brennan, P. J. & Nikaido, H., 1995, The envelope of
strated (McHugh et al. 1997). Usmg mycobacteria, Annual Reviews in Biochemistly 64, 29--63.
1s0 been demon
bridisation techniqu es, these authors obtained multiple Butler, W.R., Jost, K. C. & Kilburn, J. 0., 1991, Identification

;
b nding patte
rns from

isolates of Mycobacterium avium,
i, Mycobacteriun intracellulare,
of mycobacteria by high-performance liquid chromato
graphy, Journal of Clinical Microbiology 29, 2468-2472.
Mycobacteri um fortuit

Mycob acteriu m kansasu and My

obacte 1um malmoense. Davies, R. P. 0., Tocque, K., Bellis, M. A. & Davies, P. D. 0.,

acteria l mycolates are spec1es-spe c1fic (Butler et al. 1997, The decline of tuberculosis in England during
Mycob
Ramos 1994). victorian times, improved living conditions and selective
1991; Glickman et al. 1994;
pCR techni ques for ancient DNA detection require immunity, Abstract from P roceeding s of the International
or not this
amplification steps; it is still uncertain whether Congress on the Evolution and Palaeopathology of

procedure amplifies only the disease state, so that distinction Tuberculosis, Palfi, G., Dutour, 0. & Deak, J. (eds.),

bet ween TB, in the ancient individual, and mere infection by Tuberculosis Foundation, Szeged.
C83 Methoxy
MTB can not be made yet. Mycolic acid detection does not Dobson, G., Minnikin, D. E., Minnikin, S. M., Parlett, J. H.,
involve amplification steps, so the number of skeletons Goodfellow, M., Ridell, M. & Magnusson, M., 1985,
containing mycolic acids may reflect tuberculosis frequency Systematic analysis of complex mycobacterial lipids, in
in the original population. Chemical Methods in Bacterial Systematics,
Methoxy C85
Goodfellow, M. & Minnikin, D. E. (eds.), 237-265,
Mycolic Acids as a "biomarker" for poverty Academic Press, London.
Doucet-Populaire, F., Lalande, V., Carpentier, E., Bourgoin,
Tuberculosis is a disease of civilisation; more specifically, A., Dailloux, M., Bollet, C., Vachee, A., Muinaerd, D.,
it is a disease of overcrowding, so much so that it increases Texier-Maugein, J., Carbonelle, B. & Grosset, J., 1996,
proportionately to the degree of crowding (Wilson & Miles A blind study of the polymerase chain reaction for the
1946). Other factors involved in the increase in disease onset detection of Mycobacterium tuberculosis DNA, Tubercle
are malnutrition, stress and exhaustion (Mantagani et al. and Lung Disease 77, 358-362.
1995; Bhatti et al. 1995). Apart from an overwhelming Evans, C. C., 1994, Historic Background, in Clinical
colonisation by M. tuberculosis, disease onset is thought to be tuberculosis, Davies, P. D. 0. (ed.), 1-17, Chapman and
due to the recrudescence of the organism following a period Hall Medical, London.
of latency (Wayne & Hayes 1996). The organism would be Farer, L. S., Lowell, L. M. & Meador, M. P., 1979,
held in a dormant state until any or all of the above factors Extrapulmonary tuberculosis in the US, American
Keto resulted in a breakdown of the immune system, pennitting the Journal of Epidemiology 109, 205-217.
C86 initiation of lesions and a progressive tuberculosis (Wayne Gemaey, A. M., Minnikin, D. E., Copley, M. S., Middleton, J.
1994). Compromised immune status in modem populations C., Dixon, R. A. & Roberts, C. A., 1998a, Detection of
can be a result of infection by the immuno-suppressive mycolic acids confirms DNA evidence for tuberculosis
C85 MTB viruses, but no evidence exists to suggest that these viruses in medieval human skeletal remains, (submitted to
Keto .
threatened ancient populations, thus the single common Proceedings of the National Academy of Sciences USA).
denominator for the re-activation of M. tuberculosis leading to Gemaey, A. M., Minnikin, D. E., Copley, M. S., Ahmed, A. M.
M. marinum disease manifestation is poverty. S., Dixon, R. A., Roberts, C. A., Robertson, D. J., Nolan,
A biomarker that measures TB frequency in past population J. & Chamberlain, A., 1998b, Mycolic acids - biomarkers
will be a valuable adjunct in epidemiology and palaeo for ancient tuberculosis, Internet Arcaheology 5,
pathology. A "biomarker" that measures pove1ty in ancient http ://intarch.ac. uk/joumal/issues/gemaey-html.
populations will be a valuable adjunct to archaeology. The Glickman, S. E., Kilburn, J. 0., Butler, W. R. & Ramos, L. S.,
essential results in this presentation have been submitted for 1994, Rapid identification of mycolic acid patterns of
0 5 10 15 20 25
publication elsewhere (Gemaey et al. 1998b). mycobacteria by high performance liquid chromato
graphy using pattern recognition software and a
Time (minutes) Acknowledgements mycobacterial library, Joumal of Clinical Microbiology
0 5 10
32, 740-745.
15 20 25 D.E.M. acknowledges funding from The Wellcome Trust, Hardy, A., 1994, Death is the cure of all diseases: using the
for support in developing the mycolic acid analysis, and The
Time (minutes) general register of cause of death statistics for
Royal Society, for provision of a fluorescence detector for 1837-1920, Social History and Medicine 7, 472-492.
Fig. 5. Confimwtory
reverse-phase HPLC sepa HPLC.
of anth1ylmethyl esters
rations Mantagani, P., Jolley, D. M., Watson, J. M. & Rodrigues, L.
Fig. 4. Con of the individual ""
rv , Meth
firmatmy reverse-phase HPL C . oxy- C., 1995, Socioeconomic deprivation and notification
anthrylmethyl ester
separations of .
nd eto-mycolzc aczd . _

classes from MT B com

s of the individual a-, Methoxy with those from myc
pared References rates for tuberculosis in London dming 1982-91, British
and Keto-myco obacteria with the sam
lic acid classes from SK3 l and MTB e mycolate Medical Journal 310, 963-966.
' classes as MTB' M
prev1_ouslY sepa mannum and M. kansasii

rated by normal phase HPLC F . Besra, G. S. & Chatterjee, D., 1994, Lipids and carbohydrates of McAdam, R. A., Giulhot, C. & Gicquel, B., 1994,
( ig. 3).
previously sep 1ate
d by npHPLC (data not
Conditions are given in Methods.
Condtt1: ons are given

sho n). Mycobacterium tuberculosis, in Tuberculosis: Patho Transposition in mycobacteria, in Tuberculosis: Patho
in Methods. genesis, P rotection and Control, Bloom, B. R. (ed.), genesis, P rotection and Control, Bloom, B. R. (ed.),

30
31
 Gemaey, A. M., Minnikin, D. E., Copley, M. s. ' Ahmed' A
.
M S & Cham.berlam, A.

199-216, Ame iican Society for M icrobiology, Reichman, L. B.,1996, Multi-dmg resistance in
Washington. the world h
Presen t sltuat10n
.
. ,Chemotherapy 42,
2-9.

te
ST RONTIUM ISOTOPE STUDIES OF HUMAN BONE
McBugh,T. D.,Newport, I.E . & Gillespie,S. H.,1997, IS6110 Roberts,C.,Lucy,D. & Man
chester' K. 1994,Infl
homologs are present in multiple copies in mycobacteii a
l'es10ns of . nbs: an analysis of the
' amni at
0'Y AND TOOTH ENAMEL: THE EUROPEAN BELL BEAKER
other than tuberculosis-causing mycobacteiia,Journal of erry coll
. ecfIon,
PRICE, T. D.,1 GRUPE, G.,23 SCHROTER, P.2 & MIDDLETON, W. D.1
Amencan Journal of Anthrop
ology 95, 169-182
. Clinical Microbiology 35, 1769-17 71. Roberts,C. & Manchester,
K ., 1995, r1
Mi nnikin,
1 1ie Arehaeo
Che mical targets in cell envelopes of the
D. E.,1987,
gy 0!
lo
Disease, Sutton Publishing,
.
Stroud.

lep rosy bacillus and related bacteria,in Chemotherapy of Salo,

1 Laboratory for Archaeological Chemistry, University of Wisconsin,
W. L., Auferhe de,
- Critical Reports on
A. C.,Buikstra, J . & Holcom
b, T 1180 Observat01y Drive, M adison WI, 53706-1393 USA,
Tropical Diseases Applied 1994,ldentdicat1on of Myc
Chemistry, Vol. 21, M . (ed.),
H oopen, 19-23, J. Wiley and
obacterium tubercul .
os1s . A., 2 Anthropologische Staatssammlung, Karolinenplatz 2a, 80333 Miinchen, Germany,
in a pre-Columbian Peruvian
Sons,Chiche . mummy, Pr(' ceed gs DNI\
' ofthe 3Instit ut fiir Anthropologie und H umangenetik, Richard-Wagner-Strasse 10, 80333 Miinchen, Germany
. ster. N.atwnal Academy of Science
v m
USA 91, 2091-2094.
M1 nnikin, D. E., 1982 , Lipids : compl ex lipid s, their Shuter,J. & Bellin,E.,1997
, Multi-dmg resistant tuber
c hemistry,biosynthesi s and roles,in The Biology of the
In'ectio
':!'
us Dzsease m Clzmcal Prac
cu1os1s.'
tice 6, 430-437
My cobacteria, Ratledge,C. & Stanford, J. (e ds.), ratios are measured in human bone and tooth enamel from late Neolithic burials in Bavaria. The time
.

Stembock,R. T.,1976,Pala Strontium isotop e

95-185' Academic Press, London.

eopathological Diagn ;
sis and
erio d, known as Bell
Beake1; is thought to have witnessed substantial human migration but the evidence comes from exotic
rvi1 n ik
Inte1pretation - Bone
Diseases h1 A nc1ent
n in,D . E.,Bolton,R. C., Hartmann,S.,Basra,G. s.
,
.
Ropulat1ons, Thomas Spri
ngfield,Illinois.
. H uma/1
ra ve goods, includin
g the distinctive Beaker pottery. Strontium isotope ratios provides a means of examining migration from

Jenkins,P. A., A. I., Wilkins,

Mallett, E.,Lawson,A. M. Taylor, G. M.,Crossey, the direct evidence of
human skeletal tissue. Results of the study suggest that migration in the Bell Beaker period was indeed
M. ' Saldanha' J. & Waldron
& Ridell,M.,1993, A n integrated proce dure for the DNA from Mycobacterium
,T., 1996 substantial, but not eve1yo
ne was a newcoma
tuberculosis identi '
direct detection of ch aracteristic lipids in tuberculo sis . fied i
medieval human skeletal
KEYWORDS: BELL BEAKER,STONTIUM ISOTOPES,BONE CHEMISTRY,MIGRATION,ARCHAEOMETRY.
remains using polym
patients, Anna/es de la Societe Beige de Medicine erasen
chain teac . (wn,J,ournal of Arc
haeological Science
r picale 73 (suppl 1), 13-24. 23
Minnik
789-798.
in,D. E.,Minnikin,S. M., Parlett,J. H.,Goodfellow, Wayne,L.
'
Introduction radiogenic,and include 84Sr (-0.56%),86Sr (-9.87%),and
& Hayes,L. G.,1996,
M . & Magnusson,M .,
1984, M ycolic acid patterns of sequential study of shif
An in vitro model
fon 88Sr (-82.53%). Thus the total global ratio of 87Sr/86Sr is
tdown of Mycobacte . approximately 71327. Variations in strontium isotope com
some species of mycob acteri a,
Archives of Microbiology tube cu 1 os1s thro gh two
num One of the more intriguing questions in archaeology
stages of nonreplicating positionsin natural materials are conventionally expressed as
139,225-231. regards the movement of prehistoric peoples. It is clear that

N rlic persistence,
U. & Hagedon,
Infectwn and Immunity 64,
Szei mies,
A., 2062-2069 various kinds of artifacts moved about from original sources 87Sr/86Sr ratios.
e h,A. G.,Haas,C. J., Z ink, Wayne, L. G., 1994, Dormancy of Mycobacteri
um tuberc losis to new locations. Often such evidence is interpreted to be Geologic units that are very old (>100 m.y.) and that had
B . G.,1997,Molecular evidence for tuberculosis in an an lat ncy of disease,Euro
? pean Journal of Clinic
indicative of the movement of individuals as well,but in fact high original Rb/Sr ratios will have high 87kSr/86Sr ratios
Egyptian mummy, Lanc et 350, 140 4. M1crobwlogy: Infectw . n and
al
Disease 13,908-914
Opravi l,M.,1997,Epidemio logical and clinica l aspec ts of .
W1lson' G' S. & Mil es, such an association is difficult to make. Artifacts can either be today. Such rocks include clay-rich units such as shale or
A. A. (eds.),1946,Tapley
!
rny cobacterial infectio n,nfction 25, 5 6 -59
.
. .
Pnnc1ples of Bacteriology
W
and ilson's earned or exchanged by those who made them. Given the fact igneous rocks that have high potassium and silica contents
Ra . and Immunity Vol II 1291 such as granite (Faure 1986). In contrast,rocks that are
rno s,L . S.,1994,Characte nsat10 n of m ycobact enal spec ies Arnold,London.
' ' that artifacts are indirect,or proxy,evidence of movement in
by high performance liquid ch ro matography and pattern the past,
a better approach is to investigate prehistoric humans geologically young (<l-10 m.y.) and that have low Rb/Sr
recognition,Journal directly for indications of residential change. ratios, such as late Cenozoic volcanics, generally have
of Chmmatographic Science 32,
219-228. A number of new archaeometric techniques are in 87Sr/86Sr ratios less than 0.706 (e.g.,Rogers & Hawkesworth
development that will allow us to pursue this question. The 1989). Rocks that had very low initial Rb/Sr ratios,such as
general categories of such techiques involve ancient DNA and basalt,can have 87Sr/86Sr ratios less than 0.704. These
isotopic bone chemistry. Several different isotopes of lead, variations may seem small,but they are exceptionally large
oxygen, and strontium are being considered as possible from a geological standpoint,and far in excess of analytical
indicators of past movement (Carlson 1996; Ericson 1985, error (0.00001 for 87Sr/86Sr) on thermal ionization mass
1989; Gulson et al. 1997; Price et al. 1994a,1994b; Stuart spectrometers.
Williams et al. 1995). Of these,strontium seems to show the Strontium in bedrock moves into soil and ground water and
most potential at present. In the following paragraphs we from there into the food chain. In humans and other animals,
outline the basic principles of strontium isotope analysis for the vast majority of strontium is deposited in the skeleton.
the investigation of human migration and provide a case study The mineral matrix of bones and teeth consists mainly of
from the late Neolithic Bell Beaker period of Central and calcium phosphate hydroxyapatite [Caw(P04MOH)2]. Sub
Western Europe. Results from the study of human skeletal stitution of strontium for calcium in this apatite produces
m aterial from cemeteries in Bavaria are presented and suggest strontium concentrations on the order of 102-103 ppm in hard
that both human mobility in the Bell Beaker period and the tissue. Although local levels of elemental strontium in plant
potential of strontium isotope analysis are quiet high. and animal tissue vary due to many factors,the isotopic
composition of strontium is not changed (fractionated) by
Strontium isotope analysis biological processes because of the very small relative mass
differences among the strontium isotopes. The strontium
The basic principles for the strontium isotope analysis of isotope composition of human bones,therefore,match the
human skeletal remains are straightforward and borrowed diets of the individuals,which in tum reflect the strontium
largely from geology. Both elemental strontium content and isotope composition of the local geology.
its isotopic ratios in rock,groundwater,soil,plants,and In human bone,the strontium isotope ratio serves as a
animals vary depending on local rock types (Dasch 1969; signature of the geology of the area where an individual died.
Hur st & Davis 1981; Graustein 1989),primarily on the age Bone undergoes complete replacement or turnover of its
and composition of the material (Faure & Powell 1972; Faure inorganic phase during life (e.g., Parfitt 1983), so that
1986). The stable isotope 87Sr is formed over time by the measurements of bone strontium reflect the last years of the
radioactive decay of rubidium ( 87Rb,t l /2 - 4.7 x 1010 years) life of the individual. The actual number of years is related to
and comprises approximately 7 .04% of total strontium (Faure the type of bone under consideration and its turnover rate. The
& Powell 1972). The other isotopes of strontium are non- enamel in teeth, on the other hand,forms during gestation and
32
Proceedings of the 31" International Symposium on Archaeometry, Jerem, E. & T. Biro, K. (eds.), Archaeopress -Archaeolingua, BAR - Centi: Ew: Sei: 1.
 er
Enam el: The European Bell Beak
of Human Bone and Tooth
Price, T. D., Grupe, G., Schrote1; P. & Middleton, W D. Isotope 5tud"es
i
Strontium

infancy and undergoes relatively little change dming an have been found in the graves are frequently robu
t
individual's lifetime. Enamel has ve1y few internal organic with a distinctive "short-headed" skull (e.g., Gerhar Ill

t
re a197
sttuctures and is thus considered inert tissue which does not 1978). Settlements from this period, however, we
hn
recrystallize or remodel after fotmation (Steele & Bramblett unknown until recent years.

1988). Differences in strontium isotope ratios between the Bell Beaker materials are distributed irregular!
bone and tooth enamel of the same individual thus provide an Denmark to Sicily and from Ireland to eastern
1 Uro
indication of mobility and residence change (Eticson 1985, Compt atton and anal ys1s of rad"wearbon dates fro

.
1989). period suggests an origin in the Rhine delta region :0
.
Post-depositional contamination of bone and tooth before 2500 BC m a Corded Ware context (Lanting & v ltl
n
(diagenesis) is not a significant problem in strontium isotope Waals 1976). This early expansive Bell Beaker ph :.

studies. Bone is more susceptible to diagenesis than the assumed to have split into three "regional groups " e 11
. . the
denser dental enamel (Molleson 1988; Vemois et al. 1988). southern Bell Beaker with finds from Spain, P ortu
g
Cleaning techniques have been developed which remove southern France and Italy; the western Bell Beaker with ali
sues
.

m central and northem Franee, Great B" ntam and Irelan h Pommelsbrunn

m uch of the diagenetic contamination from bone (Price et al. d

1992; Sillen 1989). Moreover, Sealy (1989) tested the acid Benelux countries, the Rhine region, and the north Ge e
wash procedure of Sillen on the isotopic compositions of lowlands ; and finally the eastern group in Hungary, the Cz
87sr86 =

strontium in bone and was successful in recovering the Republic and Slovakia, Austria, and southern Bavaria.
some regions such as the British Isles, the disttibution of Be
non-uniform
known, biological values from bone which was initially
contaminated with diagenetic strontium of a different isotopic Beaker mateiials is almost continuous, while in others the
ratio. Other researchers (e.g., Staudigel et al. 1985; Schmitz et remains are very sparse. The end of the Bell Beaker is varia&l
e
al. 1991; Koch et al. 1992) using such acid-cleaning proced in these areas, depending on the date of appearance of Bronze

ures have had similar success obtaining Sr87186 measurements Age materials. The Bell Beaker period lasts longer in Brit ain

from fossils as old as the Paleozoic Era. than elsewhere.

Moreover, any diagenetic strontium that may remain in a
sample contains local isotope ratios. In such situations,
contamination can only mask the evidence for migration and
seems to be a very minor problem. As a control, comparison
of modem and archaeological fauna from the research area
permits assessment of isotopic contamination and provides an
independent measure of the local isotopic signature.
Initial research on fossil and modem animals, including
humans (Ericson 1985; Ezzo et al. 1997; Grupe et al. 1997;
The exotic materials found in Bell Beaker graves, alo ng
with their patchy distribution, the absence of settlement, and
the distinctive skeletal remains indicated to many archa e
ologists that this phenomenon was evidence of human
migration. In an attempt to explain Bell Beaker, Childe (e.g.,
1950, 1957) used analogies with groups such as traders,
tinkers, missionaries, or a kind of gypsy folk. In the larger
context of European prehistory the appearance of Bell Beaker
has been thought to signal the breakdown of traditional social

Price et al. 1994a, 1994b; Sealy 1989; Sealy et al. 1991, 1995)
has demonstrated the potential of strontium isotope ratios for
the study of questions concerning migration. Sealy's (1989)
study of inland versus marine adaptations in South Africa, for
example, distinguished groups of people on the basis of
terrestrial, marine, and mixed diets and thus could infer
patterns of movement for the different groups. Price et al.
structures and the emergence of more mobile groups (Sherratt
1994). This interpretation has remained a standard view of
Bell Beaker. Others, however, including Harrison (1980: 164)
and Engelhardt (1991), have suggested that increased social
ranking, not population movement, was responsible for the
adoption and spread of Bell Beaker materials as symbols of
wealth and status. The questionof the importance of mobility

(1994a; Ezzo et al. 1997) examined human bone and tooth in the Bell Beaker period is unresolved. It has not been
possible to determine if these distinctive materials were 0 100 km
samples from the sites of Grasshopper Pueblo in north-central
Arizona where ceramic and architectural evidence suggested brought by their owners or imported.
isotope ratios
that several human groups had settled the site sometime in the major foations nd stimate for strontium
Fig. 1. A schematic map of the geology of Bavaria, showing also show n.
latter part of the 13th century. The results of the strontium Bell Beaker Folk in Bavaria in Bavaria used 112 this study is
in rock. The location of Bell Beaker cemeteries
isotope ratio analysis provided good evidence for the presence
Bavaria was the focus of this study because of the large er of Bavaria is comprised
of both migrants and locals at Grasshopper Pueblo and to Foreland at the southern bord
brunn, Straubing-Oberau, and Ttickelhausen (Fig. 1). These
ted chalk sediments: The loss
distinguish different groups of migrants at the site. number of excavated buiials from graves and cemeteries of primarily of glacially redeposi
burial sites occur primarily along the Danube River, but there isotope ratios rangmg
tium
the Bell Beaker period in this area (e.g., Gerhardt 1953). More and marine carbonates have stron
The Bell Beaker period
are also examples north and south away from the river. These
e valu es were confirmd y
than 100 Bell Beaker sites have been excavated, with the between 0.708 and 0.710. Thes
sites have been excavated over the last 100 years with several Beak er cemetenes m
Bell
majority found between the Danube and the Alps. The analysis of four soil samples from
the result of rescue from recent construction (e.g., Kociumaka betw een 0.708965 and
pe ratio
The Bell Beaker is one of more intriguing, and less known archaeological and anthropological evidence suggests that the this area with a strontium isoto
& Diettich 1992; Weinig 1992). This matetial is housed in the essen tially the sam as
9377 ,
periods, in European prehistory. The term Bell Beaker is used closest connections of the Bell Beaker materials come from 0.709892 with a mean of 0.70
State Anthropological Collection, Munich, Germany. tium isoto pe ratios,
the northeast, likely in the Czech Republic, Hungary, or s of stron
for a type of pottery and a group of people, as well as a pe1iod . seawater (Faure 1986). In term
Bavaria can be divided into several zones geologically, tical ly.
analy
of time (Ltining 1994; Sangmeister 1972; Shennan 1986). Austiia, and spread southwest into Bavaria along the major these are easily distinguishable
divided between n01th and south by the Danube River
The Bell Beaker period appears at the end of the Neolithic rivers which provided water, food, and transport (Gerhardt
(Fig. 1). Zones to the north of the liver are of m i xed, non n
and dates from approximately 2500-1900 BC cal. The period 1953). The Danube must have been a primary route of Results and interpretatio
movement and settlement in the past as well as today.

uniform geological formations. The region nort eas of t e
is named after a distinctively shaped ceramic vessel,
river is charactetized by granitic sediments with 1sotop1c
Human skeletal materials have been found either in small each of the Bell Beaker sites
probably a drinking cup. Bell Beaker pottery is found most
ratios greater than 0.710, ranging to 0.750 and higher (Sollner The number of samples from
cemeteiies (10-30 individuals) such as Augsburg, Irlbach, Tabl e 1. Enamel from the first
commonly in graves that also contain other distinctive in Bavaria is presented in
unpublished data). Sediments south of the Danube are largely cal bone from the femur
corti
materials including jet and amber ornaments, some of the Ktinzing-Bruck, Landau SO, Osterhofen, and Weicheting, or peimanent molar and compact
glacial in otigin, including loess deposits in a wide band alng where both tissues were
first gold and bronze objects in Europe, and archery
as single or very small groups of burials (no more than five was collected from skeletons
the 1iver. The area between the river loess and the Alpme
equipment (Sherratt 1994). The Bell Beaker individuals that individuals), including Altdorf, Landau, Manching, Pommels
35
14
 Price, T. D., Grupe, G., Schrote1; P. & Middleton, W. D. Tooth Enamel: The European Bell Beaker
Strontium Isotope Studies of Human Bone and

Cemetery Samples Migrants@o.001 %Migrants i Samples were then solubilized overnight in 3 ml cone BNo ()
.
50.0
i ()
l 60oc . 3
l
Altdorf 1
(Madison) or by wet ashing under pressure for 6 h at
I ml cone. HN03 (Munich). After evaporation of the
14 2 Tooth Bone
acid IQ
Augsburg 14.3
I
irlbach 12 2 16.7
80C , the remnants were solubilized again in 3 ml at 400 Augsburg ,::;
0.0
HCl
and ... -2
passed through a cat10n
Kunzing-Bruck 6 0 Erlbach
. exchange column ( 200-400 rn h
es'
()
Landau 9 4 44.4
HCl as mobile phase) to separate Rb from Sr. '.._;

Manching 3 1 33-3
8
The results of the analyses of these samples are pre
Osterhofen 3 37.5 . s ented
m F'1g. 2 as a graph of elemental strontium content
.
1
. . vers
0
Pommelsbrunn o.o ""16
strontmm Isotope rat10 value. Values are plotted
Straubing-Oberau s 2 40.0 againSI
e1ementa1 strontmm
. . part to spread out the distribut
m Sr ppm
TUcklehausen l 0 0.0 ion
7 2 inspe tion. In addi io , stronti m content in human
Weichering 28.6 ? sk el et
:
Total 69 17 24.6 matenal may co tam mformat10n on the composition
of diet
200 10
.
and on status (Pnce et al. 1985; Sillen & Kavanagh 198
2).
Table 1. Samples size and immigrants at individual Bell The basic expectation of the study was that differe . . :
. . nc es in
Beaker sites. Cut-off value of 0.001 is used strontmm Isotope ratios between bone and tooth of the ... 16

sam t ...
to identify immigrants. individual would indicate residential change. There ... ...
.9
...... ...
differences between bone and tooth in the data but ther
ar:
e is
preserved. Paired samples of bone and tooth enamel were also a good bit of variation in the strontium isotope val
ues.
obtained from a total of 62 Bell Beaker individuals and Because of the variation present among the samples, it is
not
prepared fo r anal y sis. I n addition, there are 12 individuals, always obvious how to distinguish migrants. Samples T
--- -----

largely children, for whom onl y enamel was available and 1
sample of bone on ly, a total of 7 5 individuals. Approximately
half the samples w ere analy zed in Madison and half in
Munich. Se ve n samples w ere analy zed in both laboratories to
ensure compa rability of the results. A preliminary report on
this work appeared in Price et al. (1994a) and a more detailed
study in Grupe et al. (1997). T he complete dataset for this
study is report ed in Grupe et al. (1997).
Bone and enamel samples w ere washed and the smfaces
removed me chan icall y (in Madison) or by ultrasonic etching
(5 ruins. in 99% HCOOH, Munich), ashed for 12 h at 500C
to remove the organic fractions, and finally homogenized. To
about 100 mg homogenized sample was added a spike of Sr
(strontium carbonate standard SRM-987, National Bureau of
Standards, Washington, D.C) with a ratio of Sr: spike of 1:50.
20001
1600
E the individual in grave 16 is clearly detectable as an
0...
1200
II
0...
I...
Vi A Using a cut-off point of 0.001, 14 of the total of 62 tooth
Boo-" . ...
with
very high isotope ratio values clearly indicate residential
shift,
but what about the large number of intermediate val
ues?
Several approaches could be used to distinguish immigrants
in
these data (cf. Ezzo et al. 1997), but any cut off value
to
distinguish migrants will be regionally specific and somewhat
arbitrary. In this paper we discuss two methods for
determining the cutoff point: (1) a value based on geological
differences in the area, and (2) a value based on bone
strontium isotope ratios as an indicator of indigenous values.
(I) Although the geochemical differences in 87Sr/86Sr ratios
for the geology of Bavaria appear to be small, they are in fact
highly significant. Modem mass spectrometers have a
measurement error between 0.00003 and 0.00001 for
strontium isotope ratios. Thus, a difference of 0.001 (0.710-
0.709) is the equivalent of between 33.3 and 100
Bone
.A. Tooth
0.710
0.708
Fig. 3. Scatterplot of elemental strontium content versus strontium isotope ratio for samples
and Ir l bach, showing the distinct e
diff rence in bone isotope levels between the two sites.
measurement units, depending on precision. Migration from a
granitic area (with values greater than 0.710) into a region
dominated by carbonate-rich soils (with values averaging
slightly more than 0.709) would be readily visible in the
87Sr/86Sr ratios in bone and enamel. A conservative cut-off
value of 0.001 between the bone and enamel measurements
should pennit probable immigrants to be identified. As an
example, Fig. 3 shows the data from the sites of Augsburg and
lrlbach. Immigrants are readily detected and the geological
boundary between granitic and carbonate soils, marked by the
Danube River, is distinctive. Augsburg is located at some
distance from this boundary, approximately 220 km along the
river valleys. lrlbach is situated very close to the Danube, on
the southern bank where the soil is dominated by loess. While
the isotope ratios in the Irlbach samples are generally closer
to 0.710, reflecting the mixing of sediments in the river valley,
immigrant by the high strontium isotope ratio of the tooth
enamel.
bone pairs from
the Bell Beaker period indicate immigrants.
In addition, a Bell
Beaker child from the site of Straubing has
0. 712 0.714 0.720
Sr 87/86
from th sites of Augsburg
mean+ 2 s.d. value is 0.7103. This bone value is used as a
cutoff point in the enamel 87Sr/86Sr data to distinguish
immigrants. This value substantially exceeds the maximum
87Sr/86Sr value for soil samples from the project area (0.70992)
and is a very conservative estimate of immigration. Using this
criteria, 13 enamel samples lie beyond the cut-off value of
0.7103. These 13 individuals are 17.6% of the total number of
enamel samples (74) that were analyzed.
Thus, our estimates for the number of immigrants in the Bell
Beaker burials from southern Bavaria range between
17.5-23.8%. These are very conservative estimates for several
reasons, including ( 1) the geological zones of Bavaria are quite
large and migration within the same geological region will not
be discernible with strontium isotopes, (2) the numerical cut
off values are cautious as discussed above, and (3) the turnover
rate in cortical bone is very slow, as discussed below.
Given that this estimate is conservative, does 17.5-23.8%
represent a high or low rate of migration? First of all it is clear
that not all individuals are changing residence; there are no
indications of mass migration or demic diffusion. Clearly
there are several generations of the population represented in
the burials and some of these have not moved from outside the

fl.\ ia A
a very high
Sr isotope ratio in tooth enamel of 0.716210
(no compact femoral
bone was available). This child must
local geological regime in their lifetime. Secondly, a ,,normal"
rate of ffiigration in a model population can be estimated from

..
400 have moved a
substantial distance in the early years of its life life table data. Herrmann et al. (1990) use a migration rate
JJ!a A Thus, a total of .
A 15 of the 63 Bell Beaker individuals, almost based on histmical data of 10% for replacement in a model

.... A A 25
(23.8%), moved residence to new geological regions population. If this estimate of 10% is appropriate for
A dunng their life prehistoric Europe, then 17.5-23.8% mobility among the Bell
times.
0 2) An other cutoff value was also used, based on isotope Beaker people was very high indeed.
ratio value
0.709 0.711 0.713 s in bone, which provide a conservative estimate for The strontium isotope data provide details on other aspects
0.715 0.717 long-term
residents of the area. For this cutoff value we used of migration in the Bell Beaker period. Examination of the
81Sr/B6Sr he mean value +2 standard deviations for bone strontium chronology of the individual sites indicates a tendency for
is otope Bell
.
atio m the

sample. Thus, >97 .5% of the bone ales h hig er migration rates in the earlier part ofthe Beaker
Fig. 2. Scatterplot of elemental strontium content versus strontium isotope ratios in bone
fall Within
this cut-off point. The mean and standard devrnt10n period (Table 2). The sites from this initial period are smaller
or the b one
and tooth enamel for Bell Beaker graves in Bavaria. 87Sr/86Sr values are 0.7090410.000616; the b o ne and measured rates of migration vary from 33% to 50%.
 Price, T. D., Grupe, G., Schrote1; P & Middleton, W D.
Strontium Isotope Studies of Human Bone and Tooth Enamel: T he European Bell Beaker

The larger cemeteiies of Irlba ch, Augsburg , a nd Weicheri ng migrants came from a number of differe
nt areas. We Ag at oeath 45 Dasch, E. J. , 1969, Strontium isotopes in weathering profiles,
are dated to the younger phase of the Bell Beaker pe1iod and roughly estimate the minimal distances travers ca
ed by mi n + + + ++ + + ++
deep-sea sediments and sedimentary rocks, Geochimica
. . . -... +... +++ +
contain more buiials, 20 -30 inhum a tions, perhaps an md iv1duaI s. Among the sites we investigated gran t 100
the ce 0 et CosmochimicaActa 33, 1521-1522.
' m ete
indication of a more sedentary popula tion; migration rates a re Augsburg was at a maximum distance ry at oO
from the gra Engelhardt, B. , 1991, Beitrage zur Kenntnis der
ru tic .Q 80 0
lower, 14. 3% to 33%. depos1ts northeast of the Danube (Fig.
.

1). Graves 9 and lO ! 0 Glockenbecherkultur in Niederbayem, in Niederbayern

. 00

. !!'. 0 0 sci aic

Augsburg contamed two rmgrants; if those
"'

two individ 1 !O 60 0 Archiiologentag, Schmatz, K. (ed.), pp. 65-84,

Class #Burials . . u as ii> 0 sclmsf
Age tiaveled along the nver valleys, first to the west 0
and then to + sctmola Deggendorf: Leidorf Vig.
the
"

Child 9 south, the total distance involved was at least

..
0
220 km. 0 Ericson, J.E., 1985, Strontium isotope characteiization in the
40 0 0
Juvenile 8 0
0 study of prehistoiic human ecology, Journal of Human
Adult 59 0
Future directions 0 0
0

Evolution 14, 503-514.

20 0
I 00
Unknown 0
0
0 Eiicson, J. E. , 1989, Some problems and potentials of
__ ,..,, ... n 0
.
The intent o f his paper has been to presen
t a technique 0 strontium isotope analysis for human and animal
Table 2. Age Categories of Bell Beaker burials. . for 5.00 10.00 15.00 20.00 25.00 30.00 35.00 40.00 45.00
diretly exarmnm g population movement Age at Move
. in the past. T ecology, in Stable Isotopes in Ecological Research,
. he
apphcat10n of this technique to huma
n skeletal mater for dental Rundel, P. W. Ehleiinger, J. R. & Nagy, K. A. (eds. ), pp.
Age and sex information on the buria ls is summariz ed in ial F1. g. 4. Nmmalized changes in 86Srl7Sr ratios. .
from the Bell Beaker period has provid
ed strong eviden enamel( molar). femur ( msf), and pelvis (me) 252-259, Berlin: Spiinger-Verlag.
Tables 2 and 3. With regard to sex, female s were som e what
that rmgra
. t10n
. was substantial in this peiiod, at
least in as aJunction of the age of residence change Ezzo, J. A. , Johnson, C. M. & Price, T. D. , 1997, Analytical
more mobile than males. Some 62 of the sk eletons co uld be Bavaria, and likely elsewhere during
this time period. It for an individual who lived 45 years. perspectives on prehistoric migration: a case study from
sexed either anthropologicall y or a rchaeologically; 38 were is
important to emphasize th se of direct
, rather than proxy, east-central Aiizona, Journal ofArchaeological Science
males and 24 were femal e s. An equa l number of males and meas u res of human mob1hty m the .
past. Materials and ratios of 100 to an area of 0; the individual died at age 24, 447-466.
females (8 each) in the total sa mple we re indicated as mobile IB otope .
information can be earned or transmi

tted. Beakers and Faure, G., 1986, Principles of Isotope Geology, New York:
using the 0.001 cutoff value. T hu s a h igher prop01tion of 45. Variable bone turnover rates in the mid-shaft femur and m
daggers do not provide direct evidence
of human mobility. the anterior iliac crest are seen in the curves of re-calibration. John W iley.
females appear to be migr a nts. T his higher proportion might That information can come from huma
n skeletal material On the basis of such models, it will be possible to estimate the Faure, G. , and Powell. T. , 1972, Strontium Isotope Geology,
be explained by the practice of female exogamy, the and analytical techniques such as ancien
t DNA analysis and age of movement by comparing strontium isotope ratios in New York: Spiinger-Verlag.
movement of at marria ge fr om a n ancestral
females isotope ratios in human bone.
different bones and teeth. Frost, H. M., 1969, Tetracycline-based histological analysis of
residence to the community of the male. At this point, This study will be expanded along severa
l lines in f uture Strontium isotope analysis of human bone and teeth is a bone remodeling, Calcified Tissue Research 3, 211-237.
however, the evidence is only suggestive and additional research, attempting to locate the specifi
c areas from which very useful technique for the investigation of prehistoiic Gerhardt, K. , 1953, Die Glockenbecherleute in Mitte/- und
research is needed. these migrants came and examining
the life history of population movement and residential change. The range of Westdeutschland, Stuttgart.
migrating individuals. First, we will contin
ue the analysis of applications is wide - documentation of foreign rulers, Gerhardt, K. , 1976, Anthropotypologie der Glockenbecher
Sex #Burials skeletal material and sediments from Bell
Beaker burials. questions of animal pastoralism and transhumance, evidence leute in ihren Ausschwarmelandschaften, Glocken
Male 38 The strontium isotope ratio values of the
migrants in our of conquest, marital residence changes, and many others. This bechersymposion Oberried 1974, J. Lanting & J. D. van
Female 24 Bavarian study suggest that the areas from
which individ uals list continues to grow and we anticipate a variety of reports der Waals (eds.), pp. 174--164, Bussum-Haarlem.
Unknown 13 moved were to the east and north. Probable
source areas for utilizing this new and important method in the coming years. Graustein, W. C. , 1989, 86Sr/86Sr ratios measure the sources
the Bavarian migrants lie in Austiia, Hunga
ry, and the Cz ech and flow of strontium in terrestiial ecosystems, in Stable
Table 3. Sex of Bell Beaker burials. Republic and we are currently seeking these
samples. Acknowledgements Isotopes in Ecological Research, Rundel, P. W. ,
Second, we will examine individual vaiiat Ehleiinger, J. R. and Nagy, K. A. (eds.), pp. 491-512,
ion in strontiu m
Two cases of migration are observed in su b-adults. isotope ratios. Most of this variation is in fact
associated with There are a number of individuals and institutions to be New York: Springer-Verlag.
A female in Grave 9 at Augsbu rg died at approximately 15 diet and migration and the number of years
an individual has acknowledged in a project such as this. Funding for this Grupe, G., Price, T. D. , Schorter, P. , Sollner, F., Johnson, C. &
years of age. Her 87Sr/86Sr e namel ratio of 0.711687 indicates spent in the new place of residence. However,
other sources of research was supplied in large part by the Deutsche Beard, B., 1997, Mobility of Bell Beaker people revealed
an oiigin north of the Danube, while her 87 Sr/86Sr bone ratio of variation may come from intrinsic local variab
ility, multiple Forschungsgemeinschaft. Additional funding came from the by stable strontium isotope ratios of teeth and bones,
0.708184, matches the local levels at Augsbu rg. This juvenile changes in residence, changes in diet, age,
or the type of U.S. National Science Foundation (BNS-870273 l and BNS- A study of southern Bavarian skeletal remains, Applied
female must have made the journey duri ng infancy for the skeletal tissue measured. We are particularly
interested in 9111680). A number of colleagues have contiibuted to this Geochemistry 12, 517-525.
change to appear in tooth enamel. Grave 1 from Straubing was variation within the skeleton during an individ
uals' lifetime research including Brian Beard, James Burton, Bernd Gulson, B. L., Jameson, C. W. & Gillings, B. R., 1997, Stable
a small child with an isotope sign ature in th e tooth enamel for information about the life history of that
individual. Bones Herrmann, Clark Johnson, Jan Lanting, Dr. A.M. Parfitt, Steve lead isotopes in teeth as indicators of past domicile -
(0. 71621) comparable to granite. N o bone sample was and teeth remodel at different rates. Denta
l enamel from Shennan, and F. Sollner. Sample preparation was done in a potential new tool in forensic science? Journal of
available from this individ u al, bu t local soil samples provided different teeth develops at different ages
(Hillson 1986). Madison by KathieEvans and Bill Middleton and in Munich Forensic Science 42, 787-791.
a value of 0. 709656, indicating tha t the child was not born at Published data for tum-over rates (e.g., Frost
1969; Jowsey & by Dirk Weickmann. Hamson, R. , 1980, T he Beaker Folk: copper age archaeology
the site. These two cases of migration duri ng childhood, Gordon 1971; Parfitt 1983; Simmons
& Grypans 1989 ) in Western Europe, London: Thames & Hudson.
combined with the higher mobility of females, strongly indicate that enamel is stable, femur turnov
er is on the order References Herrmann, B. , Grupe, G., Hummel, S., Piepenbiink, H. &
suggest that people did not travel a lone (as traders or of 20 years, while the anterior iliac
crest remodels in Schutkowski, H. , 1990, Prii.historische Anthropologie.
craftsmen), but rather in sma ll groups, pr esumably famili es. approximately two years.
Carlson, A. K., 1996, Lead Isotope Analysis of Human Bone Leitfaden der Feld- und Labormethoden, Spiinger
As noted above, cemeteries were smaller duri ng the early Bell Sealy et al. (1995) and Cox & Sealy (1997)
have suggested for Addressing Cultural Affinity: a Case Study from Verlag, Berlin.
Beaker phase, perhaps suggesting smaller, co-r esidential units that different skeletal components should
provide information Rocky Mountain House, Alberta, Journal of Arclwe Hillson, S. , 1986, Teeth, Cambridge: Cambiidge University
at that time. Nevertheless, only half or less of the interred on changes in diet and residence during life.
Thus the human ological Science 23, 557-567. Press.
individuals were migrants, indicating that the entire group in skeleton preserves not only an infancy/deat
. h contrast in Childe, V. G. , 1950, Prehistoric Migrations in Europe, Oslo: Hurst, R. W. & Davis, T. E. , 1981, Strontium isotopes as
the cemetery had not tra veled as a un it , arguing against the sis 1s s .
r 6 r rat10s, but essentially records the isotop lnstitutet for Sammenlignende Kulturforskning.
ic life history tracers of airborne fly ash from coal-fired plants,
amval of Bell Beaker folk e n masse as warriors or invaders. of the individual. Based on differences within
an indiv idual Childe, V. G., 1957, The Dawn of European Civilization, Environmental Geology 3, 363-397
It is possible to examine dist a nces a nd direction of skeleton, it is possible to predict expec
ted strontium isotope London: Routledge & Paul. Jowsey, J. & Gordon, G., 1971, Bone turnover and osteporosis,
migration as well. The overa ll direction of migration for the ratios each year after a change in residence. Cox, G. & Sealy, J ., 1997, Investigating identity and life
A model based on in The Biochemistry and Physiology of Bone. Vol. III:
Bell Beaker people, base d on the strontium isotope data different turnover rates in tooth enamel
of the first molar, mid histories: isotopic analysis and historical documentation Development and Growth, SecondEdition, G. H. Bourne
appears to be from northea st to southwest, i. e., from granitic shaft femur, and anterior iliac crest is
presented in Fig. 4. of slave skeletons found on the Cape Town foreshore, (ed.), p. 201-238, New York: Academic Press.
to chalk and loess sediments. The varia tion seen in the In this hypothetical example, an individual
moved at the a ge South Africa, Intenationa/ Journal of HistoricalArchae Kociumaka, C. & Dietrich, H., 1992, Ein Grabeifeld der
strontium isotope ratios for tooth enamel suggests that of five from an area of a normalized
value for strontium ology 1, 207-224. Glockenbecherkultur vom Spmtgeltinde der Universitat

38
39
 Price, T. D., Grupe, G., Schroter, P. & Middleton, w D.

Augsburg, Schwaben, Das archiiologische Jahr in

Appli ation of Five
Bayem 1991, 12, 67-68. Isotopic and Trace
ent
Ele lli
Techruques, Ph.D. disserta A PRELIMINARY DETERMINATION OF METALS IN HUMAN AND
Koch, P. L., Halliday, A. N., Walter, L. M., Stearley, R. F., tion ' University of C
Sea1y, J. C., van der Mer ap eto
' F. J. &Wn.
Huston, T. J. & Smith, G. R., 1992, Sr isotopic
we N., Sillen, A., Kruger
'W ANIMAL BONES FROM PLEISTOCENE-HOLOCENE PERIOD IN TWO
.

.. Krueger, H., 1991, s1Sr

/s6Sr as a dietary indi
compos1t10n of hydroxyapatite from recent and fossil
mo dem and archaeologi
cator
in
REGIONS OF MEXICO
cal bone,

salmon: the record of lifetime migration and diagenesis, Journal of Arc

ological Science 18, 399-41 hae.
9.
Earth and Planetmy Science Letters 108 ' 277-287
Sealy, J. C., Armstrong, QUEVEDO ROBLES, P.,1 QUEVEDO LARA, T.,2
Lanting, J. & van der Waals, D., 1976, Bell Beak rs in I etime averages:
!"ti
R. & Schrire C. 1995
' ' ' B eyond
. CORONADO, G. 0.3 & ERICK REBORA, H.3
tracing life histories thro
continental No1thwestem Europe, in lXe Congres . ugh
ana 1 ys1s of d ifferent calc
. isotop1.
U.l.S.P.P., Colloque XXIV: La civilisation des vases ified tissues from archaeo
logica1. c 1ESIA Ear th Sciences, IPN-Av., IPN #2126 SC 303 Lindavista, 07340 Mexico D.F., Mexico, quevedopwww.bsmx.com
human skeletons, Antiqui
c mpaniformes (pretirage), J. Guilaine (ed.), pp. 8-32, ty 69, 290_300.
Shennan, S., 1986, Central 2ENAH-Arqueologfa-Mexico,
Nice. Europe in the third mill .
enniulll
BC.. A n evo I ut10
nary 3ENCB-IPN Mexico
traje
ctory for the beg1nru.
Liining, J., 1994, Central Europe during the Neolithic ' in
E uropean Bronze Age
og1caI
Hist ')'_ of Humanity, Vol. I, Prehistory and the , Journal of Anthropol
. Archaeology 5, 115-146.
Begmrung of Civilization, S. J. De Laet (ed.), pp. This paper forms part of a preliminary study focused on the determination and comparison of feeding habits on two human
Sherratt, A., 1994, The
emergence of elites. earl
540-556, New York: UNESCO . 1'e1 Bro samples and four different mammal species collected during a field trip on the valley of Cha/co on the state of Oaxaca, Mexico.
Age Europe, 2500-1300
Molleson, T., 1988, Trace elements in human teeth, in Trace . BC., in The Oxford Illu
strated Another objective was to find its relation with the process of fossilization in order to complement the studies made and in order
Prlust ry of Europe, B. Cun
OxtOrd
Elements in Environmental History, G. Grupe and B. liffe (ed.), Oxford:
Uruvers1ty Press. i to establish a tentative chronology of those found on archeological and paleontological collections. The first human sample and
Hemnann (eds.), pp. 67-82, Berlin: Springer-Verlag. some animals (bison, coyote and deer) were found on the Mixteca sierra, Oaxaca, close to a village with the name of San Felipe
Parfitt,A M.,1983, The physiologic and clinical significance
Sillen, A., 989, Diagen sis of the inorganic phase of corti
bone, m The Chenustry cal Ixtapa. The second human sample belongs to a male of about 22 years old found in the surrounds from Cha/co ex-lake, Mexico
pne. e
of bone data, in Bone Histom01phomet1)1: Techniques of Prehistoric Bone T D
( ed ) ' pp. 211-229, Cam state. He was found near the swface and is associated to some sherds. The studies were made using a thermic absorption
bridge: Cambridge Uni
and lnte1pretation, R.R. Recker (ed.), pp. 143-223, Boca vers1ty dispositive PEKIN ELDER MOD 370 with the right kind of lamp used on each case in order to make an inte1polation of curves

Press.

Raton, Florida: CRC Press. for each metal. The results on the content of Ca, Ba, Pb, Cd, Zn and Mg on every sample does not show any insight about their
Sillen, A. & Kavana h, M.,
1982, Strontium and pale
Price, T. D., Schoeninger, M. J. & Annelagos, G. J., 1985 odietary feeding habits for the high levels of contamination in the second human sample. It is required a palinologic study in order to
research: a review, Yea
Bone chemistry and past behavior: an overview, Jouma i 25, 67-90.
rbook of Physical Anthro
pology shed more light about it. Nevertheless the studies gave some interesting results, especially on sample SFIOOJ -H, as it is the
of Human Evolution 14, 419-448.
Price, T. D., Blitz, J. Burton, J. H. & Ezzo, J., 1992,
Simmons,
J. & Grynaps, M. D., 1989, Mechanisms of
contamination by vulcanism which can modify the studies about migration routes in the population of the Americas.
bone
. . . formation in vivo, in Bon
m Prehistoric Bone: Problems and Solutions, KEYWORDS: METAL-TR ACING, PALAEOZOOLOGY, PLEISTOCENE, HOLOCENE, MEXICO.
Diagenes1s e, Vol. I: The Osteoblast
and
Osteocyte, B.K. Hall (ed.
), pp. 193-202, Caldwe
Journal of Archaeological Science 19 513-529. ll: The
Telfo rd Press.
Price, :
D., Johnson, C. M., Ezzo, J. A , Burton, J. H. &
Introduction natural input with food, water and air, which depends pre
P. & Zindler, A., 198

Stau gel, H., Doyle,
Encon, . J. E., 1994a, Residential mobility in the 5, Sr and Nd dominantly on the local natural geochemical conditions, and
isotopesystematics in fish
prehi tonc southwest: a preliminary study using . teeth Ea1tl and Plane
,
tmy This paper forms pmt of a preliminary study focused on the the synthetic materials in the immediate or more distant parts
. S c1ence Letters 76, 45-56.
strontmm isotope analysis, Journal of Archaeological detennination and comparison of metals on two human of men and animal 's environment.
Steele, D. G. & Brambl
ett' C A 1988, 1rhe , Anat omy and
Science 21, 315-330. samples and four different mammal species collected during a More information is provided by a comparison of temporal
f!

Biology of the uman Skel

eton, College Station, Texas:

Price,T. D., Grupe, G. & Schroter, P., 1994b, Reconstruction
Texas A&M Uruversity Pres fieldwork on Chalco 's valley and in the state of Oaxaca, changes in the levels of metals in human and animal bones,
of miatio ? patterns in the Bell Beaker Period by stable s.
Stuart-Williams, H. L. Q., Mexico. Another objective was to find its relation with the which has changed in the past in relation to the varying
Schwarcz' H . p., Wh ite
strontmm isotope analysis, Applied Geochemistly 9 '
s ?ence, M. W., 1995, ' C . D. & process of fossilization in order to complement the studies availability and use of particular elements, and to the rate of
413-417. The isotopic composition
. and made in sight to establish a tentative chronology of those their anthropogenic dispersion in the environment.
diag nes1s of human bone
Rogers, G. & Hawkesworth, C. J., 1989, A geochemical from Teotihuacan and Oax
aca, found on paleontological collections and make the correlation We have studied Ba, Mg and Ca as possible indicators of
Mexico, Paleogeography
traverse across the No1th Chilean Andes: evidence for , Paleoclimatology, Paleo with paleoeco and climatic conditions during the Pleistocene long-term dietary and fossilization changes.
ecology 126, 1-11.
crust generation from the mantle wedge, Earth and and Holocene Period. This work forms part of an agreement
Weinig, J., 1992, Ein
ier_ und
neues Graberfeld der
Planetary Science Letters 91, 271-285 . Kup" made with the Musee de L'Homme from Paris, France and Sampling and sites
hbronzezeit bei Weiche
F ru .
Sangmeister, E., 1972, Sozial-okonomische Aspekte der ring, Landkre1s N euburg-

chrobenhausen, Oberbay
em, Das archii.ologische Jahr
Museo de Geologia y Paleontologia from Instituto Politecnico
Glockenbecherkultur, Homo 23, 188-203.
m
Nacional, Mexico.
Bayern 1991, 12, 64-6
We selected samples from Chalco's Valley and San Felipe
- 7.
Schmitz, B., Aberg, G., Werdelin, L., Forey, P. &Bendix The Departament of Inorganic Chemistry from the Escuela Ixtapa because the similarity in the climatic and soil
Vemois, V., Ung Bao, M. .
8, Cherruca1
& Deschamps N 198
Almgreen, S. E., 1991, 87Sr/86Sr, Na, F, Sr, and La in
a?a1ys1s of human dental
' Nacional de Ciencias Biol6gicas of the JPN made the quanti conditions of both places.
?
skel tal fish de ris as a measure of the paleosalinity of .
sites, m Trace Elements
enamel from archaeologi al
c tative detennination of the more significant elements and in this All the samples were incomplete skeletons due the pluvial
fossil-fish habitats, Geological Society of America in Environmental History G.
, way to confirm or reject the age estimated by association with erosion in the case of San Felipe Ixtapa, and though we did
Gpe & B. Herrmann
Bulletin 103, 786-794. (eds.), pp. 83-90, Ber :
lin fossils in different animal and human bone samples from sites not excavate the sites, all the samples were collected. We did
Spnnger-Verlag.
Sealy, J C., 1989, Reconstruction of Later Stone Age diets in of a few regions of the country, and to try to establish one not collected more samples because we could damage the

the south-western Cape, South Africa: Evaluation and relation between the results and the kind of alimentation that archaeological context.
had them and its paleoeco and climatic implications.
The metals of the study me mainly Cd, Pb, Mg, Ba, Ca, and Samples from San Felipe Ixtapa
Zn, which have one significant relation with the process of
fossilization because, through the time, the concentration of The town of San Felipe Iztapa is located in the District of
each element changes. In addition, the present relation Teposcolula at approximately 1800 meters over the sea into
between them, allows us to track many factors that were the Sierra de la Alta Mixteca. In this zone, there was a
present during the existence of these species. Pleistocene lake that lasted a long time (until XV I century)
By comparing the levels of metals in human bones from representated in one painting in the Convent of San Pedro and
past epochs with "contemporary" levels (Formative Period), San Pablo Teposcolula.
one may deduce information about the relative importance of Its topography is rough. This town presents three levels of
the particular source of contamination (Jaworowski et al. settlement clearly established, even though some are altered
1985). The metals may enter in human and animal bones as by rockslides. The levels are, from the most recent to the

40
Pro ceedings of the 31" lntemational Symposium on Archaeo111et1)'. Jerem, E. & T. Biro, K. (eds.), Archaeopress-Archaeolingua, BAR- Centr. Ew: Se1: 1.
 of Mexico
per iod in two regions
Pleistocene-Holoc ene
and animal bones from
na tion metals in human
0
det ernu

Erick Rebora, H. l.uni-1101-v

Lara, T., Coronado, G. 0. &
,
Quevedo Robles, P., Quevedo A pre was found in the
-detectable increase
hundred years, a non
bal atmosphere.
U or 226Ra into the glo
flux of Cd, Pb, Hg, V,
blis h a different
trations could esta
Only Calcium concen
ma ls. This con
(Chalco's one) and ani
diet between human
ent ary change rich
human bones an alim
160 centrations shows in thin k high
I). We
the sample (LCH045-
in com and grain for onl y could
1A0 pro ces s,
not be for fossilation
concentrations could cas e of the
the
120 ne contamination in
be by injer or limesto to 4), but
I-A 001
San Felipe lxt apa (SF
animal samples from the ma trix
ent s on
d in the next experim
this has to be checke
fur the r inf orm atio n. We can interpret
and correlated with the
an sample from
e element in the hum
the low levels of the sam
c rock flagstones
in the buiial of basalti
(ulg) its relative isolation
transported by
tamination with tha Ca
that could avoid the con
the water.
, levels of Zn in
orowski et al. (1985)
8 "'
0 As the results of Jaw
bone indicate that
in this millennia
:! human and animal
e. This could be
,.!.
level have been the sam
u. u..
(Chalco's Valley) the
'.Ci" Ill Cf)
-HOOJ). :i cess, but if we go
on and fossilization pro
iii :!;
le from San Felipe lxtapa (SFI
Fig. 1. Jaw of the Human samp $ 0 for increasing polluti
'!:::
E

11!
. -8 results we have in
ted to low, like the
farther, the level star
this zone, but deer is realy unco
.t::.
on sine 1 000 years ago, Iii c:
use this results for
od, Prehispanic (postclassic and and horse), so we can
_

E animals bones (deer

oldest, from the Colonial peri association with them. _g .2 e period. This have
maybe more. We found flint flakes m cation: the Pleistocen
Plei stocene-Holocene transition a chronology identifi
preclassic) and from the From the sample SFI-HOOl, we used the Vertebras. an horses about
Graphic 1. extinction of Americ
rints). correlation with the
(corroborated by lithic and footp ed to one deer (Cenvus of this species in
interest since 1993, and in
The mammal remains belong most recent samples
This town attracted our pers onal 20,000 BP (one of the
s dirus, SFI-A002 cussion
Linnaeus, SFI-AOO l), two Dire Wolfs Results and dis
(Cani
. Mexico).
those days begun our field trips or hesperohipus, resting results,
dies gav e some inte
anus
and 3), and one horse (Equus mexic
SFl- HOOl (Fig. 1). This sample Nevertheless the stu
The first find was the sample ls were: femur s-thigh bone, e samples are difficu
lt contamination by
SFI-A004). The parts of the anima analysis of the bon SFI-HOOl as it is the
s old found on a burial made The results of the especially on sample
is a female subject of about 45 year horse ), ribs (deer, horse and and flo ra we re s about migration
fibulas, tibias-shinbone (deer and environmental conditi
ons can modify the studie
clos e to San Felipe Ixtapa. to interpret. The vulcanism (Pb) which
with basaltic rock flagstones . re, and we have to relation with the
a group of footprints of dire wolf) and one skull (dire wolf) se of Jaw oro wk y and Pey herers. Th e Pb has cor
The second findings in 199 3 were differents from tho routes of the hunter-gat
ma trix where the volcanoes during
early Holocene Period s with samples of the red by geologist of the
stoc ene- co mplement the studie hard activities registe
many animals from the Plei
rabbits, and ancient
Sample from Lago de Chalco hav e to include pal
inologic and soil
e Period in the Eje
Neovolcanico
deer s, bones were found. We the latest Pleistocen
(camelids, mammots, bison, from the same firm with a few
s must be picked up ke inferences and con
lime stone . studies and the sample Transversal. We can ma
horses). These footprints are in ) belongs to a male and 1200 BP in ration, or one of
The second human sample (LCH045-I ,000+ BP in Oaxac a
the most probably mig
e of the hill. There are many stratigraphic context (20 sites which would be
The third find was in one slop surro unds from antique
in a few zones of about 70 years old found on the ulation of the Americ
as.
teca n tomb s Chalco). them, route for the pop
animal remains mixed with Mix was found near the surface
of Ca, Ba, Pb, Cd, Zn
and Mg on arza.
Chalco's lake, in Mexico state. He The results on the content Arq lgo. Rod rigo Esp
can distingui sh bones from We want to thank to
due to the pluvial erosion. We The parts were one rib and sho w any insight
and ancie nt horses: the and was associated to some sherds. every sample (Table 1 , Graphi
c 1 ) does not
its,
camelids, deers, bison, rabb the surfa ce and the ls of Ca
liphs are the same that leave one tibia-shinbone. For his distance
with
about their feeding h abits
for the high leve
References
animals representated in the geog samp le could have more
samples from San Feli pe.
contact with the water, this contamination in the animal
footprints. geo logi cal stud y in Human and
contamination than the others. It requires a palinologic, vulcanologi
cal and 1985, Heavy metals
y projectile points: cola de Jaworowski, Z. et al.,
Close to them, there are man wearing polyenthylene espe ciall ly the
ient and contemporary
France, in
All these samples were handled in order to shed more light abou
t it,
rs not identified (ancients, + or animal bones from anc
pescado, clovis and many othe with stainless steel tools more specific metals Els evi er Science
d by the varnish radio- gloves and aliquots were removed implications that wou ld have in thos e
The Science of the tota
l Enviroment 43,
be date
20-25,000 years) that will ic bags. or Silicium.
were picked up by hand into plast that have to do with diet like Stroncium Publishers B.V., Amster
dam, 103 -126.
n
carbon dating. a therrnic absorptio of Jaworowski et al. de desarrollo en Me
soamerica,
The studies were made using Taking into consideration the work pro ces o
hy of the region changed and d of Matos, E., 1982, El
We think that the topograp . 370 with a right kin l trends in the -13 1.
was dispositive PERKIN ELMER MOD (19 81), in a global scale, studies of tempora g[a Americana 5, 117
od, the site of the footprints n of Boletin de Antropolo
during the Pleistocene Peri r to make an interpolatio the past few
bone s sprea d was one lamp used on each case in orde concentrations of metals in glacial ice over
site of the
the margin of the lake and the
ins that contradict curves for the each metal.
The only rema took
site for butchery or similar. For the analysis we
All the samples were powdered.
this hypothesis are the wolf's.
rnl of
distilled water and 4
one gr and we add to each sample
7 km from these findings is
Aproximately, between 5 and with one watchglass and
cave of the wolf) in one slope HN03 cone. and were covered
(the (at the
one cave: La Cueva del Lobo nal volume, adding
y, we could not penetrate evaporated until 1/10 from the origi uble
ortu natel do
very pronunciated (72). Unf HCl cone. and the
roof collapsed. But in this end of the evaporation) 1 ml of mp le
the a
more than five meters because g notes from each s
bone s, 25 identified as volume in water filtering and takin
ins: 78
space we found animal rema
the rabbit is common in in the PERKIN ELMER MOD. 370.
that
human, deer and rabbit. We know -

g1ugtgl
Ba1ug/g) Ca(uglg) 'M
--- -- - -- _J Estim. Age Placd(uglg) Pb(ug/g) \Zn1ug/g)
;
i:!lI type -- - -- - --

1 4
-

31 i 681.
-

1
-
!

0 .3
I

0 156.94
I
- --- -----------
20,000 vears Oaxaca I 0
human {female) SFl-H001
- ---
38.811327-

----------

3.75 3.2 107.25 148.8

1,200 vears !Chalco
human (male) LCH-045-1 29.7 86.05 78.5 30.7\ 2457.
115,000 vears !Oaxaca 3.95
wolf SFl-A002 8.64 95.251 209 32.6i 15
20,000 years \Oaxaca 3.95
deer SFl-A001 3.95 2.74 83.25\ 209 37.3\
29\ 2911E
25,000 years Oaxaca I
horse SFl-A004 \Oaxaca I 2.9 13.8. 85.31 23.51
15,000 vears
wolf SFl-A003
Table 1.
43

,1')
 -KRAUTAC KER
CA L IN VE ST IG ATIONS AT SOPRON
TIIRACOLOGI
AN (NW-HUNGARY)
2
JEREM, E.
RUDNER, E. Z.1 &
Hungary,
rsi u. 43-45., Budapest,
cal Res ear ch Ins titute of HAS, Budao
1 Geogra phi ngary
Uri u. 49., Budapest, Hu
cha eol ogi cal Ins titu te of the HAS, 1014,
2Ar

T'ne culture,, orni also

fmm
Holl,tatt- ond Eody La
c" d fro m g """ of the U mfield-, Late offia to find bot ani cal
l" wm colfo etc., in
ci.arcool "nnp lam, furnace>, kiln"
t" 'uc h o' 1qf ten , joi"" "main' off<re-p use d 'ad ou' typ e> of
,,11lemen ntiate how P"hi,tod
c people
from co,,al We ha" tded to differe
tructu"' "g eta tion bon dat ing wa'
:,;Jenee about the
natuml a1b o,, al
1e, manufactudng,
junemry pmctic<' and
mryday life. Simultaneo
de
u,ly, rnd iow
to find out the 01igin
of the
arc hitectu lym wa e afa o ma
,egetation in wm e cam , dai,atogrophical ana t of the bu1 ied
ple '- In ied hou se, 01 ju'
on the ,ame 'am "main of a burnt 01 bur
canU d out the nea 1by fi" 'pot, ' if it i' ju" a g" pal yno log ica l and
if it could be f.-om ong otha thin
chOK oal, i.e. wa' applied and, am
eco!ngical approach malnly on the
Alt/ wu gh a complex palaeo in" "ig aJio n> pnwided infonnation
.,,,etatWn
bee n ca1 1ied out at the 'ite, the Jonna eta tion al-c limatological
in""igation' ha" can draw conclusions
on veg
oa,-pological inve stig atio ns, we
etation.
p of anthracological selection can affect veg
ation. With the hel ironment, on how this
cultural veget influence of man on the nat ura l env
can also estimate the
events, and, we
DIOCARBON,
N AGE, HU NGARY, RA
S: , BRONZE AGE, IRO
KEYWORD CH AR CO AL
N, LANDSCAPE.
NA TUR AL V EG ETATIO
etery (Jerem
ber Road and a nearby cem
route known as the Am
Introduction
1981, 1987). ent and the
to analyse the settlem
Our primary aim was
on a low plateau the basis of
r-side settlement lies original environ men t on
The multiperiod rive cemetery within their
in the valley natural
formed by three rivers
215-221 m above sea level s kind of recons truction of the
untain chain. charcoal analysis. Thi
hills and the Rust mo lly in the
enclosed by the Sopron has traditions especia
were excavated arboreal vegetation
usand square meters (see at Heinz 199 1) and similar
More than twenty tho Mediterranean area
(Fig. 1) between 1973-1988
. asionally been carr ied out in Hungary
investigations have occ
lement with evidence
of several 195 2; Val ko 1970).
(Hollendonner 1935; Sar
ber
The work concerned a sett kany & Stie
an trade
ated at the ancient Europe
phases of development situ

- SETTLEMENT

CEMETERY

100 km

' (
,./
I

0 som

ted area.
Fig. 1. Sopron-Krautacker excava
Centi: Ew: Sei: 1.
Archaeolingua, BAR -
E. & T. Bir6, K. (eds.), Archaeopress -
Jerem,
um on Archaeometry,
Proce edings of the 31" Imernational Symposi
 Rudne1; E. Z. & Jerem, E.
Anthracologica/ investigations at Sopron-Krautacker (NW-Hungary)
Nevertheless, H
anthracolog1c aJ
. u n gary
was among
an al s s
the first places
where
Deininger (1890 1
Methods
, 8 1 on
was made
t Bronze Age
thanks to the
work of
Accordingly' charcoal pieces
remains vaiies betwee 0
n 0
th e syste The size of our charcoal
matic sam .
20.0 cm, however we only examined the
span of the si . plmg fo r the
338-304
whole life
te cont
med, size5'
or Urngrave 23.
fraction in the
0.2-20 .0 cm (Schoch 1986) deb-5841 -25.15 217540
eside various
212-172
charcoal sample
.
s i nt n biomaterials

ed to ide
ntify the natu
vegetation grow ral arborea l tigations (Stieber 9 362-262
in g W ithi Reflected-light-microscopical inves
1
n a fe w hun
Kiln 365. -25.65 222030
dreds of meters .
deb-5833
the settlement
98 ), and eingrnber 1978, 9 259-194
(Ve rn et around and vanous tree-anatomy atlases (Schw
application of th
is veget
also the mult
ivariate . 1 90
were used m
ning
a sean j 378-337
ation m arc tree species identification and
funerary practi hitecture, ma .
Y hce (Figueiral s (Rudner et al. 19 ? deb-5809 House 100. -25.02 226045
ces and e nufacturi ng '
1988; Smart & H 306-210
eI ectron ffilcroscope for taking photo
9 )

veryda I'
1996 Boyd
1988). As a
.
the
offman We have exaffilned
711-709
three fracture faces of the remain
conclusions con
result, we ca draw . s ' 1
.e

. .
512-441
.
House I. -25.07 241050
cernmg
. tat'IOnaI-c1 im deb-5795
transversal, long1tudmal radia

1994. F'i
vege l and tangential
439-400
(B adal et al. atological pla nes
gueiral 199 events
sometimes we attaine h
)
Fractures were made by hand or
: 5 dte
surface by cuttmg the fragments 726-677
.influence . on the na . . as well as human .
House 361.
appropnate
-24.80 243050

deb-5793
. u1 al son-ou
e re a1rea 542-407
rnvest1g at10ns w ndmgs. Althou with a ra
zor.
1
gh botanical .
al. 984- 85; Fac
blade. No cheffilcal
radiocar bo
n
dy came treatment was applied so that
&
d out at this
726-677
site (Jerem et
' Jerem 198 ,
sa r
5 Jerem forthcoming),
datmg wouI d be possible as well.
House 138.
.
they pro vide info
rm ation . All microscopic investigations were deb-5803 -24.96 243050 542-407
mamly on canied out at
on the b the cultural the
727-677
. as es of vegetation Department of Plant Anatomy, Eotvo
. . archaeo bo
rnvest1g at10n s. T
.
House I.
s Lorand Univers
deb-5843 -24.40 2435 45
tamc
'

aI and carpol
542-410
h e re1,.0re ogical ity,
' our prese Budapest, Hungary.
Hungary as suc h nt results are
7.:SU-659
a I arge unique in The preparation of the charcoal for
area w1t h a radiocarbon dating w
n ana1 y House 308. -25.57 243550 560-557
great amount of
deb-5789
has not .yet b ee
(1982). Measurements
. material made according to Csongor et al.
549-408
sed to ex
composI110n an d
u s es 0f
PI ore the deve
lopm ent, done according to Hertelendi et al.'
s method (1987, 1989) in
we :
Age; it is also u ni 740-630
arboreal
que Ill Ce
vegetation from
House 301.
. the
deb-5801 -25.68 245050
the Iron
574-416
ntral E urope c Nclear esearch Institute of the Hungaiian
su bsequent time 10r the previous Academy of
p eri0 d s
as w ell. and Sciences m Debrecen, Hungary. En-
746-601
ors were taken into acco
unt
in congrnence with Hertelendi (1990
). Calibrations follow the deb-5817 Pit 192. -24.07 246545
Archaeolog
method f Stuiver & Reimer published 598-426
in 1993. All the samples
ical c
ontext and ?
sampling
House I. -25.63
were umformly taken from Quercus
Due to the e
xcellent
robur!petraea species.
deb-5819 246550 749-424
topographi. In some cases, derivatographical analy
ses are being carried
finds chrono log i c position of
c a l l y ra the site ' the out by Gy. Szo6r at the Depa
House 270.
nge from
deb-5799 - 24.52 248560 766-418
M'ddl
1 the COpper Ag rtment of Mineralogy and
e Ages ' a
nd trace e to the late Geoloy, Kossuth Lajos University
s of vari ou . , Debrecen, Hungary,
be demonstr s cuI turaJ mflu
od (1971). The aim of these
. ate d. T he ences could according to M. Foldvari's meth
golden er
the fiirst deb--5786 Urngrave 167. -25.31 291540 1123-1021
from the si xth to a 0f this settlem
ent dates analyses is to specify from the
c . century B burning temperature if the
iound m the cem C on the basis
erem 1981,
of items
1984-85) an d the
etery (J charcoal samples came from a heart
1987; J erem et al. h, a burnt or a buried
deb-5821 Urngrave 75. -24.77 296550 1242-1069
same is .
house, or just from buried vegetation.
data (Table 1, F
ig. 2).
con firmed
by some radio
carbon
Charcoal sam
deb-5810 Urngrave 167. -25.47 297555 1270-1075
ples Radiocarbon evidence
re collected
other structures from the graves
of th
rnfiel cu and
1397-1246
Hallstatt an d th e lture, from the
Urngrave 159. -24.78
end of the
deb-5811 307050
La en It was the first time that an exten
1425-1137
e periods. sive 14C analysis was
of bonfires, Wo They containe
nearby vegetati o especially on Iron Age
oden g . d remains made on Late Bronze Age and
rave-posts
2853-2796
or JUst remain
coevaI and La
n . F urt s of the
Pit 32.
material in Hungary. This first
deb-5836 -24.71 413045
her sam series of data represents
2733-2596
ples came fro
Tene s m obie J cts of almost the whole life span of the site
ettlemen t

remams of h earth s, such as from the 3rd millenium

s, oven rafters ' Jo ists, up to the 2nd century BC.
s' furnac
structures were in es, kiI ns, etc.
Table 1. Radiocarbon data.
vest'ig ate At least ten In the case of Late Bron ze Age um
d from eac graves as well as at the
although most o
f the s h chronologi
amples w cal phase 23rd Celtic um grave, the charcoal
c
1rom the Late H ere Int. samples represent the
allst tt- entionally chosen remains of the fire of the cremation,
Early La and this is why they have radiocarbon dates, which represent two separate building of which we found the remains were brought from the native
because this chron Te ne transition
oJog1caJ period, great importance as a dating tool.
BC had n ot b ee peno d from the They provided data in periods of the house as also suggested by the archaeological area of the species on purpose, or they were the member of the
n w eII 6th-4th centuries congrnence with the archaeological
excavat10 ns at So known bef material. observations. natural vegetation around the site. This problem needs further
pron. ore th e large
scale The order provided by the conve
ntional radiocarb on
took 1
As sampling investigation. Our species are mainly European, Central
ace bet wee
n 1973 and
(Table l ) and calibrated data (Fig.
2) is also in harmony with
1988, and
methods for syste Charcoal evidence European or Submediterranean floristic elements. Regarding
regionality, they mainly occupy altitudes between 0-800 m
matic s the finds based on typo-chronologi
ampling cal dating.
ological sites e of charcoal at
oal n01mally came from
la b or te archae- In case of the houses, the charc
d by anth Elements of natural arboreal vegetation found at the a.s.l. They are members of the following cenosystematical
repo1ted in the ea racologists wer
rly ninet .
1992 ; Grau-Al ies (Bad aI-
e only building material, and this can possi
Garc1a 1992; bly explain the wide Sopron-Krautacker settlement and cemete1y are
m ero 19
92' Chaba
shown in relations: within Carpino-Fagetea the Ulmion, Alnion
Table 2. Discrimination between Quercus robur/petraea
Figueira!
1992), the excavatin l 1992; Lero
chronological frame of data. Iron Age
yer & Heinz
people seem to have glutinosae-incanae, Carpinion betuli and the Fagion medio
(Feuillat et al. 1997; Figueira!
1993), Ulmus minorlglabra,

g are hae used trees from the same nearb
. ologist too y forest that had already europeon, within Quercetea rob01i-petraeae, the Castaneo
for qualitative analyse s. k only samples
enough existed there long before the lates Fra xinus excelsior!ornus,
t given calendar yeai. Tilia platyphyllos/cordata and Quercion, and they can be the members also of the Quercetea
.
More than two
d charcoa1 ated age of houses 301 Cratae gus-P yrus (Schweingrnber 1990; Heinz et al. 1988) is
pubescenti-petraeae. In harmony with Z6lyomi et al. (1967)
thousan
from 182 sam
Although the archaeologically estim
and 308 is a bit different from the
pieces were analysed
f 6
ples o
(26 buildings, l po and So6 (1964-80), the TWR values show that they are mainly
radiocarbon-measured age not possible
archaeologica at the moment, on the basis of wood anatomy.
' 18 Pits, 7
sthole l strnctures
kilns, 15 graves '
(4th century BC), this, perhaps, is I the case
hearths, ovens fu not an en-or either in of Salix-Populus, the author could not find the slightly cold resistant, xero- and mesophylous, acidophylous
Using Eartha's work (1992-93), we can describe
l so1] pr ' rnaces ' archaeology or radiocarbon datin
. ofi le) Ha g, but sheds light partly on difference.
unexanuned I f of the sam or neutrophylous-basiphylous species.
. . Its anaJysis . ples remained
Quercus robur/petraea (Plate 1.1) was used on the widest
promises stratigraphical problems, i.e. multi our assemb
on the topic, for f urt her useful pe1iod uses of buildings, lage as follows. We found two species of doubtful
14C analyses gave only a
this reas information and partly on the fact that the origin, the
on we wil refore our work may contribute solutions to this
l focus on their scale for buildings, in pits, funerary practices with Sorbus sp.,
This phenomenon can be
evaluation in the
near futu complete te1minus ante quern for dating. problem.
re. Jug/ans regia and Castenaea saliva are thought not as fuel in the household and this was the exclusive building
observed in House I., and this native to
is suppoited by the three Hungary. It is a question whether the individuals material of the ovens and kilns where, at the same time, the

46
47
 R11d11e1; E. Z. & Jerem, E. Anthracological investigations at Sopron-Krautacker (NW-Hungary)

Sample name

Urngrave 23. [EC] deb-5841

Kiln 365. - deb-5833

House 100. deb-5909

House I. II 1 deb-5795

House 361.
II Ml deb-5793

House 138. II Ml deb-5903

House I. II Ml deb-5843

House 308.
,. deb-5799

House 301. 1 deb-5901

Pit 192. deb-5817

House I. deb-5919

House 270. deb-5799

Urngrave 167. deb-5786

Urngrave 75. deb-5921

Urngrave 167. deb-5810

Urngrave 159.
im::IO deb-5811

Pit 32. 1M1 deb-5936

3000 2750 2500 225020001

750 1500 12 5
0 1000 750 500 25 0
0 2 _ 0 500 750

cal :SC cal AD

o n a g es in calendar years (BC. AD).

Fig. 2. Calibrated radiocarb

fu l The investigation of charcoal prove the evidence of pollen

e was also Quercus and Fagus sylvatica (Plate 1.2). Fagus
was also the raw material of the posts. analyses, except in the case of the occurrence of Betula and

Pits and the nearly entirely analysed House I., from where
45 samples were taken from various parts of th e house,
contained a more diverse arboreal flora with Quercus
robur!petraea, Fagus sylvatica, Crataegus, Pyrns, Tilia,
Ulmus, Sorbus, Acer, Salix-Populus an d pines.
Rosaceae. Nevertheless our work has provided more in
3. Fraxinus excelsior/omus 4. Carpinus betulus
formation on local arboriflora.
In some cases, sieving of section material took place, and
more than 2 g charcoal/I 00 g sediment ratio was found. This
is relatively high in comparison with the data of Carcaillet &

No significant differences could be observed yet in the Thinon (1996), thus suggesting a nearby forest or/and a major
subsequent age s. fire phase.

Number of Number of
Tree species structures samples with the
where this type occurrence of the
of tree tree sp.
occurred

Gymnosperms Picea sp. 2 2

Angiosperms:Trees Quercus roburlp

etraea (Plate 1.1.) 53 146
Quercu s cer ris 1 7
6. Alnus glutinosalincana
Fagu s sylvatica (Plate
1.2.) 9 10 5. Ulmus minor!glabra

u111111s 111i110 1/g/abra (Plate 1.3.) 4 10

present species of
Acer ca111p estre 3 4 Plate 1. SEM micro graphs of the transversal planes of some
of the reconstr ucted vegetatio nal types.
Fraxi1111s excelsiorlornus
(Plate 1.4.) l 2 characte ristics

A/nus glutin osa/incana (Plate 1.5.) 1 2

We have evidence for the fire origin of the charcoal from Thiebault 1987). In our case, arboreal vegetation consisted of
ordata
Tilia pla1phylloslc 1 1
river-bank alder-groves (Plate 2.2) followed by oak-ash-elm
t11/11s (Plate 1.6.) anatomical damages. Sometimes the whole f ragment is
Cmpin us be 2 5
unidentifiable, but most of them are only burnt in parts which groves (Plate 2.3). These two are edaphic vegetation types.
Jug/an s regia 1 1
means that at these places they have no anatomical structure As a zonal community, hornbeam-oak forest (Plate 2.1)
Casta nea sp. 3 12
but only the compact coal material. could exist in the mentioned ages, as also suggested by pollen
Salix-Po p11/11s 3 3
analysis and carpology (Jerem et al. 1984-85). Maple-oak
Bushes Sorbus sp. 2 3
forest, characteristic of loess areas, could grow here and beech
Discussion
Crataegus-Pyrns 1 1
could mix in the two latter forests. These types might have
Unidentifiable 5 5
Charcoal remains from archaeological sites provide occupied the closer surroundings of the settlement.
evidence about the natural arboreal vegetation growing within Quercus robur/petraea (Plate l .1) is used on the widest scale,
a few hundreds of meters around the settlement (Vernet & probably because of its high quantity and wood-properties, i.e.
Table 2. E/e111ents of natural arboreal vegetation.

48 49
 )
Sopron-Krautacker (NW-Hungary
Anthracological investigations at
Rudner, E. Z. & Jerem, E.
although
y (Jerem et al. 1984-85),
were pollen analysis and carpolog
struction. Mature trees ence of a more open env
iron ment
luable for con the latter data provided evid
ha r d - wOod' va ny cas es frag me nts with viti es. But
it i s a . We found
in ma nsity in agricultural acti
urp ose as a result of growing inte

for this l for

used nn gs (Figueira! 199
6) . It was also the main fue . re information about the
plan ts with
tr e e bet ter bur rung pollen data provide mo
arro w Fag us has t is why it
. i'te of the fact that from crops and weeds. Tha
higher pollen production
n sp ndant and
s in to have been more abu racte1ize the
hearth . . . B ut Quercus seems various methods to cha
es

th e se 1ection of is so important to apply
qual iu ter imp ortan ce m Furthermore,
to hold grea aeological settlements.

.
b'lity seems
1 198 8). These natural milieu of arch
avai la & Ho ffm an could grow
l 1996; Smart eristic of loess areas,
o o d (Figueira .
young branches. maple-oak forest, charact
fue 1 w
st cases, rem ams of
in the two latter forests.
These types
eS Cont
ained in mo able here and beech could mix
1a c have profit

e p know n to
.

fi r
tica (Plate 1.2)
1s closer environment.
Fi us sylva rco al. Ac cor din gly, might have occupied the e use,
cha
to provide goo d te 1.1) had the widest scal
g g qualities and industrial kilns and furnaces (Jerem
urnin Quercus roburlpetraea (Pla
e1ti es. It was
l in quantity and wood-prop
used as fue .. probably because of its
1t was 8; ilhs et al. 1998).' .
e m et al. 199 "':' also the main fuel for hear
ths.
1984; Jer
.

, for
around bmldmgs and pits d as fuel in industrial
kilns and
were found m and Fagus sylvatica was use
Soft woods Crata egu s and Pyru s, al. 1998).
Sorbus, m et al. 1998; W illis et
alix-Populus, furnaces (Jerem 1984; Jere
ample S veg eta tion (no n
s and pits,
: the bur ied
the remains of in and around building
obably as Soft woods were found
l, Bo yd 198 8) or they were used for probably represent the rem
ains of
charcoa used for basketry and they
artefactual
nks to their flexibility.
ueira! 1996), tha the bmied vegetation.
basketry (Fig ur/petraea (Plate 1 .1) to our
y rites, Quercus rob to nowadays, according
During funerar The climate was similar
spe cies are thought to Hun gary
sp. were utilized
. These zonal vegetational map of
a d Sorbus
n results and the present day
n (Boyd 1988), so eo
k trad itio plex pala
ropean mystical fol gested by a series of com
have a long Eu e. (Fig. 3), which was sug
mal aco
purpos (pollen, microvertebrate
,
e been selected on
they might hav ecological investigations
cal
underline the archaeologi site lies in
The fire dam age to the rem ains l (Jerem forthcoming). The
gh itlogical analyses) as wel
wo uld be
ng house-fires. Alt hou
etat ion as wel l as climatic in
obsevvations concerni a border zone regardin
also pro vid e
g veg
s, the y can
the causes of fire d nowadays, too.
interesting to specify evefluences, as can be observe
r, we still
, how out
climatological informa
tion. To achieve this
tive analyses are being carried
Individual and compara n
tal reco
need further rese arch. ing a complex environmen
with the purpose of mak faun a
the
whole of the flora and
struction including the d
Conclusion ral setting and the dom
esti cate
comprising both the natu
clim atic fluc tuat ions and shed
reve al
utacker species. They may also
settlement at Sopron-Kra caused by human activity
.
Charcoal remains from the ral ligh t on phe nom ena
near by cemetery prov ide evidence on the natu es are uniq ue in Hun gary as well as
and the These investigation seri
2. Alder grove few hun dred s of met ers e number of
within a Europe owing to the larg
arboreal vegetation growing in the whole of Central
et & Thie baul t 198 7), whic h relatively
around the settlement (Vern of the analyses and the
r-ba nk alde r samples, the complexity
types such as rive ly accurate
consisted of edaphic vegetation n. They promise a fair
es (Pla te 2.3) . large chronological spa
ash- elm grov ng a home
groves (Plate 2.2) followed by oak- the natural sphere providi
st (Pla te 2.1) coul d picture of the region and
fore
As a zonal community, hornbeam-oak
for an Iron Age population.
it was also suggested by
3. Oak-ash-elm grove have existed in the mentioned ages, as

forests;
1. Zone of montane beech
Hungary (Borhidi 1961) -
Fig. 3. Climazanality map of Zon e of oak forests;
eam-oak forests; 4.
2. Zone of sub montane beec
h forests; 3. Zone of h ornb garian Plain,
arid zones of the Gre at Hun
5. Zone of forest-steppe; 6. 1soxere
s showing the indentically

Plate 2. Present day pictures of th e reconstructed vegetational types on the bases of semiaridity-index
values.

(after Garami 1993).

51
 Rudne1; E. Z. & Jerem, E.
Anthracological investigations at Sopron-Krautacker (NW-Hungary)

leisztocen vegetacio
Stieber, J., 1967, A magymorszagi fels6p
Age to Roman, at the archaeological site of Cast Ko
. "lto", L. &. Bm tosiewicz, L. (eds.),
enyek tiikreben,
ch in Hungmy II, 85-
Acknowledgements ro m t6rtenete az anthrakotomiai eredm
trade 95.
Penices, N.W. P01tugal, Vegetation History met1.i.c I resear ocene in Hg
'

.
Archaeo (Vegetation history of the Upper Pleist
C & Hem z, c . ,
a a .

1992' Com plem entm 1te , des etu , d es .

1es
This research was carried out with the support of Grants Archaeobotany 4, 93-100. FOldtam Kozlony
r,eroyer, on the basis of anthracotomical data),
Figueira!, I., 1996, Wood resources in north-west Portu 1,
. anthracolo giq ues : les exemp
giques et

OTKA F 026036 and OTKA T 023830 of the Hungarian

g palynolo et de
.
(And orra) 97, 306-317.
a Mar gine da
1 Stuiver, M. & Reimer, P. J., 1993, Exten
National Science Foundation. their availability and use from the late Bronze Age t s de la Balm ded 14C data base and
o pyreneen la
Roman period, Vegetation Hist01y and Archaeobotan 5e
Fran ce), Bull etm d e
. , ees-Orientales, ation program,

(Pyren revised CALIB 3.0 14C age calibr

y ' Belesta 5 .
e de France 139, 281-29
References 121-129.
Soci,,ete, Botaniqu
K. & Siimegi, P., 1997, M
odelling of Radiocarbon 35, 215-230.
anya novenyleletek anthrakoto
Foldvari, M. , Metamorf k6zetek szerves E., B ab os,
Rudne, . . Valko, E., 1970, Bekesi bronzkori
1971,
z d anat omy and qumter-
Badal-Garcia, E., 1992, L'anthracologie prehistorique:
propos de certains problemes methodologiques, Bulletin
a tartalmanak vizsgalata derivtograffal szeniiltsegi
szempontjabol, FOldt. Int. Evi Jet. az 1971. evr{J/
roi climauc
change by woo
at upper plenig lacial /inter p I erug I acia 1 miai vizsgalata, Magyar Meztfgazda
sagi Muzeum Kozle
malacology nd Euro pean menyei 19, 23-32.
' of Seco
de la Societe Botanique de France 139, 167-189. . n m Hungary' Abstracts
transitio acologiques en region
. Vernet, J.-L., 1988, Analyses anthr
297-301.
Badal, E., Bernabeu, J. & Vernet, J. L., 1994, Vegetation Garami, L., 1993, Kepes utikalauz. Wdett ternieszeti erte/ie. laeontologic
al Congress, V ienna. . ologie, Pact 22,
ki also, meditenaneenne, milieux et arche
S & Stieber,
changes and human action from the Neolithic to the ink, Panorama, Budapest. :a J., 1952, A remete-szurdo
ar k
Bronze Age (7,00,000 B.P.) in Alicante, Spain, based Grau-Almero, E., 1992, Methodologie de prelevements des
S
lan alluvialis
faszenei, MTA Biol. Oszt. Kozl
. 1, 149-160.
Vernet, J.-L. & Thiebault, S., 1987, pproach .
to
on charcoal analysis, Veget. Hist. Archaeobot. charbons de bois dans les sites protohist01iques, Bull etin prehistonc veget at10n
239-254. nmthwestern Meditenanean recent
3,
. .m BergIund,
analysis,
1986 ' Wood and charcoal
eoeco zogy and
155-166. de la Societe Botanique de France 139, 205-211. Schoch, W and ecologic impli cation s, Journ al of Biogeography 14,
Handbook oif Holocene Pala

Bartha, D., 1992-1993, A magyarorszagi dendroflora tagjai Heinz, C., 1991, Upper Pleistocene and Holocene vegetation B. E. ( ed.),
ey & Son
Bennett, K. D. & Toth, A.,
s. 117-12.
nak florisztikai, conologiai, okologiai es termeszetvedel in the south of France and Andorra. Adaptations and first Palaeohydrology, Wil
W illis, K. J., Siimegi, P., Braun, M.,
' Microscopi
F H c Wood Anatomy,
mi mutatoi, Erdeszeti es Faipari Tudonuinyos Kozleme ruptures: New charcoal analysis data, Review of Schwemgru b er, 1978
in Hungary: who, how
1998, Prehistoric land degradation

.,

nyek 38-39, 13-32. Palaeobotany and Palynology 69, 299-324. Zurcher AG, Zug.
and why? Antiquity 72, 101-113.
Schweingruber, F. H.,
ds,
Borhidi, A., 1961, Klimadiagramme und Klimazonale Karte Heinz, C., Badal Garcia, E., Figueira!, I., Grau Almero, E., 1990, Anatomy of European Woo
Jakucs, P., Ka-pat hi, I.,
Zolyomi, B., Barath, Z., Fekete, G., .
Thiebault, S. & Vernet, J.-L., 1988, Identification des
Karpathi, v., Kovacs, M. & Mathe,
Bern-Stuttgart. ?
I., 19 7 Emre1 ung
..
Ungams, Annal. Univ. Sci. L. EO!vos, Budapest. se1: biol. .
Smart, T. L. & Hoffm
an, E. S., 1988, Envrronmental
.

4, 21-50. charbons de bois prehistoriques mediterraneens, m okolog1sche

. Hastorf, C. A. von 1400 Arten der unga risch en Flora
Boyd, W. E., 1988, Analysis and Interpretation of Non
Charcoal, m
chronologie et repartition, Pact 22, 161-172. Interpretation of Archaeological enta Botanica
Grnppen nach TWR-Zahlen, Fragm
& Popper, B. S. (eds.), Current
Paleothnobotany, 167-205,
Artefactual Wood Assemblages from Archaeological Hertelendi, E., 1990, Sources of random error in the Debrecen
Museo Historici-Naturalis Hung arici
4, 101-142.
go and London.
Sites, Pact 22, 311-318. radiocarbon laboratory, Radiocarbon 32, 283-. The University of Chicago Press, Chica
ac!6 rndze1:
Carcaillet, C. & Thinon, M., 1996, Pedoanthracological Hertelendi, E., Gal, J., Paal, A., Fekete, S., Gy6rffy, M.,
fl6ra es veget
So6, R., 1964-1980, A magyar .
emm Kiado,
Gal, I., Kertesz, Zs. & Nagy, S., 1987, Stable isotope
., Akad
contribution to the study of the evolution of the upper tani-novenyfoldrajzi kezikonyve I-VI
treeline in the Maurienne Valley (North French Alps): mass spectrometer, in Wand, U. & Strauch, G. (eds.), Budapest.
methodology and preliminary data, Rev. Palaeobot. Fourth working meeting isotopes in nature,
Palyn. 91, 399-416. Akademie der Wissenschaften der DDR Zentral
Chahal, L., 1992, La representativite paleo-ecologique des institut fiir Isotopen und Strahlenforschung, Leipnig
charbons de bois archeologiques issus du bois de feu, l , 323-.
Bulletin de la Societe Botanique de France 139, Hertelendi, E., Csongor, E., Zaborszky, L., Molnar, J., Gal,
213-236. J., Gy6rffy, M. & Nagy, S., 1989, Counting systemfoD
Csongor, E., Szabo, I. & Hertelendi, E., 1982, Preparation of high precision C-14 dating, Radiocarbon 31,
counting gas of proportional counters for radiocarbon 399-408.
dating, Radiochemical and Radioanalytical Letters 55, Hollendonner, F., 1935, Az Alfold 6st6rtenelemkorabeli
303-. erdeinek meghatarozasa anthrakotomiai vizsgalatok
Deininger, I., 1890, Pflanzenreste der prahistorischen alapjan, Matematikai es Termeszettudomanyi ErtesM
Fundstatte von Lengyel, in Wosinszki (ed.), Das 53, 59-69.
prahistorische Schanzwerk von Lengyel, III, Bp. Jerem, E., 1981, Zur Spathallstatt- und Friihlatenezeit in
Deininger, I., 1891, Adatok kulturnovenyeink t6rtenetehez. Transdanubien, in Die Hallstattkultur, Bericht iiber das
A lengyeli 6skori telep novenymaradvanyai, A keszthelyi Symposium in Steyr, Linz, 105-136.
Magyar Kiralyi Gazdasagi Tanintezet 1891-i evkonyve, Jerem, E., 1984, An early Celtic pottery workshop in North
Nagykanizsa. Western Hungary: Some archaeological and
Facsar, G. & Jerem, E., 1985, Zurn urgeschichtlichen technological evidence, Oxford Journal of Archaeology
Weinbau in Mitteleuropa, Wissenschaftliche Arbeiten 3, 57-80.
aus dem Burgen/and, Eisenstadt, 71, 121-144. Jerem, E., 1987, Die altesten Korperbestattungen im

Feuillat, F., Dupouey, J.-L., Sciama, D. & Keller, R., 1997, A Osthallstattkreis, Mitt. der bsterr. Arbeitsgemeinschaft
new attempt at discrimination between Quercus petraea fiir Ur- und Friihgeschichte 37, 91-101.
and Quercus robur based on wood anatomy, Can. J. F01: Jerem, E., forthcoming, Anthropogenic Effects on P re
Res. 27, 343-351. historic Environments in Hungary, Archaeolingua 11.
Figueira!, I., 1992, Methodes en anthracologie: etude de sites Budapest.
du Bronze final et de l'iige du Fer du nord-ouest du Jerem, E., Facsar, G., Kordos, L., Krolopp, E. & Voros, I.,
Portugal, Bulletin de la Societe Botanique de France 1984-85, A Sopron-Krautackeren feltart vask01i telep
e
139, 191-204. regeszeti es kornyezetrekonstrukcios vizsgalata, (Th
of th e
Figueira!, I., 1993, Charcoal analysis and vegetational archaeological and environmental investigation
cker ),
evolution of North-West Portugal, Oxford Journal of Iron Age settlement discovered at Sopron-Krauta
Archaeology 12, 209-222. ArchErt 111, 141-169; 112, 3-24.
Jerem, E., Balla, M. & Balazs, L., 1998, Early Celtic stamp
Figueira!, I., 1995, Evidence from charcoal analysis for
ed

environmental change dming the interval Late Bronze pottery in the eastern Alpine Area: workshop activi ty and

53
 TUDY OF MIGRATION IN MEXICAN PREHISPANIC P OPULATIONS
A S
BY USING DNA ANALYSIS

SALAZAR, C. Z., ARRELLIN, R. & VARGAS-SANDERS, R.

Laboratorio de Antropologia Molecula1; Instituto de Investigaciones Antropol6gicas,

Universidad Nacional Aut6noma de Mexico, C.P. 04510, Mexico, D.F., Mexico

The movements of Mesoamerican Mexican populations through Mexican territory have been motivated by various natural
and social causes. The results of archaeological research and physical anthropology data show similar cultural characteristics
between Teotihuacan and Tula populations which are represented clearly by Coyotlatelco and some Mazapa ceramics,
offerings, burial patterns and cranial deformations (Epiclassic occupation). These facts suggest that both populations could
belong to the same genetic group in this Epiclassic occupation. In this work the genetic frequencies of these populations were
compared to see whether they are in agreement with the historical sources as well as archaeological and physical
anthmpological studies. Comparative analysis of allele frequencies of these populations vaiy in time and space.

KEYWORDS: ANCIEN T DNA, PCR, BONE, MEXICAN POPULATIONS, MIGRATION.

Introduction appears as part of one complete set of data which includes

genetic differences between the populations, their culture and
It is known that the movements of human populations places of settlement, as well as the age, sex and size of
through different places, have a great . impact on human migratory populations.
biology, anthropology, demography, epidemiology and The objectives of this work are to compare genetic
genetics. Although the biological aspects of migration are frequencies of five genes in two Prehispanic Mexican
more related to effects rather than with causes, it is important populations in and around the Basin of Mexico. To study the
to know which of these facts resulted in these movements possible convergence of archaeological data and morpho
because of the biological implications involved in it. logical and metrical traits with genetic results from
The movements of Mesoamerican Mexican populations Teotihuacan and Tula populations, and to relate the genetic
through Mexican territory may have been motivated by frequencies with migration patterns.
various natural and social causes. In the particular case of
Teotihuacan and Tula populations, archaeological research Materials and methods
and physical anthropology data show similar cultural
characteristics between both populations in the Epiclassic Samples
occupation, which are clearly represented by Coyotlatelco and
Mazapa periods. Human bone remains were obtained from different
There is cultural evidence that the Coyotlatelco played a archaeological sites: Tula, Hidalgo and Teotihuacan and
fundamental role in the decline of Teotihuacan's state and the Estado de Mexico. The areas that were studied, included a
rise of Tula, but it remains one of the least studied and most museum (Chamay square) from habitations, civic centres,
poorly understood culture in Central Mexico (Rattray 1966). tunnels and caves with remains ranging intime from about 600
All Coyotlatelco settlements contain cultural elements that to 1300 years old.
strongly suggest that at least one segment of their population
consisted of recent immigrants from the northern DNA isolation
Mesoamerican periphery, perhaps from areas in Queretaro
an d Guanajuato or Zacatecas and Jalisco (Mastache & Bone remains obtained from the excavations and were
Cob ean in press). On the other hand it is believed that people immediately send to us for DNA analysis. These were always
coming from Teotihuacan were the primary colonisers in the handled with gloves and forceps to avoid contamination by
Coyotlatelco period at Tula. skin cells or perspiration.
What is clear, however, is that nearly all of the Teotihuacan Each bone sample consists of 2 different anatomical pieces.
relate d settlem
ents in the Tula area were abandoned by the Excess soil was removed by scraping with a scalpel blade.
end of the
Metepec phase (AD 650-750). This abandonment Samples of 1-3 g were crushed and genetic material extracted
Was directly related to Teotihuacan's decline as a according to modified version of Maniatis' method (Vargas
political and
economic
centre, a decline that involved radical changes in Sanders 1993; Vargas-Sanders & Sanchez 1995; Vargas
Central Mexican population distributions, settlement patterns Sanders et al. 1996).
and politi
cal and economic relationships (Sanders et al. 1979).
The ability to retrieve genetic information from ancient Recove1y of ancient DNA (aDNA)
bnes can
be used to solve the problem of the origin and
nugration of Mexican populations (Vargas-Sanders 1989; DNA extracted from a prehispanic bone was analysed by
Vargas
-Sanders et al. 1996). agarose gel electrophoresis. DNA isolated from archae
The co mbination of archaeological data and genetic results ological specimens is often contaminated and/or degraded
_
Will prov
ide a more complete picture in which biology into small fragments which interferes with the polymerase
----...

.
... "'" F & T. Biro, K. (eds.), Archaeopress -Archaeolingua, BAR- Centi: Ew: Se1: 1.
 A study of migration in Mexican prehispanic populations by DNA analysis
Sa/azw; C. Z., Arrellfn, R. & Vargas-Sanders, R.

CJ) Q) Q)
chain reaction (PCR) (Piiiibo et al. 1989; Akane et al. 1993; Genetic results reveal that Teopancazco and La Vi . -0 co
.....

Q) -
-0 -ro Q) en
c:
.....

enu Q) CJ) .c 0 co c:
& Salvo 1990), composed of Maillard products (Piiiibo
c: - - co -0 <(
Rogan bmials, wh ich represent the Classic period at T eot -0 Q)
:2
-
ih co c: .....
co
<( c: - c: ::J 0
-
.....

-
(.)
CJ) ::J
1989) or humic acids (Hagelberg & Clegg 1991), fulvic acid have two identical genes, while the other three are diftluacaii
.....
Q) .0 Q) Q)
t- CJ) ;:l c: 0 (.)
<( - Q) - -0 c:
erellt. -0 w
.....

a. CJ) - Q)

(.) CJ) '
(Tuross 1994) or the Heme group (Goodyear et al. 1994). But if we compare allele frequencies from the Cla j 0 a. Q)
ss CJ)
-ro :s: -
-0 Q) - -0 - CJ) .....

co Q) co
>- -0
Epiclassic from Teotihuacan burials there is no coincid
e Q)
.....
Q)
DNA extracted from prehispanic bone was cleaned using e <..?
-ro Q) - ::J - c: Q) ::J ::J ::J
::J
::J - -0 co Q)
CJ) co CJ) c: -0 -0
er
.0
various methods of agarose gel electrophoresis. Contemporary frequencies. However, similruities arise again in lJt 0
_..J
-0 co
>
(.) -0 (.) c:
-0
>
E
(.) (.)
-0 Q)
ro co
.0 .0
co
-
0 c: 0 ro CJ) Cl) c: '+- -
DNA was used in all cases as a control to test that the Postclassic in some genes such as GYPA and BB;;; 0 -0
- ::J Cl) -0 -0 Cl) co 0
::J c: 0
0 CJ) c: c: CJ) ro ..... c:
0.. Q)
Nevertheless, the Coyotlatelco and Mazapa phases wh c:
purification methodology did not interfere with amplification ic h 0 a. ro Q)
E
::J (.) -0
=
ro 0

0::: a.
c: Q) 0 0 Q) c: ::J -
and also as a negative control to show that there was no very close phases in time show more differences that tho
IJt c: Q)
E
a. x 0 c: ro
.....

E
0
-
.....
t- Cl) co a. .o
Q)
.....

z co (.) c: CJ) co c: co E
contamination during the extraction and purification methods. Classic and Epiclassic periods. E
CJ) Q) c: c: -
0 ro
co -
'+- .....

<(
.....
c: (.) 0 c: 0
E 2
.....
'+-

DNA was purified using the following two methods: (1) On the other hand, allele frequencies in Tula populatio 0 c: Q) .0 0
-
.....
c:
'+-
_..J Q) . CJ) Q) ..... ' Q)
ns <( - CJ) Q) >-
-0 co 0 Q) ..... co -0
- - Q) 3:
DNA recovery from NuSieve Agarose (Perkin Elmer Co). are different except in LDLR. ro
-
- - - - ro
()
.....
ro Q) c:
-
(.) 0
E
c: a..::: Q)
c: ro c: CJ) c:
E
::J ro
After performing electrophoresis on the aDNA in for If we accept the theory that people
coming fro o. c: c: ::J Q) a.
E
(/) 0 (.) Q)
Q) -ro c:
2
.....

lll >- (.) ro a. Q) -0 ..... CJ) .c ::J

E E E
ro Q) -0 co
separation of Gene Amp TM PCR Products (The Perkin Elmer Teotihuacan were the primary colonisers in the Coyotla tel :c 0 Q) - 0 -0
-
.....
Cl) c: Q)
c -
.....
.....
Cl) ::J 0 ()
.....
::J Q) c:
.....
0.. ::J 0 0 0 Q._ 3: Cl> ro -0
Co.) NuSieve agarose gel, the pigment-free portion of the gel pe1iod at Tula and compare the allele frequency in th e tw Q) co (.)
: co (.) ..... I (.) (.) .....

c-
.c -
was incubated for three minutes at 45C. An equal volume of populations we would expect slight differences between them. >- <') (.) CJ) - - Cl)
ro
>- CJ) Cl) -
- x c:
ro
>- CJ) - 0 - Cl
.....
ro ro Cl> Q) ro
phenol previously heated at 50C was added and the sample Neve11heless, results indicate an important change as can be
.....
- ro co Cl> Q) Q) ..... c:
(.) - -0 co Q) -
(.) -
.....
Q) CJ) Q) ..... c: Q) -
.c ..... -0
'+- .....

0
0 - c: (.) Q) ......
.c a. ro -0 c:
::J
CJ)
.....
Q)
.....
0
stirred until homogenised, and centrifuged for 10 minutes. observed in Table 2. Although the other theory is focused on ro -0 Q) .0
-
c: .0
.....
-
.....
Q) c: (.) .0 a. ro ro u)
a.
Cl) - - c: ro
-
ro
.....

Q) 0 ro 0 CJ) ::J
(..)
.....
Q)
Two successive phenol-chloroform and chloroform-isoamyl a northern origin for the early settlement at Tula, at this - Q)
(.) 0 ro
Cl) ro .c a. .c a. (.) -
c:
u er -o
a. c: 0
<( c: ..... Q) - 0 CJ) Q)
alcohol extractions were performed and precipitated with moment we do not have samples from that geographic region u) ro ro
E
0 ro Q) -0 Q) (.) -0 CJ) CJ)
t- Q) ro c:
(.) ro CJ) co
(.) .c Cl) .c c: c: Q) Q) -0
ethanol (Salazar 1995). (2) Electrolution into troughs. The to comprue these populations. <( .c
(.) c: co
c: -
.....

ro ::J ro
Q) ro ::J
.....
c: E (.)
E
0 -
Q) ::J CJ) -0 0...
E
.c CJ) - c: .c -
(.) Cl) co c: 0 E .o c:
method was employed as reported by Vargas-Sanders et al. One may also compare the genetic traits in two succesive _..J c:
Q) -ro
- Q) co
CJ) -0
Q)
Q) <.D 0
-
ro .._
E
ct
-
CJ) ..... CJ) Q)
<( .c .c .....

O'l
Mazapa -
:J c:
'+-
::J -0 - 0 c:
(1996). Once the aDNA was visualised on Agarose gel stained populations within in Tula: Coyotlatelco and Q) 0 -0
u
'+-
- -
() -0 3:Q._ 0 Q) ro c:
O'l c:
-ro
.....

Q)
E
Q) - a. 0 ro ro
3:
.....

E E
:::i

..-

with ethidium bromide and the UV light, a trough was cut (Table 2). In this case the LDLR gene showed the same ro
.....

<..? - ro >- Q) "ti

co >- Cl) Q) - -
0
c: (.) (.) Q)
. .
-0
0 Q)
-
(.) Q) Q)
(.) c: CJ) Q) Q) .Q
directly in front of the leading edge of aDNA and behind the pattern for both populations while the others were either c: Q)
E
c:
-0 E (..) Cl
.....
-ro ro (.) .....
O..s;:; co
Cl)- -
.....
_..J Q)
E

(..) Cl>
Q) c: ::J Q) co o Q)
-
w a. ro Q) - - -0 co c:
slightly or very different. 0
pigment, then the trough was filled with electrophoresis TBE c:

-0 0 CJ)
.....

::J CJ) Q) CJ)

<( -0 c:
.....

w
-a
ro 0 > - .....
-
(.)
Q.)
-ro (.) co
0 > 0 0 ro
::J
E
0 Cl)
lx buffer:glicerol (1:1). Every 2 or 3 minutes eluated fluid In general, we may say that the genetic frequency of the I 0 ro
(.) ..><: 0
-
(.) Cl) w - Q) (.) 0 -
Q)
-ro - 0 -0
(.) w -0 co
.....

a.i E
(..) 0 Cl>- -;;:; Cl) .c ro Q)
Cl)
ro
:
..... .....

.c c: c: CJ) 0
ui
::J 0 a. c: ::J
from the trough was recovered and then refilled with fresh same cultural group in the two sites are different. The genetic 0:::
.3 ui
::J
.....
..><:
0 ::J .c - ::J > ro co .0 .c
c:
.....
Cl)
<(
0
::J .c 0 ro
0 0 Q)

-
ro Q)
solution until all the pigment-free DNA was obtained. frequencies of the Teotihuacan and Tula populations change 0 - Q) - a - (.) >-
.....
c:
0 -0 - -
Cl .0 Cl)
-
-0 - N -0 Cl)
2
.0 0 c: Q) ro - (.)
2
..... - -
.....
E
-.c Q)
> - Q) ro ro
2
.c Q) Q) Cl) c:: ::J
Pigment free-DNA precipitated by ethanol, the pellet was with time. CJ)-
-
-0 .c > - - .q- O>f- co - x
.....
- Cl> ro (.) Q) > 0
x O'l
- :2
ro - Q) ::J
E
.I-
c: 0 0 o::: u I
:s:
(.) Q) (.) Q)
resuspended in sterilised distilled water and stored at -20C. T hese results suggest that it is possible to have more Q) ::J - (.) w Q) O'l
0
Q)
co c: 0 a. -0 -0 .c
c: ...... z
.... .

z 0 .0 ro ..... co
.....

information about the origin and migration routes in those

Amplification and typing times with the support of archaeological evidence and u 8 (..) 8 (..)
ro
0::: co ro co w
co
a.
physical anthropology traits. Ow (.) co w Cl a. o
Cl
(.) Cl - ro L{) co Cl co
Cl) L{) ro o N
Enzymatic amplifications were perfo1med in a 100 l 0 (/) CJ) CJ) Cl N co :;:= 0
...... co
co :;:= ro ' 0
0 :2
Cl)
0 <( ro ..-
reaction mixture contammg 40 l of AmplitypePM PCR References -I ro
(..)
'
Cl
0
>
0 :2
0
L{)
>
0
Cl'.'. Q._ (..) L{) 0 L{)
Reaction Mix and 40 l of Amplitype PM primer set of w <.D u
L{)
c:o
<.D () co
0...
AmpliTypePM PCR Amplification and Typing Kit (Perkin Akane, A., Shiono, H., Matsubara, K., Nakamura, H.,
Elmer-Cetus). Ancient DNA reactions were carried out in the Hasegawa, M. & Kagawa, M., 1993, Purification of E E
Cl) :::i :::i
presence of bovine serum albumin (160 g/ml) as described forensic specimens for the polymerase chain reaction _J ro ro :.... Q) Q)
Q) Q)
Cl) Cl) .....
<( ::J
.....

::J ro
by Hagelberg et al. (1991). (PCR) analysis, J. Forensic Sci. 38, 691-701. - 0 ..... ::J co
(..)
E E ::J
.....
c: (.) ::J
& Mason, I. J., 1994,
ro
Forty cycles of polymerase chain reactions were petformed Goodyear, P. D., MacLaughlin-Black, S. <..? Q) N
>
er
CJ) -0
er
CJ)
> co -0
c:
as follows: denaturation at 95C for 60 s, annealing at 57C A Reliable Method for the Removal of Co-Purifying O
w co
(.)
c:
Cl) c:
ro
>- ro
>-
ro ro ro
I-
.-1
_..J _J ro
- c:
for 1 min and extension at 72C for 1 min. PCR Inhibitors from Ancient DNA, Biotechniques 16(2), 0- 0 Q) c: Q)
w (/) - a.
.c
.....
.c .....
0 0 (.) co
Q) (.) co
Amplification products were analysed by gel electro 232-235. <( Q) 0 > c c:
.c
0 c: .
I
& ro
I- Q) (..) (..)
phoresis. Positive amplifications were hybridised as indicated Hagelberg, E. Clegg, J. B., 1991, Isolation and -ro -
- -

(.) .....
> (..) (ii -
:2 :2
,_

in the Perkin-Elmer-Cetus manual. characterization of DNA from archaeological bone, Cl'.'. ro co

<( co u

Pmc. R. Soc. Land. B 244, 45-50.

CJ)
Results and discussion Hagelberg, E., Grey, I. & Jeffreys, A. J., 1991,
C.
Cl)
Q)

Identification of Skeletal Remains of a Murder Victim by

co -0
Q) Q)
ro -0 .....

c: Q) ro
The results display a similar archaeological context between DNA Analysis, Nature 352, 427-429.
.....

Q) co Q._
""
.....

& Freter, A. C., 1996, Dating Results

.....
N co
O'l .0
Cl
Teotihuacan and Tula populations, a fact also supported by: Manzanilla, L., Lopez, C. ro
O'l ro
c:
ro
0.. co
(.)
from Excavations in Quarry Tunnels Behind the Pyramid (.) :2
0 ro c:
ceramics, offe1ings, burial patterns and architectonic styles '
..- (..) ro
(.)
ro
- ro
(Table 1). of the Sun at Teotihuacan, Ancient Mesoamerica 7, I- N c:
O'l Q)
N
ro co
::J c: :::l-
I- co
(..)
O'l .0 (.) -0
t- -
245-266, Cambridge University Press. 0
>-
The Physical Anthropology studies indicate similar patterns w ::J c: c:
-
co
-, co
..-

& Robert, H. C., in press, La cultura
.0
in morphological and metrical traits and cultural body Mastache, A. G., 0
ro 0::: a. _..J Cl) >-
-o
"Q'.O

Cl'.'. = >- 0 >-
Q) .0
modifications such as cranial deformation with two modalities Coyotlatelco en el area de Tula, in Las industrias lfticas Q._
:;::::; .c
c:
..... -0
0.. (.)
0... Q)
I-
de Q) -0 -0 - Q)
found in Coyotlatelco and Mazapa phases (Table 1). Coyotlatelco en el area de Tula, Instituto Nacional
>- Q)
2 (.)
Q)
.....

The allele frequencies for Low Density Lipoprotein Antropologia e Historia, Colecci6n Cientffica. ro
(.) (.) ..... 0
Q) Q)
_J 0
Piiabo, S., 1989, Ancient DNA: Extraction, Characterisation,
.....

Receptor (LDLR), Glycoph01yn A (GYPA), Haemoglobin g g 0 0 0

0
globin (HBGG), D7S8 and Group Specific Component (GC) Molecular Cloning and Enzymatic Amplification, p,vc.
were obtained by typing the different prehispanic populations. Natl. Acad. Sci. USA. 86, 1939-1943.

57
56
 Arrellfn, R. & Vargas-Sanders, R.
Salazai; C. Z.,

ESTRONTIUM
HBGG D7S8 GC EOD IE TA RY APPLICATIONS OF
GYPA =
pAL N SITE
Period or phase
LDLR
- IM AL BONES FRO M THE TEOTIHUACA
A=O
-
A=0.5 A 0 A= 1 A=0.5
ND ZJNC IN AN
G.1
ADEZ, R . .' & ZARAZUA,
Teotihuacan Classic A
B= 1.0 B=0 B=0
MANZANILLA, L..' VAL
B= 0.5
(Teopancazco) B=O '
JEDA, s.,
TE
C= 0.5
luca,
Nuclem; Can: Mexico-To
A=0.5 A= 1.0 A=0 iones Nucleares, Centro
Nacional de !nvestigac
A=0.5
A=0.5 1 Instituto
Teotihuacan Classic (La nes Antropol6gicas,
B= 0.5 B=0.5 B=0 B= 1.0 2Instituto de Investigacio
xico, D.F.
Ventilla) B=0.5
Me xico , Ciu dad Universitaria, 04510 Me
Nacional Aut6noma de
Universidad
C= 0

A= 0.37 A=0.25 A=0.28 A=0.2141

nce. Strontium and barium

Teotihuacan Coyotlatelco A= 0.83
B= 0.625 B=0.75 B=0.85 B= 0. 3571
bon es at levels that rel f ect its dietary abunda . .
B= 0.16 inco rpo rate d in . ause its d 1etary
(Varillas y Pirul) and barium are . . n Analogous models can be used for zmc, bec
C= 0.4286 m , zm c . . . . pos ltlo .
Stro ntiu as indicators of tropluc . . acan animal and

bone can be used .

.
. tihu
.
ratio ns in . wn of the data from Teo
A=0.5 A=0 nc e nt the bon es of growmg animals. Evaluat . es,
;+r. ent tropic l evel, meludmg Iier b'1.vor
A=0.5 in
A=0.5 c o concentratio ns fi
J ' t zinc
n a,ffec . .+
111 a variety OJ species rom
d IJJer

A= 1.0 J

levels ca
Teotihuacan Mazapa d ca lcLUm
m zinc an n valu es

barium' strontiu ' in mea

es show slight differences
B=0.5 B=0.66

B=0.5

8=0.5
bones O'Jt/1e barium and strontium valu
h uman
(Varillas y Pirul) B= 0 reve als that
as hum ans
C= 0.33 . es and ca rnivores' as well
omnivo r

A= 0.43 A=0.57 A=0.23 s.

for specie
A=0.6
A=0.5
R ADIUM.
O, STRONTIUM, ZINC,
Tula Coyotlatelco
S: PALEODIETARY, MEXIC
B= 0.4 B=0.57 B=0.43 B= 0.41
B= 0.5 KEYWORD
tified
between species can be iden
C=0.36
diet such as the differences
A= 0.5
A=0.75 A=0.13 A= 1.0 A=0.375
Introduction (Burton & Price 1990). th
calcium, is an alkaline-ear
Tula Mazapa
Barium, like strontium and
B= 0.25 B=0.87 B=0.0 B=0.5
of bon e.
into the mineral fraction
B=0.5
Basin of Mexico
C=0. 125 Wild fauna in the element and is incorporated
um and
demonstrated that both bari
great Elias et al. (1982) clearly
central Mexico is its bone at levels that reflect
their
A striking feature of strontium are retained in
Te otihuacan and Tula populations. the environment of ially
Table 2. Allele
freque n cy from rsity that is reflected in both elements are prefe
rent
environment dive dietary inputs and that
9) wh ich was occupied trac t rath er
xico (Sanders et al. 197 ium, from the dietary
Ancient Vargas-Sanders, R., 1989, Material Genetico de Restos 6seos the Basin of Me rsity was eliminated, relative to calc
Paabo, S., Higuchi, R. G. & Wilson, A. C., 1989, of vertebrates. This dive tissues. Thus animals hav e low er
Humanos, Infomiaci6n Cientifica y Tecnol6gica""' II by about 540 species region. than absorbed into body
Biol. Chem. mas s exis ting in the ts that they
action, J. ety of bio the ratios of the plan
DN A and the Polymerase Chain Re supported by a wide vari
'

19-21. species. Ba/ Ca and Sr/Ca ratios than

ted by a little more than 50 ently have lower ratios than
2 64, 9709-9712. Vargas-Sanders, R., 1993, De Los Esqueletos a /a Doble The reptiles were represen consume, and carnivore s con sequ
en Tula pois ono us.
Paredes, G. B. L., 1990, Unidades Habitacionales Some of them were snakes
and 8 wer e
e 1990).
co. Helice: Hacia un Estudio de Paleoantropologfa ent had herbivores (Burton & Pric
Hidalgo, in Colecci6n Cientifi.ca 2 10, IN
A H, Mexi
ies dive rsity in the Teotihuacan environm odietary indicator, Ezzo (199
4)
of Molecular, unpubl. Ph.D. thesis, Universidad Nacional The spec
rela tion ships Zinc has also been as pale
a
Stylistic Study in thei r trop hic
ary levels of zinc can
affe ct zinc
Rat tray, E. C., 1966, An Archaeological and Aut6noma de Mexico. particular characteristics has mentioned that diet
pied the valley. These
l.
s 7-8, 87-2l es of growing animals.
Diets
Coyotlatelco Pottery, Mesoamerica n Note Vargas-Sanders, R. & Sanchez, A. R., 1995, Material between populations that occu concentrations in the bon
ic acids isol
ated assess throught dietary leve ls in
Rog an, P. K. & Salvo, J., 1990, Study of nucle relationships are possible to zinc have led to reduced
Genetico de Restos 6seos, in Lopez-Alonso, S. & marginal or deficient in
tion occupied for each ng
33,
. pol posi cy duri
reconstruction and the trophic es, severe zinc deficien
A n thro .
from ancient remains, Yearbook Phys ?
R m s R. Ma., (eds.), studios de Antropolog(a bones and various soft tissu
osed by different authors elop men t is
: specie by using the model prop , bone growth and dev
195-214. s en B10log1ca; V, 219-242, Instituto de Investigaciones
1995; Fomaciari & growth can lead to dwarfism
S alazar, Es tudios Mole culare (Burton & Price 1989; Farnum et al.
zinc.
C. M. M. Z., 1995, s, Antropol6gicas: Universidad Nacional Aut6nom a de clearly affected by lack of Las
as Y Actuate Mallegri 1987; Elias 1982 and others ). e collected principally from
Pobl aciones Mexicanas Prehisp611ic Mexico/ Insituto Nacional de Antropologfa e Historia1 The animal samples wer
al Aut6no ma de sun , and
p rofessional thesis, Universidad Nacion behind the pyramid of the
Mexico, D. F. in animal bone Varillas and El Pirul caves s.
hua lco site
Identification of Sr/Ca, Zn/Ca y Ba/ Ca La Ventilla and Oxtoya
Mexico.
R., 1979 Vargas-Sanders, R., Salazar, Z. & Enriquez, Ma. C., 1996, the human bones from the ber
S anders, W., T, Jeffrey, T., Parsons, R. & Santley, remains e found in the funerary cham
e Ancient Nucleic Acids in Prehispanic Mexican Thirteen burials in all wer
The Basin of Mexico: Ecol ogical
Process .in t the modem occupation and
the
Populations, in Oma, M. V., (ed.), Archaelogical of this varillas cave, ben eath
Press, Umversity Strontium is one of important paleonutrition
most als had complete and ritua
lly kille d
Evolution of a Civilisation, Acade mic Chemistry: Organic, Inorganic and Biochemica
l
Aztec floors. All of the buri
parameters, because it is present in large amounts in plants, as offe ring s.
some projectile points
pottery vessels, as well as
Park. A nalysis, 391-400, ACS Symposium Series 625,
ent DNA in
bo e,
whic h is almost elective for e found
Turo ss, N., 1994, Biochemistry of anci
n
American Chemical Society, Washington, DC.
and is characterized by a trophism
The cueva del Piru l was the last excavated, we hav
the bone tissue; 99% of strontium in the body is present in the betw een
Aztec material that date
Experientia 50, 530-535.
There are in large another 14 burials under the al
bones, and only 1% in soft tissu es. with anim
turies AD, associated
but not in the bones the sixth and ninth cen
quantities in the skeletons of herb ivore s,
bones (Manzanilla et al. 199
6).
of carnivores (Fomaciari & Mallegri 1987).
rchers
The Sr discrimination model relied on by most resea
uses differences in Sr levels to dif ferentiate the dietary
Analytical procedure
contributions from plants and animals. The model is based on analysis, the cortex and
porous
To prepare bones for
the observation that Sr concentration in bone is inversely sive grin ding,
was removed by abra
internal part of each bone
p roportional to that organism's position in the food chain r tables. The
ion in inner and oute
to eliminate soil contaminat lied
<Farnum et al. 1995). y was app
dispersive spectroscop
barium microanalysis by energy
Several archaeological studies have observed that contamination in bon es. Elem enta l
and strontium appears to be good paleodietary indicators of to identified soil particle EDS
usin g
and Al were determined
trophic position. We have examined this potential of barium distribution of Ca, P, Si
tron ic Microscope (Fig. 1).
as a pa leo barium not only from a Scanning Elec mylar
dietary indicator and found that ground bone were put in
ic position, but Samples of about 2 g of
responds
at least as well as stron tiUm to troph ctly ana lysed
nd samples were dire
that by other aspects of sample holders. The grou
examining both strontium and barium,
ress -Archaeolingua, BAR - Ce1111; Ew: Sei: 1.
Archaeometl)', Jerem, E. & T. Bir6, K. (eds.), Archaeop
Proceedings of
the 31" International Symposium 011
58
 Tejeda, S., Manzanilla, L., Valadez, R. & 'Zaraziia, G. Paleodietary applications of estrontium and zinc in animal bones from T eotihuacan site

ELEMENTAL DISTRIBUTION
La Ventilla human bone
TEOTIHUACAN SITE
40 r-....--
35 .
.
,.O

,. 0 Ca/ -1,5
.. a
'C.
- h.-. Si

- 30 .

p. ... ...
a
.. - a --<>-P . I -2
RABrTWEA

25 -e--AI ST
;::: ' RABBIT
/:r. -' - cG -2,5 CACOMIXL
r- sBrr.
20
OOG
'
HUMAN HUMAN SKUNK.
f-
z ,,
- - / (.)
HUMAN HUMAN
{:>--
15 ,\ -


-- --

/ ...
' -3
z ' /
HUMA.N

0 / "' CANNIS

I

u 10 \ /
'i
'
\ /
/
(.!)
5 .
/ 0 -3,5
..J
4,45 30,1 80,1 180,1 1801 1951,1 1960 -4
DISTANCE (microns)

-4,5
Fig. 1. Elemental distribution of Si, Ca, P and Al in a section of human bone from La Ventilla.
SPECIES
- rescence. The Si(Li) detector used for collecting Results and discussion
by X ray fluo . Fig. 2. Log Sr/Ca values for species from Teotihuacan site.
fonnat10n from the sample has an active area of
the spectr al i n
80 rnm2, an FW
HM of 160 eV at 5.9 KeV and a bias voltage The E l 9PER, ZENT7 and E93COM samples show high
v. Samples were exposed to primary radiation from the concentratJ.ons of rron that means soil particles inclusion.
Of 900 .
238P u sources. An acquisition time of l000 s (live (Table 1). The data of potasmm concentration are simil arm TEOTIHUACAN SITE
l 09Cd and
d to fluoresce the samples and standardize. Data g de, w1c
h means a few differences in ionic exchange and
time) wa s use

w done using AXIL (analysis of x-ray spectra by ______.,

reduction as
li:civiatJ.on p ocesses between soil and bones. Table 1 sho w s the
-1,5 _____..._________...
-square fitting, (Valdes & Jaramillo 1994), an Fe and K concentrations for the
iterative least differences m El19PER'
rogram of modular soft ware system QSAX OZENT7, E93COM and E185CAC samples. -2
individua l p
ray analysis system) supplied by the IAEA. Sr, The concentration values obtained prove to be useful for
(quantita tive x- ns
w ere monitored as potential dietary indicators, and paleodietary reconstructions of models, these values have to be 0
-2,5 SKUNK CACOMIXL
Ba and Zn - HUrMN
K as potential indicators of diagenetism (Burton & used only as Sr/Ca, Zn/Ca and Ba/Ca ratios (Table 2). Figs 2 and c
11 ,
HUrMN DOG
Fe and
9
98 ) . Analytical accuracy and reproducibility were 3 sh? w the Sr/Ca and Zn/Ca ratios, respectively, in between
N -3 1vll"'\'N
Huu RABBin.ssrr WEAST
Price 1 C> HUrMN itA srr OPPOSUM c..;p.
.
monitored by inc
luding a sample of a IAEA H-5 animal bone species are very closed, which can be indicative of low resournes 0 -3,5 HUrMN NNI
..J

in semiarid environmental like that in the valley of Teotihuacan.
standard. NNIS
-4
_____
__.
CONTEXT SAMPLE ESPECIES Fe d.e.% K d.e.% -4,5 ...___________
-
ozrovAH OZENTG HUMAN 375.1 3.5 789.9 3.8 SPECIES

ozroYAH OZENT7 HUMAN 1223.8 3.5 763.9 9.4 Fig. 3. Log Zn/Ca values for species from the Teotihuacan site.
ozrovAH OZENT8 HUMAN 652.9 5.1 692.9 4.8
ozrovAH OZENT14 HUMAN 778.7 16.6 646.2 12.5
Acknowledgements
VENTILLA E08VE HUMAN 244.4 3.5 1433.4 3.5 Conclusion

VENTILLA E23VE HUMAN 140.7 18.9 1549.3 15.0 acknow ledge support from
The authors gratefully
Evaluation of the data from Teotihuacan animal and human
VENTILLA E27VE HUMAN 180.3 15.6 1643.3 6.9 Materials Depart ment of Nuclear Resear ch Nation al
bones of barium, strontium, zinc and calcium in a variety of
Carapia
V ENTILLA E31VE HUMAN 109.4 4 1783.3 3.5 species from different tropic levels, including herbivores, Institut e. We also thank J. Francis co Cruz, Leticia
analysing
omnivores and carnivores, as well as humans reveals that and Thelma Falcon for help with prepari ng and
CAVES ACVE1 RABBIT 629.5 4.2 1307.7 13.9
barium and strontium values show slight differences in mean samples.
CAVES ACPAP1 RABBIT 982.6 3.5 618.2 7.1
values for species. Thus herbivores have closer Sr/Ca ratios
-
CAVES ACVN4 RABBIT 613.4 3.5 569.9 10.8 than the ratios for carnivores. References
CAVES ACVE1 RABBIT 693.1 3.6 602.8 3.5 The examination of thirty archaeological samples from
Teotihuacan site confirms the closed model for this Burton, J. H. & Price T. D., 1989, The Ratio of Barium to
CAVES E9ZO SKUNK 490.0 3.5 n.d. ption of
environment. Strotiu m as a Paleod itary Indicat or of Consum
CAVES E93COM WEAST 1400.0 70.0 4500.0 675.0 17,
In the Sr and Zn data, there are significant differences Mmine Resources, Journal of Archaelogical Science
CAVES E77TLA OPPOSUM 180.0 3.5 n.d. according to species, and the human values are clearly more 547-557.
CAVES E185CAC CACOMIXL 450.0 23.0 4500.0 675.0 similar to carnivore values that to herbivores values, Bmton, J. H. & Price, T. D., 1990, Archaeometry, Birkhauser
- consistent with the variety of food resources of the diet. Verlag Basel, 787-785.
CAVES E2CAN CANNIS 177.6 4.6 1012.4 9.2
Burton, J. H. & Wright, L. E., 1995, Nonlinearity in the
Although trace element studies focused primarily on
CAVES E119PER DOG 2621.0 33.4 789.3 78.2
- trontium and barium, zinc is also a valuable paleodietary Relationship Between Bone Sr/Ca and Diet, American
-
CAVES E862BCA CANNIS 320.0 4.0 n.d. Indicator. The use of bmium, strontium and zinc permits not Journal of Physical Antropology 93, 273-281.

CAVES E85CAN CANNIS 320.0 4.0 n.d. only the Ezzo, A. J., 1994, Zinc as a paleodietary indicator: An issue of
- identification of the trophic position, but also stretch
differences for species in semimid environments like theoretical validity in bone chemistry analysis, American

Teotihuac Antiquity 59(4), 606-621.

Table 1. Fe and K values from analyses of Teotihuacan animal and human bones. an.

61
60
 ,
Tejeda, S., Manzanilla
' L. ' Valadez R & Za razua, G.

T PROTEINS
IC A TION OF A NCIEN
IDEN TIF NTECUHTLI
ESPECIES LOG Zn/Ca LOG
Ba/Ca
S CUL P TU RE OF MICTLA
IC
H UMAN
ROM A CERAM MEXICO
PLO MAYOR,
-3.57015361 -2.44521488
F AT THE TEM
HUMAN 2- .91584917 -3.38421398 -2.58258164 D.'
MARTiNE Z, R.
R.,1 OR TIZ DiAZ, E.1 &
HUMA N -2.98517409 -3.26126287 -2.76066052 DERS,
S-SAN
ARGA co C. 04510, D.F.
MEXICO,
HUMAN -2.96165394 -2.8760585 -2.40395804 V ma de Mbcico, Mbci ;
Nacional AWOno x1Ca,
ntrop ol6 gic
' Univ.,,idad ndad Nacwnal Autmwma de Me
HUMAN 3- .08801512 n.d. gadane> A
Fac ultod de Med<Cma, Um ver
. to de 1,,.,.,ti a Expenmental, .
- ento de Medicin C.P. 04510.D.F.,
MEXICO
HUMAN -3.05833551 n.d 1,,,nwzp a
epart '" Me xico
,

n.d
,,tanding t/1
approach to unde
n.d gical mata ia1' off"' a new
nd on diffmnt m
chae olo hemical and
nt pmtein' fou re,ul1' of the bioc
cie will pre ,.nt the
RABBI n.d . c
ifi ation
of an
cted i' haemoglo
bin. Thi' papa
in Mexico C ity.
This wamic
fheiden the protein' that can dete ulp ture fou nd at the Templo Ma yo' re,.nted
RABBI n.d f out on a ceramic " w ith blood, o' rep
at we carded monie>, wa' covered
RABBIT
a
p O o<
o
c l an
o l y'i' th
ath, Mictlantecu htli
who, in ritu al cere
tein' on the figu re,
but to al'o
1mman a God of De the prmnce of pro
n.d
:;
e
at, t /1 M .x ic
objective of our. "
"arch i' not onl
y to deten
.
n ine
is human or not.
RABBIT 2- .42597903 n.d figuMe r argliabechi codex The . niq ues, whether the blood
che nu cal tech
the immuno
SKUNK -2.7679898 -2.88401611 -3.38916608 ify' by JEF and
1.d ent1 CUHTLI, BLOOD,
URE , MICTLANTE
WEAST 2- .49840498 -3.2155998 O RD S: CER AMIC, SCULPT
KEYW IEF, IMMUN OCH
EMI CAL .
HAEMOGLOBIN,
OPPOSUM -2.22051 raphic, biochemic
al,
hemastix, crystallog
periments including
CA COMIXL -3.62324929 h et al. 197l a, 197l b;

00;;85;801I Introdu ction studies (Sensanbaug

and immunochemical et al.
CAN n.dr===lF==-2.4 et al. 1985; Heir
ein 1985; Ascenzi
Loy 1983 ; Lowenst al.
direc ted tow ard
man & Juli g 1989; Hyland et
DOG -2.87421505 ntie s, m any studies have been 9; Loy & Wood 1989; New ton
ev e al 198 al. 1993; Re ming
Sin ce the s from archaeologic 1992; Newman et.
CAN protein remains 199 ; Loy & Hardy
0
3- .01179152 -3.87312 sis of blood se ex- these works have
the an aly tools ; the 5). Most of
arti cular interest in lithic 199 4 ; Tur oss & Dillehay 199 eins,
CAN n.d mat erial, with p identify blood prot
ways to obtain and
proposed different of the
moglobin, one
emphasis on hae
. with particular
no method for ide
ntify ing
Table 2. Log Sr/Ca Zn/Ca, Ba/Ca data fi
mm Tceot1huacan animal and h uman bones. . So far, however,
compounds in blood
,

of
and the reproducibility
become standard,
blood proteins has
klin 1988; Smith &
Wils on
(Gurfinkel & Fran
.
Glascock, M. D.: Sand ord, M. K., Gerritsen, Sanders, W., Parsons, J. & Santley, R " 1979, The Basm of
. the methods is low
1992; Kooyman
et al. 1992; Man
ning 1994 ; Down
s &
of
J F. . n, soil conditio ns
Farnum El m ent s m Ancient Human Bone and Mexico ' Stud'ies in Archeology, Academic Press, Fiedel 1996 ). Ofte
.

,
S ., 1 99
5, Trac e Lowenstein 1995; idity ,

s g ourn al of Radioanalytical - perature and hum

Soi l U m NAA, J -
221 293. xts, such as tem
Assoc i a ted . archaeological conte
1
)' 96, 267 2 74. Sillen, A ., Sealy' J. c. & van der Menne' J., 1989, Chenu stry
Che111est1 destroy protein rem
ains.
and N uc tear .
7

ogical preservatio
n,
F., 198 , P aleonutritional studies and pa1eodi etary research . N ore easy ans wers, nature of archaeol
. . G & Mallegm,
Fomacian, .
s
.
of anci e nt p op ulation from the q t
American Anti ui y 54(3) , 5 4 0 -
; To unde rsta nd the
attempt to sim ulate
en uu n l . al models that
l some experiment

k le ta r - &
on s e t . Anz. 4, 361 3 70. Q rition dev eloping (Gurfinkel
ean ar ea, An ro
Sutton, M 1994
' I ndi rect Evidence in Paleonut exts have been
Mediterran
.11 L . , 199 ,
G
4 eografta Sagrada Inframundo en
e The vzet and Health of P rehistoric Americans
Studi s
archaeological cont
yman et al. 1992;
Cattaneo et. al. 19 93;

22, 99_'194.
Franklin 1988, Koo it

, . 199 6 ). Obv iously,
M anzaru a , 11. Instituto de In - et. al.
11tropo/0 1 s N.
a al. 1995 ; Tuross
Teot h i ua can, A Varg as-Sanders et dep ositi on
lo as
t opo i , Universidad Nacional Valdes, F. M. & Jaramillo' A ' M., 1994, Sistema para el laboratory the
reproduce in the
ve stigaciones An - . is impossible to
ns of preservation
with
exico, 53 6 5. andlisis por fl uorescencza de rayos x Manual de!
e Me ico, M
x fy the conditio
ntro de Estudios al Desarrolio Nuclear, La
ono m a d . process and speci ess ary to

::Ca, 76p.
Aut11 o ez. C. & Freter, A. C.' 1996, Oat 1ng ' s, it is nec
U to these problem
L. L p . . precision. Added s from
M anzaru a, , difficult to recover
protein remain
vauons m Qu Tunn els behind the H
t Exca consider that it is d
Resul s h e S un At T eot lhuacan, Ancient Meso- Valadez, A. R., 1992' Imp acto de! Recurso Faunfstico en la ic tools, espe ciall y those manufacture
t
i of . cert ain kinds of lith
P yra m d
sile x.
Sociedad Tceot111uacana' UNAM Facultad de Ci encias obsidian and
. a 7 245-266. glasses such as
. out of volcanic rtunity to obtain
amenc oppo
l., !991, Reconstruction .of Anasazi
.

Diet, in Divisio'n d e E stu di os de Posgrad o, Tes1s doctorado. premise, and the

. L et a . Considering this Mayor

M artm, D. A azas1 Hea 1th C ap. 3Il lin01s University, Pp Wing' E & B rown' E " 1979' Reconstructton of preh is to ric m the Templo
.

mic sculpture fr o
esa n . . samples of a cera s. In
Black M
ain
d iet, N utnents and 00d m Paleonutrition, Academic cient protein rem
tried to recover an

excavations, we the
'

63-70. u ynh. V. H., 1996, App lication of EDXRF P ress, pp. 5, 6, 4 4. two advantages:
firs t, the porosity
of
T H &H .
Nguyen, . nni at10 l ead and O ther Trace Elements in
this case we have
refe rred to as havi
ng gone
n n of mate rial and, seco
nd, this figure is
t o the dete . l the Magli abechi
Codex
fluids of Ind ustna W orkers in Vietnam, X- shower of blood in
the BJOdy 4 through a ritual
- 1 .
)' 25, 3
ctlvmeti (Lopez 1995).
ray Spe
context
Archaeological
Mictlantecuhtli: n
of preservatio
and conditions
the foundation of
Mexicas begins with
The history of the ntown
present-day dow
1325 on the site of
Tenochtitlan in AD red an area
, the city cove
1). Built on a lake
Mexico City (Fig.
Fig. 1.

62
 Sanders, R. V., Ortiz Dfaz, E. & Martinez, R. D. the Temp/a Mayo1; Mexico
ion 0r ancient proteins from a ceramic sculpture of Mictlanternhtli at
Iden.11;!;cat
1

Fig. 4.

Sample gr/ml Total gr. group in the presence of HP2, the evidence being the
Fig. 2.
oxidation of a colourless diaminobenzide to a coloured
PBS
Back+PBS (1) 7,000 350 diaminobenzidine. The results of human haemoglobin from
of four quare mile. In one of the most impressive buildings
6,600 330 archaeological samples after IEF 3-9. In this case, only three
of Mxico-Tenochtitlan - La Casa de las Aguilas two Back+PBS (2)
Fig. 3. 1,600 80 bands were stained, corresponding to the different
_

ceramic sculptures of the Mexica God of D th Left shoulder

Mictlatecuhtli, were found (Fig. 2). The sculptures fla e :d
the mam enrance of the north wing; both stood on stuccoed
benches facmg south (Lopez & Mercado 1996) (Fig. 3).
The archaeological contexts of these buildings were almost
. PhastSystm
unouched smce ca. AD 1489, when the Mexicas decided to
bmld another structure over it. Prior to this, they celebrated a
complex ceremony which included a ritual where the
sculptue were showered with human blood (Idem).
Humidity in the area of the find was 80%; both sculptures
were frgmented in tiny pieces, consequently the process of
excavat10n . was slow and careful (Idem). As soon as the
archaeologists observed an unusual maroon layer on the neck
back, and shoulders of one of the sculptures, they immediate!
.
; Preparation of polyclonal antibodies to human hemoglobin
called us m to take samples with the purpose of determining
whether the material was blood or not.
Methodology
To take the samples, we scratched the maroon layer off the
left shoulder, neck, and back, and, as a control ' we took
samples of the pigment on the body.
Protein isolation
Seven samples put in an eppendorf tube of 1OO l and
. . 50 l of PBS buffer. Two samples put in an
diluted m
eppendorf tube of 100 l and diluted in 50 l of distilled
water. They were all concentrated in a vacuum concentrator '
assayed for protein (Lowry et al . 1951), and stored at -20oc.
Isoelectric Focusing Electrophoresis (JFE)
The archalogical protein samples, were applied to IFE
electrophoresis. The phast gel IEF 3.9
r aia) was put on a PhastSytem apparatus (Pharmacia
) with Program 4 (IEF pH 6-8). Samples applied about
3-5 ml onto every pit of the mold and transferred to an 8 row
comb. Electrophoresis was carried out as recomm ded by
en
manufacturers. After electrophoresis the gels were stained by
.
Coo masie blue and the haemoglobin detected with Diamino
benzidine (McDonnel & Staehelin 1981).
Electrophoresis of hemolyzate on agarose gel was perfonned
.
usm he standard procedure. The haemoglobin band was cut
and Injected with Freund complet adyuvant subcuta eosly and
n results (Fig. 4) show 4 bands. Two of them were identified as
then heoglobi alone was applied weekly 4 times more. A
booster mtrapentoneal injection was given in the sixth week
and rabbits were bled in the seventh week in order to obtain the
polyclonal antibodies against human haemoglobin
. erythrocytes. The rest of the bands could be haemoglobin
Also, w made an immunoelectrophoresis test; using the
arcaheological samples with rabbit, rat, and human haeorno
globin reveal with anti-HbH.
Results
1) Te results of protein determination showed that proteins
stored m the PBS buffer preserved better than the ones diluted
300
Left shoulder+
PBS
6,000
Neck 10,000 500
Pigment 0 0
in distilled water; and, finally, the control sample of pigment
does not contain proteins (see table above).
2) The next step was applying human haemoglobin (HbH)
and archaeological samples to a phast gel Electrofocusig
electrophoresis (IEF) IEF 3-9 (Pharmacia); afterwards, it was
put on a PhastSytem apparatus (Pharmacia LKB) with
Program 4 (IEF pH 6-8).
Isoelectric electrofocusing can be used for the deter
mination of protein pmity and microhetorogeneity. The
protein recovered from samples and marker (Sigma Co. ) were
run with a standard IEF gel using ampholine pH 3.5-9.5. The
haemoglobin by its characteristic isoelectric point (Ip) 6.8.
The others bands show Ip 6.6 and Ip 5.9, belonging to
Carbonic anhidrase I and Carbonic anhidrase II, from human
Variants. IEF has a much higher resolving power and the
presence of minor quantities of protein can be easily detected,
be.tw een 0.78-60 g per lane. The average sensitivity limit of
this techn
ique is estimated to be approximately 20-30 ng of
pr otein per band,
as reported in the Phast System Pharmacia
LKB Biotechnology manual.
3) Haeme group is major constituent of haemoglobin; its
d etectio
n was based on the peroxidase activity of haeme
haemoglobin subunits (results not shown).
The immunoelectrophoresis test had a positive result only
with the HbH.
Discussion and perspectivites
The positive results determined by biochemical and
immunochemical analyses from the Mexica's God of Death
give us some points to consider: At first, there was a
concordance between the IEF and immunological
conclusions; in both cases we could identify that the maroon
layer was human blood, as had been suggested by the
historical sources (Fig. 5). The excellent preservation of
organic materials, careful excavation, and taking samples
quickly, allowed the Mictlantecuhtli to stand out as an
example on how to go about the study of ancient proteins.
In the near future, we will apply these samples to a
Western Blot, for a major precision of our results; even, we
would like to apply this methodology on lithic tools from the
Templo Mayor (especially those related with the ritual
sacrifices); and to other ceramic pieces but from other
archaeological context.
Acknowledgements
We want to thank to archaeologist Leonardo Lopez Lujan,
from the Templo Mayor Museum for his invitation to
participate in the analysis of this extraordinary figure. We also
thanks to Dr. Paul Schmidt who helped us with the translation
of this work.

64 65
 Sanders, R. V., Ortiz Diaz, E. &
Martinez, R. D.
2. Dating

Low nstein, J: M., 198

5, Molecular app
_ roaches
1dent1fi cat10n of species, Am. Sci. to
73, 541_5 47
(ELECTRON SPIN RESONANCE) DATING THE PALEOLI THIC SI TE
the SR
Lowry, 0. H., Ros enbroug .
h N. J. Farr A L E
J., 1951, Protem measure
. ' '
& Ran dall, AT TSAGAAN AGUI, MONGOLIA
ment with the F Ii
'

0 n .
reagent, J. Biol. Chem. 193
, 265-2?5. Phenot
Loy, T. H., 1983, Prehist
oric blood residues <let BLACKW ELL, B. A. B.,1 OLSEN, J. W.,2 DEREVIANKO, A. P.,3
. . ect'ion on
surfaces and identific ation of species of ori . . toot TSEVEENDORJ, D.,4 SKINNER, A. F. R.1 & DWYER, M., 5
g ,
200, 269-271. m Science
Loy, '!" 1 Dept of Chemist!y, Williams College, Williamstown, MA, 01267, USA,
H. & Wood, A. R., 1989,
Blood residues
aayonii Tepesi, Turkey, J.
Field Archaeol. 16
an 1 .
45

1s at bonnie.a.b.blackwell@williams.edu, anne.1:skinner@williams.edu,
Loy, T. H. & Hardy, B. 60 2Department of Anthropology, University of Arizana, Tucson, AZ, 85721-0030, USA, olsenj@u.arizona.edu
L., 1992, Blood resid
e an a1 : 3/nstitute of Archaeology and Ethnography, Russian Academy of Sciences, Siberian Branch,
Ys1s
90,000-year-old stone tool
s from Tabun Cav
e, Israel Novosibirsk, Siberia, 630090, Russiavolkova@archaeology.nsc.ru,
Antiquity 66, 24--35.
Manning, AP., 1994, A caut 4Archaeological Sectm; Institute of History, Mongolian Academy of Sciences,
ionary note on the use of
hematix Ulaanbaatm; Mongolia, ganbold@magicnet.mn,
detection and confinn . and
dot blot assays for the
. ation 5Townsend Harris Highschool, Flushing, NY, 11367, USA
archaeo1ogica1 blood residue
s, J Archaeol. Sci. 21,
of
McDonnel, A & Staehe 159 -1
lin, A, 1981, Detection
chrome f, a c-Class Cytoch
rome, with Diaminobe
of C
Y

. .
m po1yacry1amide gels, Ana nz1.din. e T sagaan Agui Cave lies south of the Gobi Altai massif. Sedimentmy fill includes intercalated loess, sand, and clay units, with
l. Biochem. 117, 40-4
4.
Newma , M. E. & Julig, P.,
? 1989, Protein residues some soil horizons, as well as ironstone concretions, gypsum, eboulis, alluvial, terra rosa, and gravel beds in deeper layers. In
on litltic
artifacts from stratified bore Test Pit 2, Stratum 3 contained Levallois-like points, whereas Strata 4 and 5 had flakes and burin-like tools, among other
al forest site' Cana
d"zan J. artefacts. Deeper layers yielded retouched flakes, burins, notched tools, and scrapers. ESR was used to date seven subsamples
Archaeol. 13, 119-132.
Newman, M. E., Yole I, R. M., Ceri, H., & Sutton, fmm one Equus and one cervid tooth, both from Stratum 4, associated with transitional Middle-Upper Paleolithic materials.
Fig. 5. M. Q., ESR dating uses the radiation-sensitive signal found in well c1y stallized fossil tooth enamel, but not in modern teeth to date
1993, Immunolog1cal pro
tein residue analysis of
Ii thic archaeologic .
al materials, J Archaeo
non- fossil teeth. The equivalent radiation dose needed to produce the observed ESR signal is the integral with respect to time of the
References l. SCl.. 20' natural, environmental dose rate experienced by the tooth after its deposition. Since the age depends on the uranium (U) uptake
93-100.
Remingtn, s_. J., 1994, history assumed, three limiting cases are calculated assuming early U uptake (EU), continuous (linear) uptake (LU), and recent
Ascenzi, A., Bnmori, M., Citro, G. & Zito, Identifying species of orig
R., 1985, in from U uptake (RU), respectively the minimum, median, and maximum ages. ESR isochron dating requires numerous subsamples
prehistonc blood residues,
lmmumulogical detection of haem Science 266, 298-299.
oglobin in bones of Sensanba gh, G . Wilson, from large mammal teeth, but eliminates in situ dose measurements or sediment sampling, because the tooth acts as its own
ancient Roman times and of Iron and A. C. & Kirk, P. L., 197l
Eneolithic Ages, . a, dosimetn: The teeth yielded a mean age 33.2 3.8 ka (EU), 36.2 4.4 ka (LU), and 39.2 5.1 ka (RU). 230Th/34U dentine dates
Prot m stability in pres
erved biological remains
Pmc. Natl. Acad. Sci. USA 82, 7170
-7172. . ]. might clarify whether U leaching has occurred. Given that little difef rence exists between the various model ages, Stratum 4
Survival f biologically acti
Cattaneo, C., Glsthorpe, K., Phillips, R. & Soka ve proteins in a 8-year-old
l, R. J., 1993, sample dned blood, Int. J. probably dates to 33.2 3.8 ka, assuming EU, but may be as old as 39.2 5.1 ka. Stratum 4 was deposited during Isotope Stage
Blood residues on stone tools: indo Biochem. 2, 545-557.
or and outdoor Sensanba gh, G. , Wil 3, a time when the Gobi experienced less arid conditions.
experiments, World A rcha eology son, A C. & Kirk, P. L., 1971
25, 29-73. . b,
Protm s ab1lity in preserve
Do wns, E. E. & Lowenstein, J. M., 1995, Ident d biological remains II.
KEYWORDS: ELECTRON SPIN RESONANCE (ESR) DAT ING, MAMMAL TEETH, ESR ISOCHRON DAT ING,
ification of Modificat10 and aggregat
archaeological blood proteins: ion of proteins in an 8 year-old
A cautionary note sample of dried blood, Int. TSAGAAN AGUI CAV E, MONGOLIA, MIDDLE-UPPER PALEOLITHIC, LE VALLOIS-LIKE PALEOLITHIC,
J. Archaeol. Sci. 22, 11-16. '
. J. Biochem. 2, 558-568.
Smith, T. R. & Wilson, M. LAT E PLEISTOCENE, GOBI DESERT.

Fiedel, S. _J., 1996, lood from stones? Some T., 1992, Blo od residues on ancient
methodological tool surface: A cautionary
and mterpretatJve pro blems in blood note, J. Archaeol. Sci. 19'
residue analysis 237-241. Introduction T he Tsagaan Agui Cave contains a narrow, inclining
J. Archaeo/. Sci. 23, 139-147. '

Tuross, N. & Dillehay, T., 1995 entryway, a lower grotto, a rotunda-like main chamber, and
Gurfinkel, D. M. & Franklin, U. M., 1988, A , Mechanism of preservation at
study of the Electron spin resonance (ESR) date archaeologically at least two smaller chambers behind the main rotunda.
!"fonte Verde and one use of
feasibility of detec ting blood resid biomolecules in archaeologica l related mammal teeth between - 30 ka and 5 Ma in age and
ue on artifacts' mterpretation, J. Field Arch T hese innermost chambers were not systematically in
J. Archaeo/. Sci. 15, 83-97. aeol. 22, 97-1 IO. heated flint. ESR dating can provide a real advantage over
Tuross, N., Barnes, Y. & Pott vestigated during the first maj o r excavation by the Joint
Herr, J. C.,_ Benajamin, D. C. & Woodward s, R., 1996, Protein identification other methods, because the teeth and flint represent artefacts
, M. P., 1989, of blood residues on Mongolian-Russian-American Archaeological Expedition
Detection of human origin of blood experimental stone to ols, with archaeological significance, unlike some methods which
on tissue, in Allen, J Archaeol. Sci. 23, 289-296 (JMRAAE) in 1995, but constituted one important focus
R. 0. (ed.), A rcha eology Chemistry, Wash . date only stratigraphically associated sediment (Blackwell
ington, DC: Vargas-Sanders, R. & Orti & during the 1996 and 1997 T sagaan Agui excavations
American Chemical Society, 39 4-40 z, E., 1995, Advances and Schwarcz 1993a). ESR dates have compared well with 14C
6. pe specti es in t e analysis (Derevianko et al. 1996, 1998).
Hyland, D. C., Tersak, J.M., Adovasio, J.M. & Siege of proteins from projectile dates for samples ranging up to 20-25
l, M. I., pom ts: b10chemical stud ka (Grun 1989), and
1990, Identification of the speci es ies of haemoglobins, paper with thermoluminescence (TL) and 230Th/234U
of origin of residual prese ted at the 1st Sym dates in the
blood on lithic material, American
posium of Archaeological 30-200 ka
Antiquity 55 ' Che 21stry, Division of Hist range (Blackwell et al. 1994; Blackwell 1995).
104-112. '! ory of Chemistry, 209th ACS
National Meeting, Anaheim
Kooymn, ., Newman, M. E. & Ceri, H., 1992 , U.S.A.
, Verifying Vargas-Sand rs' R., 01ti
_
reliability of blood residue analysis z E. & Martinez, R. D., 1995,
on archaeological Dete . The Tsagaan Agui Cave deposits
tools, J. Archaeol. Sci. 19, 265 -270. nat10n of ancient hemoglobin by biochemical
and 1
Lopez, L., 1995, Guena y mue1te unol ogical analysis, paper presented at Xllf In the eastern Gobi Altai range, in Bayan Hongor
en Tenochtitlan International Congress of aimag,
. Prehistoric and Protohistoric
Descubrimientos en el recinto de Mongo lia (N 4442'32.6", E
las Aguilas, Sciences, Forli, Italia. 10110'08.8") lies T sagaan Agui
ArqueologfaMexicana 12, 75-77. C ave (Fig
. I). The cave occurs in lightly metamorphosed,
Lopez, L. & Mercado, V., 1996, Dos esculturas
Precambrian
dolomitic limestones, replete with karst
de
Miclantecuhtli encontradas en el lan dforms
recinto sagrado de (Fig. 2; Derevianko et al. 1996). Today, a few semi
Mexico-Tenochtitlan, Est. Cult. Nahuatl n omadic
26, 41-6 8. herdsmen use the Gobi Desert's northern borders to Fig. I. The Tsagaan Agui Cave archaeological site,
gra ze their flocks. At
times in the past, however, the area has Mongolia. Tsagaan Agui Cave occurs in Bayan Hongo1;
support
ed much lusher vegetation and a more diverse fauna southwestern Mongolia, in the edge of the Trans-Gobi Altai
(Derevianko et al. 1996, l 998).
near the Gobi Desert.
66
Proceedillf?S of the 31" International Svmvosium Oil Archaeometrv. Jerem. E. & T. Biro. K. feds. I. Arrhaennl"l'S<-ArrhnPnli11<>11n RAR - rPntr l'"11r SPr I
,, ..

Blac"1vell, B. A. B., Olsen, J. W., Derevianko, A. P., Tseveendori, D., Sk11111e1, A F. R & Dwyei; M.
. Mongolia
Dating the Paleolithic Site at Tsagaa n Agui,
ESR (Electron Spin Resonance)

24 25 26 27
21 22 23
19 20
d
In 1995 and 1 997' the cave's lower urotto y .
. ,,, . ield
er th a ne an
extens1ve stone tool collection typologically earli

QT40 k: QT41 33.2 3.5 ka (EU) t

those
ber. Fu h .
recovered from strata within the cave's main cham
rt er 36.24.4 ka (LU)
. .
need d 39.2 5.1 ka (RU)
archaeoIog1ca1 and sedimentological analyses are
.
detennme whether this assemblage has been redep . e to

. .0tn -300
os1ted fr
elsewhere within the Tsagaan Agui complex,
.
as the I . AA-23158 33.84 0.64 ka.
.300
. . 11ItiaJ
sed1mento1og1cal analyses hinted.
2, the upper beds are mainly clasfI c se
In Test Pit
dim
with secondary mmerals, such as gypsum and carbo ent
nat es, a n

.
-400
. ct
.
limestone eboulis, while the lower beds contam
if Iner cl
Ienses mtercaIated with coarse sand layers (Table
l F' g ay
.

n :lyses
3;
a
Derevianko et al. 1 996). Palynological and fauna!

,,....
e
have not yet been completed for these layers, n .
"'
o1 h a s the
detailed sedimentological analysis.

-500 "'
_,

Since 1995, approximately 2800 stone artefacts a

n d some -:0

\l
5000 debitage pieces and unused flakes have been rec "!)

. . over ed ..Q

4l
m the Tsagaan Agm excavations. Although all artef g .J::

acts were
1y classified in the fi eld, only a small fractio ,&>
; .. 0
prelimman
n h ve J:l
"'

been th oroughly analyzed. Preliminary data from
the l "V Burrow -600
.
-600

excavat ons at Ts gaan Agui reinforce several
gene ::i 11C Date
TL Date
conclus10ns draw m analyzing the archaeological
mate rials
+ ESR Date
from the two prev10us field seasons:
1. Stone
-700
raw material, mostly jasper and o
. ther
t Preferred
-700
cry tocrystalline quartz minerals, appears exclusively
m LJ . Io 1'

Upper Plioconc/ Lower
havmg been obtamed within just a few hundred metres
Plcmoconc pcbblr of e
cave entrance. m
-
tcmcc deposits

-
0 1
t
2. A stratified cultural sequence representing the
Lo''r Prc::i111hn;111
dolrimiu:: . . late
llTHCSIOl\C :
prehi tonc early Bronze Age through Middle Paleolithic h
as
at the T sagaan Agui excavation in the main chambe1:
Fig. 3. Stratigraphic profile for the northeast wall
Upper Prcca111hrun mwmorphic
been 1dent1fied.
Quatcrnm scrl 1mcnt from translocated from their positions to this stratigraphic
profile. Where
D 3. In the deepest strata, recovered tools consist mostly of The locations for the dating samples have all been
sandstones and ,olcanics sa1ra :md lo" s.11ra tl!rraccs
. . in relativ e depth between the
been adjusted to compensate for dif e
f rences
fl ake s rapers, compnsmg only approximately 4% in the lithic necessary, their positions relative to the datum have
units is correct . QT40 and
1Uffs
v
G:Zl Upper Jurass1c/Lo\\cr (rel"'
bas.11ts and
"'
0Fault collect10n from these horizons. sampling location and this profile, in order that their
positions relative to various stratigr aphic
14C
4.
4 in Square A24, while all the
from the lower part of Stratum
Flakes were derived from both prepared platform QT41, plus associated sediment samples were collected
Upper CrctJccous pebbles. r7.7l Siliceous \C1ns ng layers, and all the TL sample s from lower in the sequen ce.
"Levallois" (sensu Okladnikov 1986; Alekseev 1990,. dates so far obtained come from higher in Stratum 4 or overlyi
Derev1'anko l 998) and polyhedral cores. Primary reduction
0 0
boulders. and sands1onc
portion
was deposited from at 33 1 ka, althoug h the lower
The six AMS dates and two ESR dates confirm that Stratum 4
. ve1y much older (modified from Derevianko et al. 1998).
Fig. 2. T he geo l ogic setti11gforTsagaanAgui. occurred ots1de the cave, principally at the raw material source. could possibly be as old as 38 ka. Deepe r units may be
.
Lightly metamorphosed Precambrian dolomitic limestones The lithic r duction waste products litter the limestone
. . ed below.
in addition to the ESR determinations describ
contain many karst features, i11c/11di11gTsagaanAgui Cave massif contaimng Tsagaan Agui Cave. S urrounding many found. The plane was made on a large spall, the edge trimmed
. 3 and the upper part of 4 average d 33.00
The dates for Strata
(modified from Derevia11ko et al., 1996). Jasper cobbles and boulders that outcrop just above the cave by removing several large flakes. Made on a massive flake,
1 .2 1 ky BP. These are associa ted with a typolog ically
e trance, l ge primary flakes and smaller chips indicate in
. the combination tool combines a sidescraper with a spur. The
-Upper Paleoli thic flake and core tool
transitional Middle
In 1988 and 1989, joint Soviet-Mongolian expeditions sztu educt10n. Detailed contour and scatter density mapping spurs found in this site seem unique to the Mongolian
cultura l
excavated a trench 1 6 m long and 2-6 m wide s panning the drip
reinfor ces the interpr etation that
of this workshop was completed in 1 996. Paleolithic, mainly because they are produced in several assemblage, which
below Stratum 4 are substan tially earlier,
of the cave'sinclined entryway In Strata 4 and 5 in Test Pit 2, 46 Paleolithic artefacts were d ifferent ways. Essentially, the collection resembles a materials occurring
line along the south
p rofile in that
thic in
margin
perhaps early Upper Pleistocene/Middle Paleoli
(Derevianko & Petrin 1995). In 1995, the north fou d, icluding two core-like artefacts, several spalls, a Levallois-like transitional Middle-Upper Paleolithic
.
and 12
trench was extended 50 cm to the north and 2.0 m east into the
for the Strata 5, 11,
0ne
affinity. Preliminary TL dates
partial dihedral blade 29 flakes, and 12 d e'b1.tage pieces. assemblage (Olsen et al. 1 996; Derevianko et al. 1 996, 1 998).

suggest very much older ages (Derev ianko et al. 1 998).

cave's main chamber . I n 1996, the sounding in the main rotunda core-like artefact resembles a Levallois-like nucleus preform. Analysis also continues on the large and diverse faunal
.

was expanded to the east and west in order to determine the The smaller flakes have damaged striking platforms, while the
maximum depth for the deposits bearing cultural artefacts and lger ones show defined residual striking platforms. A to ol
. .
to resolve the degree to which post-occupational ro offall has kit, cons1stmg of a plane, two burin-like artefacts a notch
'
affected the underlying sediment. In 1997, JMRAAE linked the made on an oval flake, and a combination tool, was also
original Soviet-Mongolian soundings made in 19 88-89 with
our own excavations from 1995-96 to yield a continu o us
Stratum Age
mostly gray sandy silt 'With gypsum crystals,
might
sample recovered in the Tsagaan Agui excavations. A wide Since the early 14C dates indicated that some layers
or one
limit, ESR dates were attemp ted f
range of mammalian and avian species has been identified exceed the 14C dating
o und in
sp. molar and one cervid cheek tooth, both f
thus far, many with paleoecological implications, such as Equus
2 in Square A24, within the lowest 5- 1 0 cm of
biso n, gazelle, horse, and ostrich. In 1997, additional organic Test Pit
Stratum 4 (Fig. 3; Table 3).
samples were collected from Ochotona (pika) and Alticola
Sediment Type (vole) nests near the cave, since the 1 996 samples yielded
ESR dating
_

l Holocene
longitudinal profile through the cave's main chamber down to ages [:S 1 .30 0.14 ky BP (GX-22673)]. JMRAAE staff are
carbonate crystals, limestone eboulis
the bedrock floor. Bedrock and large blocks of dolomitic debris currently analyzing these and other rodent middens from
2 extensively
occur at depths below 4 m beneath the present surface i n the
Holocene? mostly gray sandy silt with gypsum, excavations at Chikhen Agui Cave to assess paleoecological The theory underlying ESR dating has been
carbonate crystals, limestone eboulis re (see
cave interior. The open chimney in the main rotunda roof and
ical and archae ologica l literatu
Variation. described in the geolog
3 dark gray to grayish yellow sandy silts with fossil tooth
sporadically active stre an1s passing through the cave complex
Late Pleistocene recent review in Blackw ell 1 995). Since the
-8
In 1996 and 1 997, Tsagaan Agui 's principal inner chamber
angular limestone gravels and gypsum crystals
enamel acts as a natural dosimeter recording its total
Was excavated. Artefacts there suggest that that late Neolithic
9
itself have caused e r osional events, which have profoundly total

radiation dose, determining the

13
Pleistocene aItematmg gray-blue and green clays and
or early B ronze Age peoples used the cave's deep interior. A environmental
influenced the sedim e nt composition and distribution wit hi n
silts with intercalated coarse sand layers
. in the tooth
rate and the dose built up
environmental dose
_

the cave. Stream activity seems most prevalent in units at and . stone slab there may have served as an altar.
where the dose
while exactly when the chimney o pened is Six AMS 14C dates have been completed for the cultural pennits one to date a tooth. For tooth enamel,
below Stratum 3, n pertains:
rate, DS(t), varies with time, more comple x equatio
currently difficult to assess. Table 1. Stratigraphy in Test Pit 2. sequence in Tsagaan Agui's main chamber (Table 2; Fig. 3),

68 69
 Blackwell, B. A. B., Olsen' J. W., Derevianko, A. P., Tseveendori' D "ki'
., ..,, n11e1; A . F. R.
& Dwye1; M.
ESR (Electron Spin Resonance) Dating the Paleolithic Site at Tsagaan Agui, Mongolia

external y d ose rate

component. An atte
m t to us . Results and discussion
to calculate the time e Iso hr positions. A diamond-tipped hand-held
-averaged e xternal
do e (e.g.,
c o . b sample
(!) & Sch warcz 1993b) Blac Ila relative
was use d to obtain subsamples that had minimal
failed , because the Jcw mel_
teeth con
= the total accumulated radiation dose in the tooth, little U (see below).
:n geochemically altered tissue. Dentine The two teeth, QT40 and QT41, together yielded seven
where ta ine
d pre
nation from
A;111 = the radiation dose accumulated in the tooth from co.ntaiJll subsamples, all of which produced viable ESR dates.
t
The internal dose re m easured by micrometer. The enamel was
.
rate Dim (t), was cal
culated by thi c)alesses we . .
internal sources, the tooth Itself by
,
dentme, cleaned of all adhenng In QT40, the enamel contained 0.21 0.02 ppm U, and the
NA A for its ma o ari . . a n alyzin se pa rated fr om the
r ra atio then_
Aexi = the radiation dose accumulated in the tooth from usually only U and n s ou g ness measured by micrometer. After dentine, 13.63 ppm, while for QT41, the enamel and dentine
the daughter isoto e rces and its thick
external sources, s m g d entI averaged 0.08 0.04 and 3.90 1.20 ppm respectively
and Th decay series f rorn th u' ' were dlilled off each side, the enamel thickness was
follo
e
' wed b Y a theoret1cal
:
Dr.(f) = the total radiation dose rate affecting the tooth (e.g., Namb.i & Aitken 198 ca lcul
ation
20
red The enam
el was powdered in an agate mortar and (Table 4). The U concentration for the QT41en6 dentine sample
6). Although fresh
from all sources, U, toss11 enamel can easi teeth co reme1 a su (200-400 mesh). Neither the diilling nor was somewhat higher, perhaps because it was an internal, rather
n tain no 34- 78 m
ly absorb 5 ppm U pe st e to_
, and
D;111(t) = the internal radiation dose rate from sources ppm U in lOOky, .
thereby mcreasing
dentine
, 10() g affe cts the dating signal intensity. Neither than an external, dentine. Alternatively, the outer dentine layers
' their internal pawd erin . .
within the tooth, Theretore, a U u ptake dose ra es rious signals or alters the U concentrat10n m the in QT41 may have lost U through leaching, which would make
history must be assu t . ce ss pu
med or eac p ro du 230Th/234U
Dejt) =the external radiation dose rate from sources when calculating a
ge. Thre e cases are h tooth l
or the enamel (Blackwel et al. 1992
). the actual ages younger than those reported herein.
outside the tooth, usu ally cons1 de tine
dered: el subsampl es were weighed into 10-13 aliquots may reveal if leaching has been important, providing a
he ena m
t =time, the age of the tooth Early Uptake (EU) approximatly 30 mg, irradia_ted with a 60Co y successful analysis can be completed. Because the enamel for
The tooth acquired . weighing
0 =today (Blackwell & Schwarcz 1993b). .
most of Its
U ve order to obtam added doses rangmg from 10 to 1000 QT41 contains little U , radon loss does not significantly change
soon after i ts depositi .
on at the sit source in
L'mear Uptake (L e. I}' and annealed for three days at 90 C to remove any
0
any calculated ages (Fig. 4).
U) The tooth acquired U . Grays,
its co nt1nu ous1
Th e accumulated dose, AS, was calculated using the addi ti v e . interference signals (Skinner et al. 2000). The ESR
(Jinearly) smce depo Y unstable U Concentrations
od, while the internal and external dose rates w ere sition .
dose meth Recent Uptake (RU) The tooth gained most U signal inten sities were measured at room temperature usmg a Sample Enamel Inner Dentine Outer Dentine Cementum

calculated
based on the radioactive element concentrations in ery recently. L RElX ESR spectrometer with a microwave frequency (EErnl (EErni (EErnl (EErn)
JEO
el and associated sediment, bone, and dentine. power, under a 100 kHz field
A. QT40, 96TA1, Cervid
th e enam EU a es represent the
minimum possible . of 9.445 GHz at 2 mW QT40enl 0.21 13.63 5.83
Th e calculated ESR age strongly depends on the estimate d from a given accum ESR age denv e<J of 5 mT/T using a 0.3 second time constant.
ulate d dose, while RU modu lation 0.02 0.02 0.02

dose rate, Dex1(t). Although Dex.Ct) is best m easured by ages are usually B.
external maximum. Alt th Spectra were scanned over 50 mT centered at 360 mT with a
QT41,96TA3,Equus:
hough a coupl ed e
TL or c dosimetry at the oiiginal sampling sites (Blackwell et
. ESR-230 Th/234 QT4len l 0 II 3.51 4.67
calculat10n can give
the exa
ct up take param_eters
U ag e 4.0 minute sweep time. The receiver gain vaiied from 10 to QT41en2 0.08 3.15 3.15
(e.g., Grun&
al. 1992, 1994), that was not possible for this initial study. McDe1mott 1994) _ 400 d epending on signal intensity. QT41en3 0.08 3.35 5.83
' these teeth contam so little u (see b
Since the teeth were collected before the excav ators d ecid ed elow) 0.07 2.63 2.63
After powdeiing, associated sediment samples, and each
QT4len4
that no succes sful 2i0Th/234U
has y e t been com QT4len5 0.12 5.03 3.35
pleted.
to try ESR dating, neutron activation analysis (NAA) was dentine and enamel subsample were analyzed by NAA for U QT41en6 0.02 5.83 3.66

us ed to measure the radioactivity in the asso ciated sediment with delayed neutron counting (DNC) for 60 seconds, Mean 0.08 3.91 3.88
The analytical
for this expeiiment. Dexi(t) was then calculated from
method 0.03 1.23 1.17
following a 60 second irradiation and a 10 second delay. For
Typical errors' 0.02 0.02 0.02 0.02
radi oactive dosimetry (e.g., Nambi & Aitken 1986). This For tooth ename
l the ESR datmg . K analyses, s amples were irradiated for 60 seconds, and after
NAA detectio11 0.01 0.01 0.01 0.01
protocol is well
m e thod requires that sediment water content be known, since established (Blackw
l
e l 198 9) The teeth 24 hours' delay, counted for 20 minutes using a y counter, limits1 0.02 0.02 0.02 0.02

water weakens all radiation dose rates, particularly the _ were p hotographe
and sketched in six ff .
di erent orientatJO d while for Th, samples were irradiated for 60 minutes and l
Typical NAA detection limits and errors depend on sample mass and tissue type.
ns m order to record the
analyzed for 20 minutes on a y counter after a week's delay.
SamEle Numbers Sampling Location The sediment water content was measured by weighing the Table 4. U Concentrations is T sagan-Agui Teeth.
1
Collection
Type Quadrat Stratum Horiz.on AMS wet sediment, then heating at moderate temperature for
>ODatum < Surface2
14CLab within Stratum 14CA several weeks in order to diive off the water, and reweighing The sediment surrounding QT40 and QT41 generated the
(cm) (cm)
TA97-6 Wood A20 3 (kyBP) the samples. external dose rates, Dex1(t) =0.957 0.121 and De,,(t) =0.963
334 40
AA-26586 charcoal 0.931 0.122 mGray/y respectively (Table 5), while the mean Dex.Ct)
TA97-15 0.065 ESR age calculation for Stratum 4 based on nine samples was 1.039 0.159
Wood A20 2 lowest
AA-26586 430 33.78 mGray/y, which is not significantly different from that
charcoal gravel layer just above 3
0.59 By fitting the data to a saturating exponential curve and immediately surrounding QT41. For layers 1 through 4, the
TA97-17 wood A120 3 surface
436 a ssuming a 1//2 weighting, the Vfit program calculated the AS mean Dex.Ct) measurements differ little from layer to layer,
AA-26586 charcoal 33.50
values and their associated errors. The ages and their suggesting very consistent sources for the cave sediment.
0.60
TA97-16 Wood A'23 3 top associated errors were calculated assuming the ku-value for Therefore, although only one sediment sample was available
3 55 80
AA-26586 charcoal 33.84 enamel to be 0.15 0.02, its density, 2.95 0.05 g/cm3, and associated with QT41, rather than the usual 6-10 to estimate
TA97-18 wood A'20 4 surface
0.64 no Rn loss. The initial activity ratio, (2 34U/238U)0, was assumed an average sedimentary De,,(t) the calculated value does seem
AA-26586 probably derived from 3
390 30.94 to be 1.2 0.2 in the cave system. Dose rate calculations to provide a good estimate for the whole stratum.
charcoal
0.48 assumed some attenuation due to water in all phases, The associated sediment for QT40 and QT41 showed no
TA97-12 Wood A26 4 near surface 27 4 69 including the enamel, and some attenuation of p dose due to significant change in water content when diied, probably
AA-26586 charcoal 32.96
density and sample thickness. Water in sediment was assumed because the sample bags in which the samples were stored
0.67
-

1 Relative locations
shown on Figure 3 to average 10 10 wt% over the time the tooth was in the after collection could leak air or moisture. More sediment
2 Present ground surface ground, while the cosmic dose rate was assumed to be 0.0 samples, collected and properly bagged on site in August,
Table 2. AMS uc Dates.for the Main Chamber' Tsagan-A g 1.. mGray/y, because the teeth occmTed more than 10 m below 1997, were tested now for water content. These averaged
Lil, Mongo 1a.
the ground surface (Nambi & Aitken 1986). < 1-2 wt% for all samples. Although the region is quite dry
The programs calculate standard errors using standaid today, in the past, the cave has seen intermittent stream flow,
ESR SamEle Numbers Location1
Tooth radiation physics. The largest error found in ESR enamel age as suggested by the sedimentology (Olsen et al. 1996;
Analysis Ca talogue Accession Layer Square Depth Species calculations usually deiives from those associated with the
Type Derevianko et al. 1996, 1998). Strata 3 and 4 do appear to
(cm) accumulated dose, Ar., and external dose rate, D<,,(t), while have expe1ienced some stream flow, although this must be
Qr40 96TA1 SS44 Bottomof4 A24 370 Cervid cheek tooth some 30 other factors produce fairly insignificant errors. To confirmed by detailed sedimentological analysis. Moreover,
Qr 41 96TA3 SS86 Bottomof 4 A24 370 Equus sp. molar test the robustness in the calculated ages, the effects from duiing the late Quaternary, at least one laige playa lake
Relative locations shown on Figure 3 Variability in Rn loss, sedimentary water concentrations, and formed in this region, suggesting moisture may have been
Table 3. ESR Enamel Samples ftvm Tsagaan Agu1 somewhat higher in the cave sediment duiing such high lake
Dex1(t) were all analyzed, using the data from typical sample,
, Mongo 1.
. w.
QT4len2 (see below). stands. The sedimentary character and prolonged dry season
70
71
 '''

A. B., Olsen, 1. W, Derevianko, A. P., Tseveendori, D., Ski1111e1; A. F. R. & Dwyei; M.

Blackwell, B.
ESR (Electron Spin Resonance) Dating the Paleolithic Site at Tsagaan Agui, Mongolia

60
40 ,.,, 1
_,,C.,
on""
, ,ce,,
n,,_,trati_n.s.......
, External Das
e Accumulated ESR Ages
'DI K
--_

Sample Layer '"'jfninel

---- Dose,l"li: EU LU RU
----
- -------- - ----------t. i!!----.iina
9ITA21 1.58
0.02
4.81 2.60

0.12 0.10
0.02 0.941 .. san1Ple
(Gray) (ka) (ka) (ka) Typicol
0 118___ 2 error
38 9ITAl5
9ITA16
1.85 5.02 3.08
2a 0.01 1.081
0:064
.14 9
--rQT4if
. 96TA I, Cervid : 52
2.17 6.05
2a 2.71 0.01 1.081 45.24 30.0 36.9 46.6
9ITA17 2a 2.50 4.15
0 00 5.51 9 1.212
QT 40enl
9ITA18 2.44 .
: :8 2.44 2.9 4.2 6.3
5.38
2a 2,71 0.01 1.078 1 1
9ITA19 2a 2.87 5.60 2.81 0.01 L153 5.4% 10% 11% 14%
9TfA20 1246
2a 2. t3 5.85 2. 99 g,01 l.128
36 Mean 2a 2.60 5.57 2.80 O.
l.t J3Qf41, 96TA3, Equus3:
--------- ---=-+_,
oc.:
. ,:; 1,,__
6 _ 0.33 0.19 0.01 0.164 Q:r4ien1 37.52 30.8 32.9 34.6
Q)
---

9ITA22 2b
o.117 . 4.5
1.34 5.05 2.95 0.01 I.003 106t- L20 3.6 4.1
01 : 2b 170 5.53 2.86 0.00 1.042
<( QT41en2 1.84
1:108 36.7
; 4.33 2.95 0.01 L020 LOS4 35.78 33.1 35.1
34 as reported 9ITA2S .57 5.33 2.75 0.01 l.198 1.274
QT4len2
grrA26 3 1.02 3.9 4.3 4. 7
,/ 2b 1 64 4.88 2.70 0.00 0.972
9ITA27 . 1.033 35
2b O.Ol
9ITA28 2 b __J,::61:--:5-- .
3:
:-.. 2.:. 9 7 __:
0,0 1-- L048 .--14--l!._ 42. 56 41.2 42. 8 43. 7
4 -- : c::
'.___ QT41en3
Mean 2b 1.95 5.08 2.86 0.01 L047 1.63 5.1 5.5 5.7 *RU
1.rn ""
32 Typical 0.74 0.39 0.10 0.01 0.151 0.107 OT41en2 LU
error 9TfA 6 1.71 36.61 33.9 35.7 36.9 os reported
9ITA7 2:. 10
6.29 2.26
7. 58::
0.949 l. QT41en4 EU
':'- ----C:.: --' :
---:= ___;2::.!.18 _:::_
L 03
J __jl o l.46 4.1 4.5 4.9 28+--------
:oii-
_ __

1.91 20 30 40
__

Mean 6.94 2.22 0.991 1- 0 10

0.20 0.65 0.04 0.128 37.61 31.8 35.4 38.5
30+--r---r-i---r60:-ir-: -.---, 9ITA2 4 1.41 4.60 2.80 o.oz
0.074 QT4len5 Sedimentary Water Concentration ( wt% )
0.957 LOD- 1.75 3.6 4.3 5.1
0 20 40 80 100
9ITA4 4 1.31 104 0.01
183 0.963 1.023
9ITA9 4 2.22 5.53
Rn Loss (%) 9TfAIO 4 2.18 4.50 2.18
2.44 0.02 L004 1.068 Qf4len6 36.15 31.7 34.5 37.2 Fig. 5. The effects of the sedimentmy water concentration
0.01 0,897 0. 953
9ITA29 4 2.44 6. 74 2.50 0 ,02 l.096 l.203-5----'4.2'--4.8"- on the ages for QT4len2.
1.164
9ITAJO 4 2.25
g the es for QT4l en2. 7.06 2.27 0.02 1.042 1.107 4
Fig. 4. The effects of radon loss on 9TTA31 4 2.11 7.49 2.59 0.01 I.I 16 MeanQT41 37.71 33.8 36.1 37.9 Water in the sediment attenuates the sedimentary radiation
Ll86
ed in th e U sen es decay sequence, 9ITAJ2 4 2.87 6.93 2.59 0.02 2.49 3.5 3.1 2.8 dose (a component in DeJt), the external dose rate)
p o
Radon (Rn), a gas r duc 9ITA33
1.167 1.241
enesis. If Rn is lost,
4 -=:.2.32:___:_7.59"--,.::2-:::,41!___ O.OJ L l0"'-3 1c:.;. l e'..:7
3
can escape from t h e teeth during diag reaching the tooth. Increasing the sedimentary wate1;
___

4.5 5.0
__

1.38 4.0
___

Mean 2.12 6.03 2.54 0.02 l.039 l.104 Mean error

r ,c u g ----t 0.46
the effective interna l dose rate is dec eased a sing a es --; --: L 35 0.2 5- 0 .01
--: ----
0:
.1
59---2
0: 21 0 - 3.7% 12% 12% 13% therefore, decreases the external dose rate, resulting in a
not considered. Typical errori' 0.01 0. JO 0.09 0.001 0.113 0.0 l
to be underestimate d if the R n loss is - 0.02 0.20 0,13 0.002 6 36. 73 32.3 34. 7 36.8 higher calculated age for a given accumulated dose, AS. For
0.152 0.080 Mean QT415
relatively little U, even 100% NAA detection''
Because these teeth contain 0.01 0.05 0.001 0.001 0.004 0.005 0.81 L1 0.9 1.3 all the model ages, significant differences in the calculated
in h limits 0.02 0, 10 0.005 0.002
Rn loss would produce no significant change t e 0.008 0.008 ages for water concentrations do not result unless the
1 Abbreviations: D,/ll =external dose rate due to y particles Mean error 1.33 3. 7 4.3 4.8
f ects woul d occur or QT40.
calculated ESR ages. Similar ef
! sedimentary water concentration exceeds 30 wt%. The
C'.alculated assuming
ulated assuming: 3.6% 11% 12% 13%
The data plotted here were calc cosmic dose rate, D.,.f.,t) 0.00 0.00 mGray/y maximum age differences for all models are less than 25 ky.
Calculated assuming
MeanQT40 38.78 33.2 36.2 39.2
time-averaged scdimen'l!Y water, W.,,
Similar effects would occur for QT40. The data plotted here
(234U/111UJ,,""" 10. JO. v.1% &QT414 3.37 3.5 2.9 4.0
120 0.20 were calculated assuming:
initial U activity ratio, Calculated assuming

k, 0.15 0.02 ume-averagedsedimentarywater,w,., = 5. Mean error 1.53 3.8 5.1

a particle efficiency, 5. ivto/o 4.4
ppm Typical NAA detection l im s
enamel U concen tration, U., sample mass and tissue type.
0.08 0.02 it and errors depend on
3.9% 11% 12% 13% initial U activity ratio, {234U/238U).,,<h 120 0.20
315 ppm
dentine U concentration, U..., a
0.02 particle efficiency, k. 015 0.02
II'" 2. 2. \'<t% Ta ble 5. External Dose Rates from Tsagaan Agui Sediment. 1 Dose rates reported in Table 7. enamel U concentration, U.,, ppm
enamel water concentration, 0.08 0.02
2. v.t% 3.15 ppm
dentine U concentration, U.i...
5.
dentine water concentration. Wo.. Assumptions for calculations listed in Table 7. 0.02
2.95 0.05 'iJcm3
enamel density, p.. significantly at the 95% confidence level from the mean. The Abbreviations: EU assuming early U uptake model enamel water concentration, W.,. 2. 2. wt%
2.75 0.05 'E}cm3
dentine density, po.. dentine water concentration, Wden
=

0. ESR ages average 33.8 4.0 ka (EU), 36.14.3 ka (LU), and assuming linear U uptake model
LU 5. 2. wt%
radon loss in all tooth phases, Rn,...,
0. %
=

assuming recent U uptake model enamel density, p0, 0.05 'E)cm3

2.66 0.05 'iJcm3
2.95
37.9 4.8 ka (RU) (Table 6b), with mean errors near 12-13%. RU
sediment density, P..i 2 0.05
=

. dentine density, Pc1oo 2.75 'E)cm3

enamel thickness, .. 1050 0.100 m
No 230Th/'34 Calculated using external dose rate derived from associatE
- U analysis have yet produced reliable dentine sedimentary water concentration, W,ed 10. 10. wt%
0.075 0025 m sediment, 91I'A2 (fable 4).
thickness removed from inner enamel,- ages, precluding a coupled ESR-230Th/234U age to assess the sediment density, p,..i 2.66 0.05 glcm1
0.044 0.025 m D""'1,.,(t) 0.957 0.121 mGray/y
thickness removed from outer euamel, ...,, enamel thickness, .. 0.100 m
ti ming for the U uptake. Since the model ages do not differ LOSO
=

3.20 0.70 mm
dentine thickness, ..., Calculated using external dose rate derived from associatE thickness removed from inner enamel, i/Jin= 0075 0.025 m
!JI 0.02 ppm significantly from one another at the 95% confidence level,
sedimentary U concentration. U..i sediment 91I'A4 (Table
, 4). thickness removed from outer enamel, 0,,., 0.025 m
3.83 0.14 ppm 0.044
sedimentary Th concentration, Th..i however, the U uptake model assumption is not critical for
sedimentarv U concentration, K..i
3.04 0.12 ppm D.,.1jt) = 0. 963 0.122 mGray/y dentine thickness, i/idcn 3 . 20 0.70 mm
these samples. In several dry environments, EU ages hav e sedimentary u concentration, u.ed 1J I ppm
=

D.,(t) 0.000 0.000 mGray/y All subsamples. 0.02

c<"ismic dos e rate,
sedimentary 111 concentration, Th,ed 3.83 ppm
=

proven to be the best uptake model (e.g., McDermott et al. Without Qr4len3. 0.14

he obi even during wett er
that would have occ ed in t G urr
nt saturation. Since the
periods, how ever, arg u e agai consta
nst
centra tio n is likely to have been
time-averaged wate r con
it w as assumed to be 10
higher than the 2 wt % seen today,
ns.
10 wt% for the age calcula tio
ced only one subs mple and
Since QT 40 was small, it produ
34U analysis to assess the U
could not be submitte d for 2fh/2
chron age be calcu lated. The
uptake model, nor a n iso
ges fo r QT40enl and QT4 l
similari ty in the c a lculat ed a
QT4 0 ages are reliable. The QT4 0
(Table 6a) suggests that the
36.9 4.2 k a (LU)
ages are respectively 30.0 2.9 k a (EU),
, errors of 1 0-14%.
and 46.6 6.3 ka (RU) it w h
es, the internal dose rates,
For QT41, the accu mulated dos
consist ent for all subsamples
the EU, LU, and RU a ges ar e
en3 s eems rather different, wh en
(Tables 4, 5). Although QT4 l
nsid ered, it does not d iffer
its associated err or is co
1 993). Therefore, the
EUrepresents aage
reasonable median age for this tooth. For the two teeth, the
combined mean age is then 33.2 3.8 ka, assuming EU.
Because water in the sediment slows the incident radiation,
a change in the water concentration over time significantly
a changes the external dose rate, D.x,(t), and, therefore, the
calculated age, t. To test the effect of the sedimentary water
assumption, ages were recalculated using different water
concentrations. If the cave sediment had been much wetter, o n
average, since 50 ka than that seen today, the calculated ages
would be significantly older than those reported herein
(Fig. 5). If the sedimentary water concentration had average d
30 wt%, instead of the 10 wt% assumed here, the EU ages
would increase by 2 7%, the LU, by 30%, and the RU, by 3zo/o.
Despite the high lake levels intermittently in the past, however,
to maintain 30 wt% sedimentary water concentration would
probably
Table 6. ESR Ages for Tsagaan Agui, Mongolia
require that sediment was completely saturated for at least
70--80% of the time, or - 30 of the last 50 ky, a scenario
that seems excessive for the nmthem Gobi. T he evidence
currently available suggests that the maximum time-averaged
Water concentration did not likely exceed 2 0 wt%.
T he external dose rate calculation strongly influences the
calculated ages. T he inhomogeneity in the sediment close to
the teeth
(Table 5) is sufficient that the actual external dose
rte, D.,,(t),
that the teeth experienced may have been
Sign ificantly different than that calculated herein, causing
p ot e ntial inaccuracies in the ages (Fig. 6). If Dexi(t) were
actually 0.240 mGray/y lower than that calculated here, the
calculate
d ages would increase by 9----1 2 ky. If, however, the
sedimentary U concentration, K.ed 3.04 0.12 ppm
cosmic dose rate, D00,(1) 0.000 0.000 mGray/y
actual external dose rate were 0.240 mGray/y higher, then the
calculated ages would decrease by 6-7 ky. More sediment
samples around each tooth will be analyzed to ensure the
accuracy in the ages. Coincidentally, however, the sediment
samples closest to QT40 and QT41 yield the lowest D.Jt)
values seen in Stratum 4 (Table 5), but the other sediment
samples were from more than 1-2 m away from the locations
where QT40 and QT41 were found. Measurements for
Stratum 5, which does contribute some dose to QT40 and
QT41, have not been completed. T he TL ages for Stratum 5
hint that it is much older, and may have been deposited under
very different conditions. Until sediment from Stratum 5 can
be analyzed or in situ dosimetry can test the modem D.,,(t),

72 73
 .
Blackwell' B. A B. , Olsen, J W. , De11!vwnko, at TsagaanAgui, Mongolia
A. P., Tseveendori, D., Skinne1; A. F. R. & Dwyei; M. Spin Resonance) Dating the Paleolithic Site

ESR (Elec tron

EU
3001
A. Conclusions
I

---- -
Sediment

j
1
D.,,,.1.,y(t) d
D int.eu( Din1 .reu(t}1
Due to low U in the enamel, few signi
ficant . saniple (mGrav/ ) (mGray/ ) (mGra i )
250 .
QT40<liffe ren /\ QT40 96'TA1. Cervid:
exist between the model ages for QT41
ages 0.125 0.004 0.005
smn1 ar to those for QT41. Therefore, the , 0.257 0.017
average E

0.037

o. 957 0.001
ag
Qr 40enl 0.003
4
0.017 0.004 0.008
33.2 3.8 ka, provides a reasonable age estim 0.121 0.006
0
200 ate or Stra
_::.
"-"
4. Small changes in the time-averaged sedime
ntary . J3 4 , 96TA3, Equus: 0.004 0.004
content would not cause significant diffierences . 1Uo1s QT 1 0.020 0.055 0.009 0.027
O. 963
ag , if
m the qr 41enl 0.025 0.004 0.004
0.007
overesti e '
(j) 150 however, the external dose rate was under- or 0.963 0.015 0.052
0.004
(Jl ma1e4 QT4ten2
0.016 0.027 0.007 0.0 1 3 0.004
RU
<( here, the ages could change significantly. 0. 963
* QT41en3 0.020 0.004 0.004
0.013 0.043 0.006

LU Further ESR and associated analyses may
. . c1anfy
. sotne QT41en4
0.963
0.010 0.048 0.004 0.005
0.099
EU remaimng questions. If obtainable ' 230Th /234U 0. 963 0.021
100 0.005
analyses QT4ten5 0.087 0.002 0.042 0.000
show w hether U leaching has occurred from the e lllay 0.963 0.004
. namel QT41en6 0.007 0.029 0.003 0.004
OT41en2
sediment analyses should help to establish the pre . '1oic 0.963 0.014 0.061
QT41 mean

0.002
4
reported cise ext 0.002 0.002 0.002
dose rates for Stratum 5, which does influence teet fr e
Typical
0.004 0.003
h o lllal
50 0.122
m the
error
f-t--1 lower Stratum 4. We have now collected severa -
EU assuming early U uptake model
1 more t "lll L Abbreviations:
specificall

. y for ESR dating from Strata 3, 4 and so e LU assuming linear U uptake model
me Iayers
0-;t-r-r-'T..,-,-,-fr-r-T-r-r-r-,-
-, lower m the sequence. RU assuming recent U uptake model
External dose rate, y component
0 400
Daxt.r (t)
800 1200 1 500 2000
Compared to the 14C and TL ages, the ESR ages
Dext(t), External Dose Rate (Groy/y) . .
consistent with the stratigraphy (Fig. 3). Interest '
are tota)J
Y Dmt,en(t) Internal dose rate from enamel
mg1Y, how.
4
ever, the 1 C and ESR ages combined with the TL Dim.,dcn(t) Internal dose rate from dentine
ag es do mGray/y
cosmic dose rate, D"""(t)
Fig. 6. The effects from variations in the external dose rate 0.000 0.000
suggest a great hi atus m deposition between Stratum 1 Calculated assuming

' 4 and
sediment density, p .,d
Dex(t), on the ages for QT4I en2 . As the external dose rate 2. 66 o. 05 g!cm3
f cave
Stratum 5, perhaps indicating a prolonged period
o wt%

sedimentary water, W....i

zncreases, all the model ages decrease exponentially, . . 10. 10.
ng that
c1osure. The much more rapid sedimentological filli
.
asyptotzc
ally approacl ing an age near 22 ka at very high begms m s tratum 4 may be related to the ope .ng
o f the 2 Calculated assum ing a particle efficiency, a.,,, 0.15 0.02

ru g/cm3
external dose rates . Smee the sediment associated with .
chi mne above the main gallery, which would have allow 3 Calculated assuming dentine density, Pilm 2.75 0.05
QT40 w s imilar to that for QT4I, effects on QT40 would . ed
water in dentine, Wden 5. + 2. wt%
wt%
much higher sediment volumes to enter the cave.
be s1m1lar. A small change in DeJt) will cause the tratum 4 rpresents
layer deposited in the Middle Late 23 Calculated assuming Rn loss, Rn1edh 0. 0.

initial activity ratio, (234U/238U)o,toelb

ca/culated age to fall outside the envelope formed by the . 1.20 0.20
P leistocene, with deposit10n beginning probably about 33 2 +
.
associated errors. Increasing the Dex1(t) from 960 to 1200 1.2,3 Calculated assuming enamel density, Pon 2. 95 O. 02 g/cm3
middl;
=

wl/O
3.8, but possibly as early as 39.2 5. l ka, during
mGra /y, a 25% increase, decreases the ages by I 9-2I%, water in enamel, W.., 2. 2.
mm
?' Oxygen sotope Stage 3 and continuing until 33.0 0.7 ka
wzle decreasing DeJt) to 720 mGray!y, a 25% drop, enamel, <Poo 0. 70 0.10
(cf. Martms n et al. 1987). At the time, glaciers would !\ave 2,3 Typical thickness ranges:
. 1.10 0.10 mm
mcreases the ages by 28-32%, depending on the uptake been retreatmg from the continents in the northern hemi
0.06 0.02 mm
model . The data plotted here were calculated assuming: shere.' cusing . dramatic climate changes in this are a , as inner enamel surface removed, fmner
0.02 nun
outer enamel surface removed, -.,,
0. 06
climatic Circulat10n systms realigned in response to rising
. dentine, tPdoo 3.20 0.70 mm
initial U activity ratio, (234Uf238U).,,...h
sea lvels and slight mcreases in global temperatures.
0.01 0.02 mm
1.20 0 20 cementum, <Poem
a
particle efficiency k 0.15
Certainly, vegetation and fauna would also have been
ual subsam pl e thickn esses, U concen trations in various tissues
Typical errors usually depend on the individ
0.02
enamel u concentration: u; 0.08 0.02 ppm
changing in re ponse to the changing climate, requiring that

4

dentine U concentration, Uden 3.15 0.02 ppm the hman res dents also make significant changes in their (Table 2) and their associated errors.
enamel water concentration, w

2. 2. wt% behav10ur. Dunng times in the late Quaternary, this area was
dentine water concentration, w 5.
mu:h .more humid than today, and might be more humid Table 7. ESR Dose Rates for Samples from Tsaga
an Agui, Mongolia.
J
2. wt
enamel density, Pen 2.95 'e)cm
3
0.05
dentine density, p"'
g/ cm agam m the future.
& Debenath, A.,
Blackwell, B. A., P orat, N., Schwarcz, H. P.
References
. 2.75 0.05
sedimentary water concentration, W...i 10. 10. wt%
tooth ename l: Comp arison with
1992a, ESR dating of
Acknowledgements
=

'E/cm.3
sediment density, p,.,.. 2.66 0.05
230 /234 dates at La Chaise -de-Vo uthon
enamel thickness, .. l.050 Alekseev, V. P. (ed.), 1990, Paleo/it i Neolit Mongolskogo Th U speleothem
. 0.100 m
thickness removed from inner enamel (Charente), France, Quatern ary Scienc e Review s 11,
0.075 0.025 m
' "wz We thnk M. Divjak, B. Lau, D. Conway, J.l.B. Blickstein, Altaiya, Nauka, Novosibirsk, 644 pp.
thickness removed from outer enamel
C. .Moms, H. Chan, G.Q.P. Xiang, and A. Dawoodi for
ourer 0.044 0.025 m 231-244.
Blackwell, B. A., 1989, ESR Dating of Tooth Enamel,
Blackwell, B. A., P orat, N. & Schwarcz,
dentine thickness, <1<n mm H. P., 1994, The
and
. 3.20 0.70
sedimentary U concentration V. assistance in preparing and analyzing the teeth. J. Johnson McMaster University, Dept of Geology, Technical Memo
1.31 0.02 ppm ologic al sites in the Great
sentary Th concentration, 77i:: 3.83 0.14 ppm J. 'Yelsh, McMaster University, performed the NAA analyses, 89.2, Hamilton, 234 pp. potential for ESR dating archae

sedimentary U concentration, K,,..i gai scales, burnt flint,

assisted by A. P idruczny, McMaster Nuclear Reactor. Iv!. Blackwell, B., 1995, Electron spin resonance dating, in Lakes region: Mammal teeth,
304 0.12 ppm
cosmic dose rate, D""(t) and Paleo
0.000 0.000 mGray/y Butler, McMaster Nuclear Reactor facilitated the 60C0 Quaternary Dating Methods, Rutter, N. W. & Catto, hearth sand, in Great Lakes Archaeology
the
N. R. (eds.), Geological Association of Canada, St. ecology: Exploring Interdisciplinmy Initiatives for
however, some difference may exist between our measure
l
irradiations. S. Appel and J.I.B. B ickstein assi sted with
Nineties, MacDonald, R. I. (ed.), 321-3 66, Unive rsity of
proofreading and poster layout. NSF Grant HBS 9709912 to John's, Geotext 2, 206-268.
BABB financially supported the data presentation at the Blackwell, B. A. & Schwarcz, H. P., 1993a, Archaeo
ments and the act al J?exi(t) affecting QT40 and QT41. In the Waterloo P ress, Waterloo.
. . of Siberia: New
Internat10nal Archaeometry Conference in Hungaiy. pSC Derevianko, A . P., 1998, The Paleolithic
meantime, the smnlanty in DeJt) for Layers 1--4 suggests that .
ch ronology and scale, in The Effects of Scale on
Archaeological and Geoscientific Perspectives, Stein, J.
retatio ns, Institu te of Archae
those measured for QT40 and QT41 , i'f any thing, are CUNY grants to BABB, and an NSF grant ILi 915111 to Discoveries and Interp
Divisi on, Russian
K. & Linse, A. R. (eds. ), Geological Society of America
somewhat low, by perhaps 0.080 mGray / y. If that were true ology and Ethnography , Siberi an
AFRS supported the ESR analysis. Grants to JWO, APD. and
Academy of Sciences, Novos ibirsk & Unive rsity of
then the ages reported here would be marginally older than th DT fro the National Geographic Society, Wenner-Gren Special P aper 283, 39-58.
Fo ndat10n. for Anthropological Research, Leakey foun
Illinois P ress, Urbana, 406 pp.
. A. & Schwarcz, H. P., 1993b, ESR isochron
ctal ages ?Y - 3 ky, a difference that does not exceed the Blackwell, B
.
Derevianko, A. P., Olsen, J. W & Tseveendorj,
D. (eds.), 1996,
linnts established by the uncertainties in the ages. The strong dat10n, Umversity of Arizona, and Russian Academy of dating for teeth: A brief demonstration in solving the
n
agreement between the ESR and 14C ages (Table 2; Fig. 3), Sciences supported the fieldwork. external dose calculation problem, Applied Radiation Archaeological Studies Carried Out by the Joint Russia
Exped ition in Mong olia in I 995,
however, argues against the higher De,,(t). and Isotopes 44, 243-252. Mongolian-American

74 75
 Blackwell, B. A. B., Olsen, .
J. W.., Derevianko, A. P., Tseveendori D. Skin
ner A F R & Dwye1;
M.
' '

Izdatelstvo, Russian Academ

y of Sciences, Institute of
chaeology and Ethnography,
Novosibirsk, 328 pp.
McDermott, F., Grun, R.
Stiinger C B &
1., 1993, Mass-spectrom
'
Hawk
es\Vo
'

Derevrnnko, P., Ol en, J. W.,

& Tseveendorj, D. (eds.), HAT FOR AND WHAT LIMITS CAN AMINO ACIDS
HAT WAY, W
;
etric U-seiie llb
date s
f or I ,
1998, Archaeologzcal Studies Car Neanderthal/early mod
em hominid Sit s
ried Out by ti1e JOtn
r . f 252-255.
es, N
ature M N CID RACEMISATION BE USED IN ARCHAEOMETRY?
A I OA

Russian-Mongolian-America
in 1996
.

n Expedition
Nambi, K. S. V & Aitk
en, M. J., 198
Izdatelstvo, Russian Academ
f 6' An CSAPO, J.,1 NYBERG, J.,2 MALMGREN, B.,2
Archaeology and Ethnogra
y of Sciences, Institute o
conversion factors for TL . nu al
phy' Novosibirsk ' 406 pp. and ESR datm
. 28, 202-205.
g, Arch
ae0 CSAPO-KISS, ZS.1 & CSAPO JR., J.3
Derevrnnko, A. P. & Petrin' V
T. 1995 , 1ssledovam.ya
Peshhernogo Kompleksa Tsag , P., 1986,
Okladnikov,

A.
an-Agui na Yuzhnom Fas Paleo/it Mongolu.. 1Facult of Animal Science, Pannon Agricultural University, Guba S. u. 40., Kaposvdr, 7401 Hungmy,
Novosibirsk, 433 pp. , Na y
2Geological Centre, University of Gateborg, Goteborg, 41298 Sweden,
Gob1skogo Altai a v Mongoli
i, Izdatelstvo, Russian

Academy of Sciences, Insti
Olsen, J. .,D erevianko, A. P. & Tse
6., Pees, 7624 Hungary
S., 6 .r Natu ral Sciences,
tute of Archaeology and . veendorj, D N atural Geography Department, Janus Pannonius University, lfjusag u.
Ethnography, Novosibirsk, 132
Invest1gat10ns in Tsagaa . 7 I faculty 01

n Agui Cave, m J
pp. . Archaeo I
. og;
, R., 1989, The ESR dating
..
Grun Studzes Carried Out by
the Joint R uss1
method, Quat. emary .. an-Mo
Amencan Expedz.t1on . o.
8 han.
.
1nternatwnal 1, 1-69. in Mongolia in 1995 :
Der VI. v wing prev ious attempts to use the extent of amino acid racemization (AAR)
for the dete1mination of the age of
8: McDermott, F., 1994, Open system modelling for A. P , lsen, J. W. & Tse alJko, A er re ie
Griin, R.
.
: veendorj, D. S.
eds.)
,
C t ogical samples contai
ning proteins, we present our own approach. Before starting amino acid racemization research, a
chaeolo 74-89,
U-snes and ESR datm
Publishing House of
the Institute of Ar arc aeol
g of teeth, Quaternary Scie
gy and rated for protein hydrolysis with ve1y low racemization of amino acids. The hydrolysis was pe1formed at
nce ethod was elabo
13, 121-125.
Ethnography, Novosibirsk
to the original (l 10C, 24 h)
m perature (J70C) for a short time (30 min) which caused very low racemization compared
Reviews
Maitinson, D. G., Pisias, N. G.,
Skinner, A. F. R., Blackw
.
ell B A B ., Chast
ne:v,,
hig
Hays, J. D., Imbrie, J., Moo een, D. E.,
re, J. M. & Mm, S. S., Shao, equ ently the D- and L-amino acid content of fossil bone samples of known age (radiocarbon method) was detetmined
'

& Shackleton, N. J., 1987, Age eth od. Subs

in press ' 2000, I

.

: HPC af er precolumn
T.
dating and the . mproveme .
nts t derivatization. Based on the half-lives of racemization obtained and plotting the DIL ratio as a function
datmg tooth enamel by
orbital theory of the Ice Age ESR, Applied R . .
s: Development of a high ad1at1on & III acids, calibration curves were obtained which can be used for the age detemiination of fossil bone
:;
Isotopes 52. time for
v arious amino
0 to 300,000-year chronost
.
resolut10n
ratigraphy' les
amp in the range of 2000- 500,000 years. Another method is presented for the detemiination of age of textiles in the range of
Quaternary Research 27, 1-29.
J(){)-1800 years. This method is based on the dete1mination by amino acid analyser of the age-dependent alteration of amino acid
Cystine, methionine and tyrosine content decreased, while cysteic acid content increased with age.
com position of proteins.
Predicti on equatio ns were developed as linear regressions of age of wool based on cysteic acid, cystine and tyrosine content.

KEYWORDS: PROTEIN H YDROLYSIS AT HIGH TEMPERATURE, RADIOCARBON CALIBRATION,

AMINO ACID RACEMIZATION, D-AMINO ACIDS, AGE DE TERMINATION,
OXIDATION OF SULPHUR CON TAINING AMINO ACIDS.

Introduction
The subject of this paper is a survey on the possibilities of
the determination of the age of archaeological samples
containing proteins based on transformations of the amino
acids therein. The first possibility is to base the age
determination on the extent of racernization of the L-amino
acids which are the constituents of native proteins. Amino
acid contents in fossil shell, bone and tooth samples from
early ages were reported first by Abelson in 1954. In 1967,
Hare and Abelson reported that D-amino acids in fossils
resulted from conversion of L-amino acids of protein. It was
found that the older the fossil the higher the D/L ratio and,
after a certain age, amino acids occurred in racemic form. The
ratio of D-allo isoleucine and L-isoleucine content in a
fossilised shell sample was found to be 0.32 and the fossil was
estimated to be 70,000 years old, as reported by Hare and
Mitterer, in 1968. This is considered as the first application of
am ino acid racemization (AAR) - or rather epimerization - in
geochronology.
Subsequently, racemization of amino acids was used for
age determination
of various materials containing protein
CWehmi!ler & Hare 1971; Williams & Smith 1977; Miller &
Hare 1980; Bada 1985; Taylor 1987; Csap6 et al. 1988,
1990). Isoleucine was given special attention because L
. temperature at this depth is
is oleucine -
containing two chiral centres - can be easily
separated
from the diastereomeric D-allo isoleucine by an
amino acid analyser. For the moment Miller et al. (1997) used
the amin
o acid racemization to determine the integrated
temp erat
ure exposure during a long period of time.
However some errors of age determination based on AAR
by Williams and Smith in 1977. Temperature,
Were reported
PH, soil composition and various contaminants should also be
c o nsider
ed when estimating the age of fossil bone samples.
Recently Marshall (1990) established that the bones are not
reliable materials for AAR testing, particularly if they come
from a warm environment. The statement was based on
differences observed between the age of the California bones
determined by 14C accelerator mass spectrometry (5000-6000
years) and by AAR (50,000-60,000 years). Milford Wolpoff,
paleoanthropologist, expressed the opinion (cited by Marshall
1990) that many people currently regard AAR as "some kind
of joke".
Since various changes in temperature during the past and
other conditions influencing dead biological organisms are
not well known, the reaction temperature of racemization can
only be estimated and not accurately determined. This is the
reason that in this study at first contents of D- and L- amino
acids and their ratio were determined in samples of known age
(as determined by the radiocarbon method). These data were
then compared with data obtained from the analysis of amino
acids in samples of unknown age. To make the comparison
more accurate, the antecedents of samples of known age when
analysed were the same as or similar to those of unknown age.
All of the samples analysed in this study originated from the
same Hungarian environment. The samples were excavated
from a depth of approximately 1.5-2.0 metres (the depth is
very important because of the temperature; the yearly average
11C). The pH of the soil at this
depth in most cases was very near to neutral and never
exceeded 7.0 (the pH ranged between 5. 5 and 6.8). Therefore,
approx. 150 fossil bone samples previously analysed by the
radiocarbon method were collected from various Hungarian
museums, and their D- and L- amino acid contents were
determined. The D/L ratio was plotted against time, which
produced a calibration curve. This curve can be used for age
estimation of samples of unknown age after their D- and L
amino acid contents have been determined. The D/L ratio for

76
Proceedings
of the 31" Jnternatio11al Symposium on Archaeomet1y, Jerem, E. & T. Biro, K. (eds.), Archaeopress-Archaeolingua, BAR- Centi: Ew: Se1: I.
,.,..,. in archaeometry?
o acid racemisation. be used
s can amino acids and amin
hat fior and w hat limit
Csap6, J., Nyberg, J., Malmgren, B., Csap6-Kiss, Zs. & Csap6, J. Jr. w
Jn wIi
ay

at w '

amino acids
m ples The D/L ratios for various
2-3 amino acids was detennined for each sample and the hydrolysis and racemization have been carefully in
vesri Age of sa
ga ed by Val
mean value of ages estimated from calibration curves was It was concluded from the data of our experimen determin Glu Ala Ile

ts His Phe Asp
considered the true age of the fossil sample. rae of the racemiztion in the course of the hydro t cone cted
. the 14c
. ear)
In the course of these studies it was found that in the case acid catalyzd prtem hydr lys1 decreases in the fo oo method (y
-
U
of samples containing proteins with low D/L amino acid ratio ?
order: aspai:1c ac1 , glutamic acid, threonine, pheny
(fossils under the age of about 2-3000 years) it is not possible
_
alane, valine, _ _
stidine.
he rate of the racerni
la! a
ltine,
2200
0.138
zation 0.162 0.101
_
to achieve reliable data for their age. Another possibility for peptide bound amino acids m 6M hydrochloric acid b of 2800
etw 0.181 0.109
the age detennination is to base the measurements on the 110 and l 70C is 4-7 times higher than that of the fr
ee 3110
0.199 0.128
changes in the amino acid composition of the aged samples.
The basis for using the amino acids for age detennination is
acids. The racemization at high temperatures a
nd
reaction times is by 20-55% lower than at l 10C for ott


3240
4630
0.253 0.179 0.109

4 0.312 0.225 0.128

that the two sulphur-containing amino acids are sensitive to

;
Espe ially advant geous is to run the hydrolsis at 16
ooc f 5460
0.419 0.252 0.171 0.091
_ .
oxidation both in the free state and when bound in peptide. 60 min or at 170 C for 45 min. These condit10ns hav been 6850 0.126 0.112
e 0.618 0.442 0.271
Further, depending on environmental conditions, cystine may selected for the age determination experiments. 11200 0.143 0.131
0.682 0.473 0.289
decompose into alanine, homocysteine, homocystine and 12400 0.178 0.158
0.561 0.378
glycine (Yoritaka & Ono 1954; Osono et al. 1955). Age determinations of fossil bones 15600 0.209 0.192
0.654 0.432
Methionine may also be considerably degraded by being 18600 0.233 0.209
0.689 0.491
oxidised to methionine sulphone and sulphoxide (Martin et al. The data obtained from the analyses on 24 fossil 20200 0.256 0.228
lion 0.543
1945. In order to eliminate analytical problems due to the
facts outlined above, Moor & Stein (1963a,b) and Hirs (1956)
samples of known age from various Hungarian museu ms
summarised in Table 1. Linear relationship was fou
22600
254 00
0.580 0.275 0.246

nd 0.621 0.311 0.289

devised methods for the detennination of the two sulphurous between the D/L ratio and the age of the samples detennined 28600 0.321
0.643 0.325
amino acids in the oxidised state. Because of the low content by the radiocarbon method. Seven amino acids 30400 0.343 0.099
(His :: 0.702 0.355
of sulphurous amino acids in collagen which is the main histidine, Phe = phenylalanine, Asp = aspartic acid, 32500 0.381 0.118
G!u :: 0.395
protein constituent of bone, the methods based on the glutamic acid, Ala = alanine, Ile = isoleucine, Val = valine) 36900 0.465 0.134
0.481
determination of their changes were found unsuitable for its were investigated. These may be considered as being the most 44600 0.483 0.142
0.500
age measurement. At the same time, however, calibration suitable for age determination because some of them show 46800 0.510 0.169 0.100
0.527
curves obtained on the basis of the changes of cystine, cysteic ve1y fast racemization (His, Phe, Asp), while others show 54300 0.586 0.188 0.115
0.606
acid, methionine and tyrosine content as a function of their medium (Glu and Ala) and very slow racemization (Ile, Val). 62200 0.613 0.199 0.119
0.634
age enabled us - for the first time in the history of the Analytical data for other amino acids analysed are not 65000 0.652 0.221 0.136

archaeometry - to determine the age of wool carpets and presented; none of the ratios lower than 0.1 or higher than 0.7 72400
radiocarbon method.
textiles (Csap6 et al. 1995). presented, in these cases, the accuracy of age determination
Table 1. DIL rati os for vari ous amm
.
o a
.

1 ; .

ds onc rn '. ng ages if fossil
samples determined by the
ino acid to reach 0.333,
In order to be able to measure the changes of the amino acid was doubtful. The half life of amino acid racemization, i.e. the _ at n .e. t e time re qu1- 1 d for the ratio of D- to L-am
composition and/or the enantiomeric ratio of the individual time required for the ratio of D- to L-amino acid to reach T he ha lf life of amino acid race nu z w , t samples during burying was
approximately 1 1 oc,
the data of Tab le 1 . T he temperature oif . J1e
amino acids in very small archaeological samples the use of 0.333, was calculated by interpolation or extrapolation from was calculat ed from
was between 5.5 an. d 6.8.
the surroundings of the bone
while the pH of the soil in
the highly selective and sensitive high-performance liquid the data of Table l , and is presented in Table 2. The tempera
As
n curves is presented finally.
chromatographic method (HPLC) is inevitable. Pre-column ture of the samples during burying was approximately 11C, The applicability of calibratio
Amino acid Half-life (year) of whic h was unkn own
ple the age
derivatization of a-amino acids using o-phthalic aldehyde while the pH of the soil in the surroundings of the bone was an example one bone sam
he
(OPA) and various thiols as the reagents leads to fluorescent between 5.5 and 6.8. ina edfrom the end of the Neolithic Age or from
and orig
Histidine 5500 g to the arch aeol og sts
accordin
formed derivatives, while another reagent, 9-fluorenyl-methyl From the data of Table 1 it is evident, that, D-His, D-Pl\e, beginning of the Copper Age
Phenylalanine 8500 acids and the followmg
chloroformate (FMOC-Cl) transforms *-amino and imino D-Asp, D-Glu and D-Ala contents can be used for the age yse d -"or L and D-am ino
was ana1 i -
8600
Tyrosine own sample was excavated from
acids to fluorometrically active derivatives. Both types of determination of samples which are 2-12,000, 3-20,000, results were obtained (the unkn
13500 ):
5-35,000, 8-70,000 and 10-80,000 years old, respectively.
Aspartic acid the pH of the soil was 6.50
derivatives have good chromatographic properties enabling
16500 a depth of 1.85 metres and
Serine
several amino acids to be separated and measured within one Age of samples older than 30,000 and 50,000 years can be
Threonine 17000 mg, D/LHis = 0.428
chromatographic run at very low concentration levels. detennined on the basis of Ile and Val content, respectively. L-His: 0.0697 mg, D-His: 0.0289
Glutamic acid 28500 n curve: 7100 years;
If the aim is the enantiomeric separation of amino acids, Data were corrected (reduced) with the D-amino acid content Age calculated from calibratio
Alanine 32000
chiral derivatization agent should be used which transforms of a fresh pig bone to eliminate the errors of analysis. SEM = 337.
Isoleucine 110000 mg, D/LPhe =0.254.
the amino acid enantiomers to pairs of diastereomeric de Concentrations of the D-form for the other amino acids were L-Phe: 0.0543 mg, D-Phe: 0.0138
Leucine 140000 n curve: 6950 years;
rivatives separable on achiral HPLC columns. The chiral 1-(9- negligible. However, all analyses were corrected for the small Age calculated from calibratio
Valine 180000
fluorenyl)-ethyl chloroformate (FLEC) reagent (Einarsson et concentrations present in fresh pig bone. SEM = 191.
mg, D/LAsp =0.182.
al. 1987a,b) and also the OPAfthiol reagent are suitable for Studying the calibration curves, it can be concluded that, in L-Asp: 0.1346 mg, D-Asp: 0.0245
the case of the D/L ratio being lower than 0.1, the D-amin
Table 2. Half-lives of racemization and ration curve: 6900 years;
this purpose if a chiral thiol is used in the latter case. Both Age calculated from calib
It epimerization of various amino acids found
types of reagents were successfully used in this study. If the acid content is too low and age detennination is uncertain. SEM = 465.
e in Hungarian fossil bone samples.
aim is only the separation of the isoleucine and D-allo is obvious that the calibration curves can be used for ag
of the
detennination most satisfactorily in the linear range (betw een sample is the mean value
isoleucine, no precolumn derivatization is necessary since
years The estimated age of the
0.1 and 0.5 where D-amino acids are present in w
eJI Sample 1 estimates vmy from 562 to 600 years. This mea n valu e has a
they are diastereoisomers, and the separation and quantitation s above estimates, or 6980 _
le and average 580 years. All four sets of confi nc limit
d
s and the 95% confi denc e mte rval
can be made by amino acid analyser without chiral selectors. detectable amounts). The optimum D/L ratio for each s amp standard enor Of 202 Year
e overlap, indicating that the estimates are not s1 ni.fic
antly
The prerequisite of a successful chromatographic analysis can be found by analysing the amino acids best suited for a g een would be 6554 to 7406 years. .
1 ts betw r
detennination. E.g., for fossil bone samples of 11,200 years
of different. We can be 95% certain that sample od includes the analytical erro
is the complete hydrolysis of the protein content of Of course the described meth
, 550 and 610 years of age. the effe ts on AAR of
age the D/L ratios for His, Phe, Asp and Ala are 0.682, 0. 473 method, but
archaeological samples. All hydrolyses were carried out using
344 years of age estimation by the 14C
6M hydrochloric acid. If the aim is the determination of the 0.271 and 0.112, respectively. In this case the D/L ratios
of Estim ates for sample 2 range from 297 to
re, pH and the com position of sol have been
ap, and we temperatu _
overl ld be
for 2 to 4 amino acids shou
of an d average 326 years. All confidence limits .
enantiomeric ratio, it is very impor tant to keep the extent of Phe and Asp are recommended for determining the age and 364 eIiminated. The D/L ratio
ed can be 95% certain that sample 2 is between 288 mea n valu e of estim ated
racemization at the lowest possible level. The effect of the samples; however, the D/L ratios of His and Ala can be us determined for each sample,
and the
yea rs of age.
reaction times and temperatures on the extent of the to confirm the estimate based on the ratios of Phe and As p.
79
78
 archaeome try?
csapo,'J" Nyberg, J., Malmgren, B., Csap6-Kiss, Zs. & Csap6, J. li:
o acid racemisation be used in
limits can amino acids and amin
Iat wa) ' what for and what
'
In w1

Einarsson, S., Folestad, S. & Josef

sson, B., 1987, Separation
ed on cali ration curves is considered the best estimate
to 344
sample 2 range from 297 precolumn deriva
ages bas
From the data it is evident that as age 1ncrease mates for of amino acid enantiomers using
. dc s e. Esti s over lap,
f the fossil sample. We have utilised this method very
y te ic of g a
6 years. All
confi denc e limit
and 2,3,4,6,-tetra-O
Years d ave rage 32
content mcreased and cystine content de
of age o . cr e as ed .
1s betw een 288 and tization with o-phthalaldehyde
J. Liquid Crom. 10,
compared with contemporary wool' the cyste1. sample 2
successfu
lly for dating fossil bone samples from Hungary. The c a c1 years an n be 95% certain that acetyl- l -thio-b-D-glucopyranoside,

ct con

between the data from the calibration curve and were approximately 10, 20 and 30 times as gre d w e ca
ce at at 50() .
differen
.
. 1589-1599.
14C d a tmg was generally negligible. However, our and 1700 years, respectively. Cystine conte I an
364 y e and decr easmg cystme and tyro sme
, Racemization of amino
Hare, P. E. & Abelson, P. H., 1967
m . cysteic acid
those fro nt d e e
reaA

re asin easing age of wool samp les have

s should not be used in other environment Jnc
.
1ess tha n 50% m 120-140 years to 3501 Ill 5
' -;o ted with incr
curve
c alibrat io
n
. 00 Yea s """d acids in fossil shells, Carnegie Inst.
Washington Yearb.
r an
cia
nditions (temperature, pH). However, base a ss estimating age of

ts
nt co 10% m 1600-1700 years The differences are conte n an accurate basis for
to provide
ere
due to diff di even o be exercised in 66, 526-536.

betl sh We or cloth. Howev
o ther calibration curves can be formulated for n er, caution sho uld
when expressed as a ratio of cysteic ac1 , Laboratory simulation of
Hare,P. E. & Mitterer, R. M., 1968
re sul ts,

on these cystine.
ment o n the basis of the methods described here. 1600-1700-year-old samples had a ratio more th wo l c
ion equations pre
sen ted in this paper.
ls, Carnegie Inst.
amino acid diagenesis in fossi
on
e predict
ir an 100 .
each env
antage of this method compared to the other as great as that of modern carpets. u sin t
working with wo ol fab ric of a different
t laboratory
at adv .
The gre
A d i11e ren either to Washington Yearb. 67, 205-212.
low size of sample required. 2-1o mg nalyse some sam
ples of kno wn age
sed w11h a ion of 1ibonuclease with
s the ve:r_ Both methionine and tyrosine contents deerea a Hirs, C. H. W., 1956, The o xidat
_i ld
methods g
n. . ou
0.1-1.0 mg protein, is sufficient for on n sh
ility of these equations
or to develop a set
performic acid, J. Biol. Chem. 219,
cont ammg In the 1750-year-old wool fibre and one of the 1 611-621.
e applicab .
siz e 600_Year.01
sam ple
t en samp1es.
th
AAR.
f
.ons appropnate forh
based on The radiocarbon age venY
wool fibres we were unable to detect the presence . dating: Great expectations,
pU
nin ation
. Marshall, E., 1990, Racemization
en
age det . of e1ther .
on met ho d can be used only for those samples tyrosme or methionine . The methiomne d des cnb ed her e we can only estimate the age
detennin
ati content of m etho Science 248, 799.
samples decreased to 85% of the original leve1 .
B th e
the can demonstrate with 100
% confidence
which are
than 80,000 years. By means of AAR 1945, Analytical chemistry
: pet, but we Martin, A. J.P. & Synge, R. L. M.,
m ore recent
. m Hl0-140 of e car een two car pet s, and we can
the me ans of Ile, Leu and Val) the age of the years, to 55% m 400-500 years and to a1 o 100 years betw & Edsall, J. T. (eds.),
of the proteins, in Anson, M. L.
y by
(especiall m st 1 'f th ere is inals if the

_ imitation amo ng orig

estimated up to 300-500 thousand years. 1600-1700 years. Tyrosine decreased by 10-15' JU Ill
10 Ill 100-140 e contemporary , Academic press Inc,
sam ples
ca n be
.
years, by 30% m 400-500 years, and was almost co

em onstrat
arpet is older than
100 years.
Advances in Protein Chemistry
mple tely ori gin al c New York, 2, 1-83.
Age est! mation of ol carpets based on decomposed at 1600-1700 years.
Miller, G. H. & Hare,P. E., 1980
, Amino acid geochronology:
cystrne and cyste1c acid content Linear regression equations, correlations and st dard Acknowledgements ix and potential of
. an Integ1ity of the carbonate matr
.
errors of estimate for the regressions of age on ammo a 'd Hoering, T. C. & King,
Ct
Fun d for Scientific molluscan fossils, in Hare, P .E.,
Jn accordan
ce with the statements in the previous chapter contents were calculated. Based on the correlatio
' ns and errors The financial
support of the National amino acids, J. Wiley &
K. Jr. (eds.), Biogeochemistly of
the age o
f ol textiles (100-1800 years) is not high enough t
d
_

of estimate, cysteic acid content was the most acc

urate Research (OTK
A T 6653, OTKA T 1491 6) and the Ministry
ledged. Sons, NY, 415-425.
M-15) is gratefully acknow
Miller, G.H., Magee, J. W. & Jull,
amin o acid racemization methods for the dating. In estimator, followed by tyrosine and cystine contents.
The of Education (MK A. J. T., 1997, Low-latitude
use the .
the other method outlined in the Introduction based c st e1c ac1d
icystme ratio was a less accurate predictor than isphere from amino

this case glacial cooling in the Southern Hem

stimation of the age dependent degree of the o dative xl either of the components of the ratio ' and methiomne References hells, Nature 385,
on the e conten1 acid racemization in emu eggs
on of some of the amino acids in their proteins can was clearly the least accurate predictor.
degradati 241-242.
Amino acids in fossils, Carn
egie
be used.
Correlations between the various amino acid contents Abelson, P. H., 1954, Moore, S. & Stein, W. H., 1963, Chromatographic
108 .
Samples of
copt textiles and wool carpets were procur d extremely high. onsidering the three most ace
_ :: Institute of Washington Year
Book 53, 97-
determination of amino acids
by the use of automatic

from the
H arian National Museum and the Hungari n
ung : es 1mators, c rrelatron coefficients were -0.980 for cysteic

Bada, J. L., 1985 , Ami no acid race mization dating of fossil
recording equipment, in Colowick
, S. P. & Kaplan, N.
pplied Arts. Samples from contemporary wool acid and cystm , -0.990 for cysteic acid and tyrosine, and 13, 241-251.
bones,Ann Rev Earth Planet Sci
0., Methods in enzimology 6, 819-
Museum f 831.

g1 ate from th Domus furniture and furnishing 1988, Archaeological age
+0.970 for cystme and tyrosine. As a result of these high Csap6 J., P ap I. & Kolt6, L., mato grap hic deter mination of amino
carpets on . les containing protein Moore, S., 1963 , Chro
he city of Ka_posvar. New wool of Hungarian Merino correatrons bet veen inependent variables, very little could determination of fossil bone samp c recording equipment,
store in t _ :-
n and epimerization, acids by the use of automati
obtamed d!fe ctly from our experimental farm. be gru ned by usmg multiple regression. However, the average based on amino acid racemizatio
sheep was . J. Biol. Chem. 238, 235-245.
to the age determination based on amino acid Anthropologia Hungarica l , 67-86. , F., 1955, Determination of
Osono, K., Mukai, I. & Tominaga
Jn contrast of estimates based on cysteic acid, cystine and tyrosine was
Csap6, J., Csap6-Kiss, Zs., Kolt6, L. &
. P app, I., 1990, Age
on, in t is case it is not important to minimise the found to have a standrud error of approximately the same size and peptides, Nagasaki
racenu zati based on the ratio cystine and cysteine in proteins
ation durmg the hydrolysis. It is, however, most as that based on cysteic acid alone. Use of the average of determination of fossil bone samples
racenuz _ 90, Iggakai Zassi 39, 156.
of amino acid racemization, Arch
aeometry
t to void_ t h e oxidation of the amino acids. In stIm ates allows compensation for errors of analysis for ics in archaeology and
imp ortan _ . Taylor, R. E., 1987, Dati ng techn
ce with this the hydrolysis with 6M hydrochloric mdiv1dual amino acids. Birkhauser Verlag Basel, 627-635. . 59, 241-251.
Csap6, J., Csap6-Kiss, Zs., Folestad, S., Orwar, 0.,
accordan Tivesten, paleoanthropology,Anal. Chem
carried out at l l0C with the complete exclusion 1971, Racemization of amino
Vehmiller, J. F. & Hare, P. E.,
P redicted age, standard errors and 95% confidence limits
acid was
A., Martin, T. G., & Nemethy, S., 1995 , Age estim ation
pheric oxygen. Careful optimisation of the reaction for estimates of age of samples 1 and 2 are shown in Table 3. ce 173, 907-914.
of atmos cyste ic acid conte nt, acids in marine sediments, Scien
has shown that the usual hydrolysis of 24 hours of old carpets based on cystine and G., 1977, A critical evaluation
Williams, K. M. & Smith, G.
Sample 1 estimates vary from 562 to 600 years and average
conditions 20.
icient and a reaction time of 48 hours is necessar Analitica ChimicaActa 300(1-3), 313-3 acid racemization to
is not suff 8 yars. All four sets of confidence limits overlap, of the application of amino
e complete hydrolysis of the proteins in th md1catmg that the stimates are not significantly different. We Einarsson, S., Josefsson, B., Moller, P. & Sanchez, D., 1987, metry, Orig. Life. 8,
t o achiev l amines geochronology and geothermo
can be 95% certam that sample 1 is between 550 and 610 Separation of amino acid enantiomers and chira
textiles.
derivatization with ( +)-1-(9- 91-144.
using precolumn rmination of methionine in
Am ino Acid ed-ph ase liquid Yoritaka, T. & Ono, T., 1954, Dete
Sample AA content Estimated age Standard error 95% C.L. fluorenyl)ethyl chloroformate and revers saki Iggakai 'Zassi 29,
proteins and peptides, Naga
g/100 g year L.L. U.L. chromatography,Anal. Chem. 59, 1191-1199.
400-405.

I. Cysteic acid 1.92 562 14.4 532 592

Cystine 3.24 600 31.6 534 666
Tyrosine 1.99 578 25.8 524 632

Mean 580 14.2 550 610

2. Cysteic acid 1.44 337 17.2 301 373

Cystine 3.91 297 40.5 213 381
Tyrosine 2.38 344 31.2 279 409

Mean 326 18.1 288 364

Table 3. Estimates and confidence limits for ages of two cmpets of unknown age.

81
80
 THE PROBLEM OF CHRONOLOGY

DAYTON, J. E.

clo The Institute of Archaeology, 78 Dean Street, Soho, London WJV GBE, UK

for large volcanic eruptions in ice cores and from tree rings give us an opportunity for a fixed chronology for the
Two dates
e Age of the Aegean and Egypt. The archaeological fallacies of the present system will be explained, and a solution
Late Bronz
fior the chaotic and destructive end of the Bronze Age itself.
proposed

KEYWORDS: DENDRO-CHRONOLOGY, ICE CORES, EGY PTIAN KING LISTS, VOLCANOES, MASS
EXTINCTIONS, SEA PEOPLES, SANTORINI, ASH FALL-OUT, TSUNAMIS, RAMSES III, THE EXODUS.

archaeologist and a geologist, has who built the three great pyramids. Herodotus' description of
Th e writer, a Middle East
Archa eometry Conferences almost since their the walls of Babylon and the Tower of Babel were found to be
attended
Oxford, and this paper is an attempt to bridge the conect by the German excavators in 1908 so why should he
begin ning at
gap between archaeology and science. The be wrong about Egypt where he also described the Labyrinth.
widening
archaeolo gists, now specialise and ignore the scientists. The 5. Astrological Venus tablets, of little value, but a solar

diffusion of technology is out of fashion. The scientist is not eclipse in Babylon on 15th June 763 BC is a fixed point from

aware of the problems, such as provenance, which the which we have floating Assyrian King Lists.

archaeologists now avoid.
It is not realised by scientists, nor by many archaeologists,
that firm dates do not exist for archaeology and h istory until
about the time of the First Olympiad, assumed to have taken
place in 776 BC. Even our modem dates are wrong. For
example Herod the Great died in 4 BC when C hrist was born.
Therefore we will be celebrating the Millennium 4 years late
in 2000 AD. The Christian era was only organised by a monk,
Dionysius Exiguus who lived in 496-540 AD. Later in
165 AD Bishop Ussher of Armagh stated that the world
was created in 4004 BC which many still believe to be true to
this day.
Like science, archaeology is a mere 200 years old.
Napoleon's team of scientists found the Rosetta Stone in
1798. In t h e 1820's Thomsen sorted King F rederick's
'cabinet of curiosities' into the 'Stone', 'Bronze' and 'Iron'
Ages that we now have.
A mere 50 years ago, only 4 aids were available for dating
the prehistoric past:
1. The Bible, with its genealogical tables, its description of
known places, and the important description of the Exodus
under a Pharaoh Ramses.
2. Five Egyptian King Lists, all of fragmentary form giving
the na mes of some kings and the lengths of their reigns. All
these lists are incomplete and floating in time.
3. A semi-mythical list of all and every possible ruler of the
"Thirty One Dynasties" of Egypt. Compiled by Manetho, an
Egyptian priest for the Macedonian ruler Ptelomy c. 300 BC.
Some of the Dynasties certainly did
not exist. Egypt consisted
of t wo king
doms "Upper" and "Lower", and the rulers may
not have actually
ruled both, although claiming to. Manetho's
dynasties add
up to 5608 years precisely from the first ruler
Menes or Minos (Egyptian like Arabic and Hebrew has no
vowels.)
4. The much maligned ancient Greeks, Homer
Herodotus.
Herodotus visited Egypt and Babylon c. 450 BC
and was
told that Min was the first to rule the two kingdoms,
and also
the names of the builders of the pyramids at Giza. He
al
b so cu nously put Sesostris a great ruler of the 12th Dynasty
Sir Alan Gardiner (1966), the great Egyptian scholar has
summed up Manetho perfectly:
"In the earlier days of Egyptology, its adepts accepted the
evidence of Manetho with child-like credulity ... and today
there are still scholars not innocent of this enoneous method
of calculation. The student has to be on his guard against
popular traditions that are offered as history, and assertions
containing a kernel of truth but resented in a distorted form."
Serious chronology only began with Sir Flinders Petric just
over 100 years ago at Abydos in Egypt. He excavated with
care, as distinct from looting pretty things for museums, and
invented 'sequence dating' by which at a multiple series of
levels, the deepest was the oldest. This method did not allow
for earlier excavated 'fall-out', when sites were levelled for
rebuilding, or for intrusive pits and disturbances by ancient
tomb robbers. Pettie reduced his original date for the Ist
Dynasty of Egypt from 5546 BC to 4145 BC. Breasted
reduced it further to 3400, and now the 'official' date has
reached 3114 BC precisely. One can see that a 'fixed' date for
Egypt is not yet a reality.
"The chronology of Syria, Palestine, Crete and the Aegean
is all based on tenuous relations with Egypt." Renfrew (1973).
"The whole chronological problem could be clarified by a
single positive synchronism which all scholars could accept.
But such does not exist." Ward (1971).
Petrie' s Ongoing Great Mistake
W hen Petrie at the end of the last century was excavating at
Abydos in Egypt he was in fact digging in rubbish pits. He
states:
"Green glazed baboons were found at about level 70 of the
Ist Dynasty, and more were found at level 28." He continues
"We have already noted the difficulty about these things being
found at so high a level .... but it is clear that the objects are all
and of the Ist Dynasty." There is also "burnished black pottery
from Crete". This was in fact Tel el Yehudiyeh ware, now
dated to c. 1600 BC.
What alerted the writer to this c hronological enor (Dayton

1978) was "At the beginning of the Ist Dynasty we meet the
efore Che
ops, Chephren, and Mycerinus of the 4th Dynasty art of glazing fully developed, not only monochrome but for

Proceeding
s of the 31" lntemational Symposium 011 Archaeomet1)', Jerem, E. & T. Biro, K. (eds.), Archaeopress -Archaeolingua, BAR-Centi: Ew: Se1: 1.
 Dayton, J. E. The p roblem of chronology

inlay of different colours. No . .

ad vance ... appears m
of coloured glaze unfl
the vanety megaliths f weste m Europe were older tha n correction curves' for caldera of 83 square kilometres in area and up to 400 m deep.
I th e XV I ? . n the produced the 'calibratio
. IIth D nast PYranu. 11s, . o k has
In the earlier Abydos repor Y Y "
t ( l 901b) we have the followmg .
and the Biblical myth that civilisation
began m t
.
hep. ;
'fitlS w 4 dates, but also remarkable climatic records over the The eruption has been calculated at five times the force and

longer holds Citi carbo 1984) volume of Krakatoa in 1883 the only comparison of a Plinian
Crescent and spread to the barbarian West no oaks (Pilcher et al. and matched
amazing statement: "Las t ye a . ears on Irish
i m any pieces of pottery closely "W'11h t h e calibration of carbon 14 dates they
are unteWillet b
tast 6 Cologne, Stuttgar t, and Gottingen. explosion in an ocean that we have.
nabI
resembling Aegean ware c errnans at
by the
.
ame t o Ii ght m the tom b of as t he temples m Malta predate the pyram
ids and S 1984). Kuniholm , Kromer and What is impo1tant for archaeology is the existence of a
Mersekha and in tha t o f D en
of the I st D ynasty" o nehen r & Delorme
pha e III is earlier han Mycenae." (Renfrew ; g IT P.USCh ne a Minoan/Cycladic town buried under 40 metres of white
Identi 1973 . \..,.. . produced a long sequenc e for Anatoli
'The body of the ware IS . have also
cal with t hat oflater Aegean Libby checked his first dates against carbo
M na 1996). Whereas the Irish, volcanic ash (ignimbrite, glassy silica shards) with diagnostic
or Mycenaean pottery, th .. nised b
500 BC (Kuniholm et al.
.
e
Pattems are conm1on on pompen, and against wood from a
boat of the . "Ulll from are not tied to any pottery which has been little published. This city of Akrotiri
Mycenaean pottery, and llldee . tune and American sequences
d no patterned Egyptian pottery CaIigu1 a, and found that they m atched perfec Of a errnan, .
also contained magnificent frescoes depicting sophisticated
. a date from umbers of the Kas
is known until the XVIIIt h tly H is
' dates for date' Kuniholm has
Ynasty. This pottery of a fabric the Near East did not fit Petrie's chronology bistoncal . .
,,
and of forms ent'Ire1 Y iorei d
an so they . k of 1305 BC which
contamed Mycenaean pottery. shipping and the siege of a multi-storied town such as Troy.
g n to E . ...
w"'0 shiPWree . .
Christos Doumas (1989:39) wonders if the warriors in the
also has doubts regarding the 'offi
gypt, and f European wiong. I t never occurred to anyone that the cml' E gypttan
character, is now absolutely d at Egypl a

ed to the second king of the Ist were wrong.

! n da tes l(u niholm
Dynasty about 4700 BC''. ships are not in fact Mycenaeans, and that if they are, "our
gy.
'.he writer constructed a chart in 1978 of ch ronolo views on the history of the Aegean c. 1500 BC will have to be
uncorrected rpose here, it is the climatic and linked volcanic
which fitt e d very well to the evolution of
da For o pu
ur
revised." The town had an elaborate system of drains and
Petrie thus establi
s hed an erronous amva 1m the Near East in the shape of true
technology
and tts events,
caused by volcani c dust which .
lowers global
.
m tree nngs that are of sewers. The houses are large, up to three stories in height,
chronology for E bron zes, coba ures, and causes frost damage
g 1ass, an d a bove a11 lin and silver lt temP erat
t h
to this day an YP t t
on w h ic t e
J
hpe1hs1sts
. Egypt, geologicall
b
.
terest. Large

volcamc erupt10ns, sueh as El Chi chon m

with large wooden beams for the roofs, and with 14 rooms on

chronolog Y 0 f
the Near East
the last place which these materials reached
Hyks s, c. 1600 BC. Anachronisms such
at the ti :: ;:
0

exico in 1982 inject

and Ae gean
still depend
Petrie's Abydos "Aegean"
pouery . . and
is tucked away m a very
dusty case in a verv dark co
J rner of t he Egyptian .
museum m
Cairo. His chronological error
":as then carried to Crete by Sir
Arthur Evans who wanted a
high c luono1ogy and 'b ent ' the
evidence at Knossos to mak
e his M. .
moans supenor to th e
lowly Mycenaeans as Palmer
(19 69) has demonstrated. Wace,
Blegen, Astrom a nd D ora Le
' vi have all expressed senous .
doubts over Aegean dat'mg .
Ill recent ye ars
In 1974 Barbara Adams was . of reeds,
able to study the diary ofone
of Petrie's assistants ' Green, at
C amb ndge. Green had a1ways
held the private view that the 'M .
' at H'1er akonpolis
ai n Depos1t
excavated by Petrie be1onged
' to the Middle Ki ng dom, 1.e.
1200 years later than the Ist D n
a huge aerosol of sulphuric acid each floor. The pottery includes 'Mycenaean' cups with
Vaphio handles. Minoan "black and red on buff' ware, many
as the silvers stratosphere. These absorb and back-scatter
and dro plets into the
true tm bronzes of Ur of 3500 BC stood Cycladic 'nippled' jugs decorated with swallows and other
out clearly. The radiation, decrease mean global temperature
incomi ng solar
amounts of up to 1 C, while the dust shows up
uncorrecte d dates for Egypt were remark birds, and a 'Syrian' jug.
ably low er,
b y signi ficant
. 'fi1cant as we shall see below:
s1gru it can be analysed.
. in the polar ice cores where
I st and 2nd Dynasty dates (c. 3100-2900) The date of Santorini's Big Bang
. . on rope and
linen were mca 2250 BC.
=
Ice cores
4th Dyn. Pyramid builders, (c. 2600-2500)
for ropes on There has been much discussion of the effect of the
Cheop s' boat = 2000 BC. Santorini eruption on Crete and Minoan civilisation, and an
Complementary to tree rings but giving more information
Middle Kingdom dates of Sesostris I, II, and III
(c. 1900 ) are the ice cores from the two polar regions. After a false start attempt, based on elaborate pottery styles and their sub
were= 1600 BC. divisions, to play down its effect. There is no doubt that at the
at Dye 3 in southern Greenland further cores have been drilled
further north at Summit, 72 6'N and 38 YW known as
New Kingdom dates of Ramses II (1304-1237) end of LM IB there was widespread destruction and burning
were = 1050 BC.
GISPI and GISP2. The Russian Vostok core in Antarctica throughout Crete. All the palaces, villas and farms were
Dates for the last phase of Knossos, Pylos, and Mycenae reached bedrock at 2083 m, and covered 165,000 years, destroyed, and never rebuilt or re-occupied. The evidence
were also = 1050 BC. giving a superb climatic record of the Ice Ages. from L aki in 1783 shows that a large part of the population
Santorini, six dates on seeds, (Zielinski et al. 1990) The principle of the ice core is that the fall-out from an and the animals would have died. Herodotus tells us Crete was

had date d 1063 BC.

=

Y asty to which Petne depopulated twice, before and after the Trojan war. If the
it. But it was even younger. atomic or volcanic explosion eventually settles on the snow of
(That the dates for Knossos, Pylos, Mycenae, Santorini & the polar regions. This 'dirty' snow which can contain up to Thera frescoe really is of the siege of Troy, then the eruption
An XVIIIth Dynasty scarab ' .
a faie. nce foundat10n plaque of
Thothmes III c. 1450 ' green f .
Ramses II are the same, whether calibrated or not is very 56 different elements, strontium 90, sulphuric and nitric acids, was after that event, quite late in the Bronze Age as is agreed,
aience bab significant, marking as they do, the end of the Bronz Age in
and a cartouche of Necho of 6
oons as at Ab ydos,
0 B C were found in the same
hydrofluorides, dust from volcanoes, lead from petrol, oxygen thus pointing to the 1159 BC date for the Thera eruption. It is
the ear East.) (The Knossos date was on barley grains.) 16 and 18, etc. does not melt in the very low temperatures, and now also agreed by vulcanologists that there was no great
arry Snuth Wnt
deposit As Professo r H
es Adams (197 4 ) . no It is agreed that Carbon 14 dating is not a precise tool, as
m period of time (a few months at the most) between the

object from the Main Dep Sit . is covered in succeeding years by more snow. The layers in
c an be safely attributed to an
early date .' At Abydos, di scu
ssed ab .
ove, a senes of New
Kingdom temples c. 1550-13 20
r est on the levelled remains
of the Old Kingdom buildings,
. hence the mix up
Based on Petne 's dates the
wh 1 e of .
. 0 Egypttan chronology
is wrong but no archaeo1og1st dar . .
e adnut it.
The above exposition, I . .
hope, ex
plain s the basis of
archaeological chronology to this
day.
Carbon 14
This was the first scientific tec .
.
hni que to stnke
and it was a revolutio n. C0Iin R
1968 to recognise itsimpo1tanc
archaeology,
en frew was one ofthefirst m
.
e but I. ts .imp cations
li h ave
still not been realised by archaeo '
It has shown that 'barbaric'
logists
are as of western Europe had
technology and a civili sa t'ion of .
. sorts earlier than those of the
Middle East and the Fert11e C
rescen t. Thi s, as the wnter
demonstrated in 1971 and 1978,
. .
. Was peitect
-" I y 1og1caI , as the
mineral deposits of copper, tin
to make
bronze
.
with copper,
and silver were all m the We
st and outside .
the Fert11e
Crescent. Tin bronzes were not
discovered
. by Mesopotanuan
pro spectors in Bohemia as Chil
de (19 9)
had postulated but
had a rrived in the Near East with .
mvadmg peoples. The great
the cosmic ray neutrons are produced by the sun which is not
a stable star. Over very short periods, e.g. 460-390 BC, and
1880-1960 AD, there have been major anomalies (Pearson et
al. 1986; Budyko 1969).
Eight samples of grain from the same storage jar at
Santorini gave dates of 2037, 1850, 1420, 1350, 1394, 1300,
1110, 960, and 900 BC. Six threads from the Shroud of Turin
produced dates of 1260, 1265, 1295, 1305, 1345, an d 13 82
AD, but they were good enough to show that The Shroud did
not date to 33 AD when Christ was crucified (Aitken 1988).
Fortunately we now have two techniques which pro vide us
.
with accurate dating within an error of 5 years, they are
nngs and the Ice Cores from the Polar Regions.
tree
Tree rings or dendro-chronology
In an endeavour to correct the original Carbon 14 dates that
ha d so upset the Egyptologists, the tree rings of the long Jived
.
bnstle-cone pine which grows in the White Mountai ns of
Nevada at a height of some 10,000 ft. (3,500 m .) w e
analysed for their Carbon 14 age and studied for variations in
cosmic ray activity. The rings also show climate ch ange and
.
dramatic climatic events, such as ve1-y narrnw rin gs caused y
b The isl
. an enor
frost damage brought about by m ajor volca nic ev ents
the sliced ice core can thus be counted individually and
visually with back lighting back to about 8000 years with
great accuracy and to 160,000 years by calculation.
The GISP2 core gave a superb record over the last 7000
years. Less than 1 m of core was lost, and large scale bedrock
folding did not exist (Zielinski et al. 1994). The dust profile
w as v ery accurate and known and unknown volcanic
er uptions, together with the dust of the Siberian meteor of
1908, clearly visible ( Anklin et al. 1993).
The volcanic Plinian explosion must be strong enough to
.
eject the dust
through the tropopause at a height of about 20
km. Some eruptions have reached 40 km. El Chichon had two
asts to 4 and
.
38 km. Tambora also two to 33 and 44 km.
esuvms m 79
AD is calculated to have reached 33 km. In the
.
; ce cores,
together with the tree rings, we therefore have a t
ast, a dat
ing tool accurate to a single year.
Santor
ini
Santonru,
also known as Thera, is the key to the chronology
f the M
iddle East, Egypt, and the Aegean, and its date will
na!ly corr
ect the cluonological nonsense of the last 100 years.
and, some 110 km north of Crete is the remains of
mous volcanic eruption which left a huge flooded
warning rumbles and earthquakes on Thera, which enabled
the people to escape with their valuables, and the final great
explosion, and so no gap of some fifty years at Knossos.
In a deep sea core no. 58 at a distance 110 km from Thera
the volcanic ash was 78 cm thick. The tephra in Core 50 at
200 km distance towards Rhodes, where Trianda is destroyed,
was even thicker at 212 cm (Ninkovich & Heezen 1965). This
shows that the wind was from the south-west at the time of the
eruption, perhaps in early Spring as some of the storage pots
contained beans which had started to sprout. The coasts of
Anatolia would have suffered greatly, so putting the peoples
of that area in motion. Knossos and Mallia are only 120 km
away so the damage to Crete can be imagined. But we must
not forget the other islands in the Aegean and the mainland of
Greece and Turkey only 200 and 300 km away.
At Trianda, at the north of the island of Rhodes, recent
excavations have revealed layers of Tephra from Santorini
from 30 to 50 cm thick (Marketou 1988). Tephra up to 39 cm
thick has been found on Kos, 95 km to the N.W. Both Kos and
Rhodes are only a few km from the Turkish coast, and Lycia
is from where the Lukka a contingent of the 'Sea Peoples'
came from. At Xania on Crete 15-20 cm of ash has been
found. A deposit of only 10 cm of tephra can put fields out of
action for ten years.

84 85
 Dayton, J. E.
There appear to be only three major volcanic events in the
ice cores and tree rings in the two millennia BC. They are at:
2345 BC in Irish oaks, with Icelandic tephra in peat bogs of
2310 BC dated by C l 4
1628 BC in ltish, German, and English oaks, in Anatolia,
and in Bristle. Cone pines.
1150 BC which is very clear in Irish oaks, starting at 1159
BC and the climatic effect lasts for 18 years until trees begin
to recover. 18 years also show up in Fennoscandia (Briffa
1994). The above information is in Baillie (1995) and the
same dates show up in the Ice Cores (Hammer et al. 1980).
But as a cave at Zielinski G. A. et al (1994) list 3 large
eruptions at 1459, 1457, and 1454 (VEI 164). Also 2 at 1192
(VE l 110) and 1190. (VEI is the explosive index).
The 1623 BC date at which archaeologists had confidently
jumped has now been proved by analysis (Zielinski &
Germani 1998) not to be from Santorini. We therefore have a
choice of other fixed dates for a ve1y big volcanic event. The
effects of which lasted 18 years. The writer will argue for the
acceptance of 1159 BC on the archaeological evidence of the
incursions of the 'Sea Peoples'.
It is agreed that the Bronze Age throughout the Near East
ends in a phase of semi mass extinction. All the archaeolo
gical sites from Pylos in w estern Greece along the shores of
Turkey to Syria & Palestine are destroyed by fire. Even Egypt
and Mesopotamia decline into darkness. This extinction
coincides with a mass movement of peoples by sea and by
land seeking food and shelter in Egypt. They come from
Libya, by sea from the islands, and by land with their families
and animals from Greece, Asia Minor, Syria and Palestine. It
is clear that this mass movement is caused not by Dorians and
other invaders but by the mass destruction to agricultural land
caused by the Santorini eruption.
The evidence from other kno w n volcanic eruptions is as
follows:
1. Santorini was 5 to 6 times greater than Krakatoa, our
only comparison for the walls of a Plinian volcano collapsing
into the sea, with the consequent inrush of sea water and the
production of glassy ignimbrites and hot poisonous gases.
Thera had a high sulphur content. The ash/ignimbrites are
fluidized when the sea water breaks in. At Mt. Pelee in 1902
the ignimbrite flow covered the 4 miles to St. Pierre in 3
minutes. The heat of the flow was 700C and 30,000 people
were killed in one minute, their lungs burnt out and their body
fluids evaporated leaving dessicated corpses. One man in the
town jail survived.
At Laki in 1783 and Hecla in 1970 in Iceland, thousands of
animals died when the volcanoes produced fluorine rich grass.
It has been calculated that if dry grass contains more than 250
ppm fluorine, animals grazing on it will die within 2 or 3 days.
In 1783 75% of all the animals and 25% of the population of
Iceland died (Sigurdsson 1982).
In 1815 Tambora ejected 150 cu. km of ash over a distance
of 1300 km and 90,000 people died of starvation when their
crops were either poisoned or destroyed. Its dust cloud created
"the year without a summer" in 1816 when crops thousands of
miles away in Europe and America failed to ripen.
The great Katmai eruption in Alaska in 1912 released so
much hydrochloric and hydrofluoric acid that washing hanging
on the line in Chicago, 3000 miles away was damaged. Katmai
also gave off traces of lead, zinc, molybdenum, copper, arsenic,
86
The problem of chronology
silver, antimony, tin, cobalt, tho1ium, bism uth
telurium. The damage to Alaska and northern c' SU Phur
1
BLACK _SE
m the period 1 9 19_ 18
. anact a.
known. Z1es calculated that .
1,250,000 tons of hyochloric acid and 200, o2 sollle
. .
hydrofluonc acid were discharged into the atmosp
00 o
ns Of
!
here.
2. Tsunamis.
These are great waves caused by volcanic exp!
o s1ons
and
by earthquakes, often out at sea. As the waves
. approach -
contmental coasts and the waters become shal "JC
lo w so
.
he1ght of the tsunami increases often up to the
35
Krakatoa. Sometimes the anival of the wave is
prec = at
the sea receding exposing the seafloor. At Puyehue
1960 people on the shore noted that the tide had
in Chile y
s dd Ill
goe out. Fi een minutes later the first of 4 wav
es 6
nly
amved, causmg much destruction. Twenty-two hour
ave reached Japan, 17,000 km away with great
s later
force and
k illed 180 people. In Lisbon in 1755 the same thing
ocCUITed.
whi1e m Japan in 1703 100,000 people were killed
.
by sueh a
. .
wave. Santonru would have produced such a series
t
. . of waves Cf)
of smu1ar magrutude causing devastation on all the
sho re s f Q)
the eastern Mediterranean. The waves would have dest ro 0.,-,
0
Q)
the Minoan/ Mycenaean fleets, and caused enormous
coa taI
d a mage. a..
The retreat of the tsunami obviously accounts for
t he al
'miraculous' parting of the waters that we hear of in 'Exodu
s'.
Someone had seen the effect of the tsunami of Santorini on
the coast of Egypt. Krakatoa caused a succession of waves of
two types, long with periods of about an hour, and short
irregular waves. They were felt 9,000 miles away in Chile
where ships broke their anchor chains. Two hundred and
ninety towns were destroyed in Indonesia by Krakatoa. The
destruction in the Aegean must have been similar. Meswesti
.......__
The evidence for 1159 or J J 92 BC 0 100 200 300Km
I. The Bronze Age ends with universal destruction.
of Turkey are within the 400 km
2. There is a great migration of peoples to Egypt fro m all Map 1. The eastern Mediterranean. Mainland Greece, all the islands, and the Greek settled shores
destruction circle. From the destruction evidence it appears that Cyprus and Libya were effected within the 500 km circle, and on
r oun d the eastern Mediterranean. These people are not
them.
raiders, but bring their women, children and cattle with the evidence of historic eruptions, the dust would have reached as far as the Delat of Egypt. Tree rings in Ireland, Europe, and
3. The map 1 shows the area affected by poisonous ash Nevada show an J 8 years period of little growth after 1159 BC. With grazing destroyed for such a long period mankind could not
from Santorini. The Libyans (Meshwesh) invade Egypt from have surviv ed in the area. A few survivors migrated and the area was wasteland that we find in the early decades of the Iron Age.
the west. The 'Sea Peoples' from Syria and Palestine. Pale stine at the greatest distance from Thera recovering fairly rapidly under the Philistines and Tjeker.
4. Egypt with the Nile's annual flood washing away
poisonous ash would have had food. Other areas would have isotope dating has shown that the sulphide copper ores of 11. The Bible. The account of the Exodus clearly relates to
required some 15 years of rain to clean the land. Cyprus were not exploited before the conventional date of a great volcanic event. The Israelite slaves are building a city
5. The evidence from Medinet Habu in Egypt depicts 1400 BC (Dayton 1984). Again a date of 1627 is ruled out. or palace for a Ramses, Pithom in the Delta (Exodus 12:37):
Ramses III (conventionally ruling from 1198-1166) defe ating Plague and a murrain that kills cattle is a n01mal after The great eruption of Santorini and the confusion and
the invaders. This date is near to the 1159 BC event. effect of volcanic events. The great eruption and dust veil of darkness (Exodus 10:21) gave them the opportunity to escape.
6. Keftiu (Cretans) still appear as t1ibute bearers at the time 536 AD brought plague and famine to the Byzantine world of We also read that the wheat and the rice were not grown up,
indicating that it was springtime in Egypt. The fish in the river
of Ramses II (conventionally 1304-1237) so Crete was not Justinian, and spread to Gaul and Britain by 542 AD (Baillie
19 9 4). die because of the acid fallout from Santorini, and the frogs
destroyed before 1237 (Pritchard 1955).
7. Herodotus tells us that Crete was depopulated t w i ce , In Exodus we hear of plague and a murrain when all the leave the waters for the same reason. The hail, rain and
once before the Trojan War, and immediately after it. "T
he cattle in
Egypt die. thunder were also caused by its atmospheric effect. The Lord
Cretans reward was to return from Troy to find plague and 9 . The Israelites were building a palace for a Pharaoh put a column of fire to guide them (n01thwards) by night and
fami n e among themselves and their flocks. Crete was the
n Ramses before the Exodus. This rules out the 1627 date, a column of smoke by day (Exodus 13:21). This must have
depopulated for the second time" (Herodotus 7, 1 70-1) Th
e Which is when the Hyksos were ruling in Egypt. been the eruption of Santorini which in spite of the curvature
g the 10. Prevailing winds. In summer the prevailing wind in the of the earth, must have been very great and visible from
durin
fall of Troy is conventionally dated to 1184 BC i.e.
reign of Ramses III.
Aegean is
the Meltemi from the north, but from the end of Egypt. Then when they had crossed the 'Sea of Reeds' the
8. The King of Cyprus writes to Pharaoh "do not take i
t to September
to the end of M ay, the Aegean has variable winds Lord put the column behind them. (In other words they had
heart that there is so little copper, since plague has kill e d all from the
south-west which would have carried the ash across reached the shore of the Mediterranean, where they met the
ad the sea to
the people, and there is nobody left to smelt the copper." Le the shores of Turkey (Map 1 ). tsunamis of Santorini and turned south into Sinai, and in three
87
 Dayton, J. E. The problem of chronology

days they came to the Bitter Lakes (Exodus 15:23). All this is known in Egyptian records as The Third Inter Hammer, C. U., 1987, The Minoan eruption of Sant01ini dated
mediat
perlectly reasonable. We also hear that they could not flee e. P lit References to 1645 BC, Nature 328, 232-235.
recov e o
hundred years 1s too long for a civilisation to
r e
through the land of the Philistines, who did not settle in from the Santonm d'Isaster. Israel and the Phil' ' ven
Hughes, M. K., 1988, Ice layer dating the eruption of
1s1Jnes

Palestine much before 1150 BC and were part of the Sea . Pro 8Per Santorini, Nature 335, 211-212.
perh aps m only two or three generations, and so ., Ancient Hierakonpolis, Warminster, England.
the St B 1974,
People that Ramses III fought against. The mention of the that Solomon started building The Temple in 1 atelllen1
AdaJll5 .. .r A 1988, The Thera Eruption, resume of dating,
Jouzel, J., 1993, Extending the Vostok Ice Core record to
erusal
Philisti nes here is a later anachronism. years after the Exodus cannot be correct nor th eIll, 480 Aitken, iv.. ., 3700 m, Nature 364, 203-207.
etry 30, 165-182.
An Egyptian papyrns "The Prophecies of Neferti" . . ' at they
8llen1
A. chaeom Johnsen, S. J., 1992, New dating from the GRIP core (revises
430 ears m the wilderness (Exodus 12:41). Greenland Ice Core Project, Nature 364,
f\l""'n, .r 1993, The
in.,
trli Ii ..
(St. Peterburg I I 16b, recto) states 'the sun is veiled and It IS also clear that Egypt with its crops and cattl Dye 3), Nature 359, 311-313.
shines not in the sight of man. The river i s dry, even the river
e de
stroyed 20 3- 207. Kuniholm, P., 1996, Long tree ring chronologies for the East
.. .r G L. , 1990, Irish tree rings and an
also suffered from the eruption, which was mu c 'llie, in. event in 1628 BC,
. . h greate
r than .
of Egypt. (This is because the emption took place in April or Bai Ill Mediterranean, 29th Symposium of Archaeometry,
has been Imagmed, or experienced in historical
fImes. D. A. (ed.), Thera and the Aegean World
The in Hardy, TUBITAK, Ankara, 401-409.
May when the Nile is at its lowest.) 'The river is blood. Oh length and vacuum of this 400 year period 166.
hasforJ vol. 3, p. 160-

tha the earth would cease from noise. Trees are destroyed, no
. .
womed archaeologists. To raise the date of Sant
onru to 1 ng
. o
L., 1994, Dendrochronology & the nature of the
Kuniholm, P., Kromer, B. & Manning S., 1996, Anatolian
M. G.
627 Baillie, &

frmt or herbs are found. The land is without light.' (cf. Exodus Tree Rings, Volcanic Eruptions, the Absolute
BC would make this period even longer. The Holocene 4, 212-217.
AD 536 dust veil event.
10:21). This is exactly describing what it must have been like Chronology of the Eastern Mediterranean 2220-718 BC,
The 1159 date fits the Egyptian dates for Ram chronology and the chrono
ses III b M . G. L., 1995, Dendro
during the eruption (Vitaliano 1973; Gardiner 1914; Pritchard UI Baillie, Nature 381, 780-782.
means that the date for the destruction of Knossos
and the nd Bronze Age, in Waddell, J. and Shee
e logy of the Irish
1950). Krakatoa caused darkness in Bandung 140 km away . . .. . Lamb, H. H., 1970, Volcanic Dust, P hil. Trans. of the Royal
of Mmoan CIVIlisat10n, which is now contemp Ireland in the Bronze Age, p. 30-37,
orary With Twohig, E. (eds.),
for three days. Mycnaean, must be reduced accordingly. Society London A266, 425-533.
Dublin.
It IS to be hoped that analysis of the volcanic dust . Leuschner, H. H., & Delorme, A., 1984, Verlangerung der
G. L. & Munro, M. A. R., 1988, Irish tree rings
. ,
Conclusions . m the1ce Baillie, M. Gottingen Eichenjahningchronologien ftir Nord und
cores nught fingerprint one of the two volcanic veils, Nature 332, 344-3 46.
da tes10 Santorini and volcanic dust
Santonm .. which we know German oak tree chronology
Stiddeutschland bis zum Jahr 4008 v.Chr. Forstarchiv
was Iich in sulphur. 1981, A 2350 year south
Becker, B.,
The archaeological picture of the Late Bronze Age reveals 1159 also gives us a fixed date for The Exodus w l, 64. 55, 1-4.
hich can in Fundberichte aus Baden-Wiirttemberg 545-5
much confusion. It is clear that it ends in massive destruction be seen to be based on fact rather than fable. of the Hyksos. British Moore, J. C., 1992, The chemical basis for the electrical
M., 1996, Avaris: the capital
Bietak,
and burning that stretches from Pylos, in the far west of Greece stratigraphy of ice, J. of Geoph. Res. 97, 19803-19812.
Museum Press, London.
to Mycenae, Tiryns, Midea, Gia, Lefkandi on Euboea, to Kea Ninkovich, D., & Heezen, B. C., 1965, Santorini Tephra in
Addenda Bond, A. & Sparks, R. S. J., 1976,
The Minoan Eruption of
and other Mycenaean sites coastwise along the shores of Submarine Geology & Geophysics, Colston Papers 17,
Santorini. J. Geo!. Soc. of London 132, 1-16.
'.'1edite aean to Turkey, Miletus and Tarsus. The end of Troy
rr , Since giving this paper in April 1998, G. Zielinski and
M. Briffa, K. R., 1994, Holocene climate change:
evidence from tree 413-453, Bristol.

growth in northern Fennoscandia, in Funnell, B. M. & Kay,

IS conventionally put at 1184 BC. From here the destruction
continues through Syria where Ras Shamra is destroyed by
earthquake and fire and apparently abandoned in a day
..
(cf. Pompen). Further south in Palestine the picture is the same.
Ashdod is destroyed by fire, but the migrating survivors of the
great catastrophe settle down after being repulsed from Egypt
y Rames III as the Philistines and Tjeker. It is interestin g that
m the Bible the Philistines are reputed to come from Crete. The
st ing refugees would no doubt have fought and plundered
therr way through any surviving cities of the Levant.
After this dramatic end to the high civilisation that we see
on the Thera frescoes, we have a supposed 400 ye ar dark age,
Germani's paper in the Journal of Archaeological Science 25
'
Spring 1998, has come to hand.
They have proved that the volcanic glass in the GISP2
(Greenland) ice core dated by counting the snowfall layers to
1628/27 BC at a depth between 766.8 and 766.9 metres, does
not come from Santorini. Eleven glass shards from Santorini
were analysed and found to be different.
This !aves he 1159 BC date alone for the very large
.
Santonm erupt10n that destroyed Minoan Civilisation and
in the Wiiter's opinion caused the massive destructio that
ended the Bronze Age, and put the "Sea Peoples" in motion
(Fig. 1).
Palmer, L. R., 1969, A New Guide to the Palace of Knossos,
Faber & Faber London.
R. L. F. (eds.), Palaeoclimate of the last Glacialln
l terglacial
Pearson, G. W. & Stuiver, M., 1986, High precision
Cycle, Special pub. no 9412 NERC, London.
Calibration of the Radiocarbon Time Scale 500-2500
Budyko, M. I., 1969, The effect of solar radiation, TELLUS
BC, Radiocarbon 28, 839-62.
XXL
Petrie, Sir W. M. F., 1902, 1903, Abydos I and II, London.
Clausen, H. B. & Hammer, C. U., 1988, The Laki & Tambora
eruptions as revealed in Greenland Ice Cores from eleven
Pilcher, J. R., Baillie, M. G. L., Schmidt, B. & Becker, B.,
locations, Annals of Glaciology 10, 16.
1984, A 7272 year tree ringchronology for western
Europe, Nature 312, 150-152.
Dansgaard, W., 1993, The GRIP core in Greenland , Nature
Pritchard, J. B. (ed.), 1969, Ancient Near Eastern Texts,
364, 218-220.
Princeton.
Dayton, J. E., 1971, The problem of tin the Ancient World,
Pyle, D. M., 1989, Ice Core acidity peaks, etc. Archaeometry
World Archaeology 3, 49-70.
Dayton, J. E., 1978, Minerals, Metals, Glazing and Man, Geo. 31, 88-91.
Pyle, D. M., 1990, New Estimates for the volume of the
Harrap London.
Minoan Eruption, in Hardy, D. A. et al, Thera and the
Dayton, J. E., 1984, Sardinia, the Sherden and Bronze Age
Aegean World Ill: Earth Sciences, p. 113-121, London.
trade routes, Naples.
Delmas, R. A. & Zegrund, M., 1989, Volcanic deposits in Rampino, M. R. & Self, S., 1984, The atmospheric effects of
El Chichon, Scientific American 250, 34--43.
Antarctic snow and ice, J. Geophys. Res. 90, 319-341.
Dou mas, C., 1989, Santorini, a guide, Rampino, M. R., Self, S. & Stothers, R. B., 1988, Volcanic
Athens Ekdotike
Athenon S. A. Winters, Annual Review of Earth P lanet Science 16,
Downey, W. S. & Tarling, D., 1984, 5 cm of volcanic ash in 73-99.
Renfrew, C., 1973, Before Civilisation. The radiocarbon
East Crete, New Scientist 1319.
D ruitt, T. H. & Sparks, R. S. J., 1981, Ignimbrite Breccia revolution, Cape, London.
Sigurdsson H., 1982, Volcanic pollution & climate: the 1783
Facies on Santorini, J. of Volcanological Research 13,
147-71. Laki eruption, EOS 63, 601.
p
nedrich, W. L., 1990, Carbon 14 dates for Thera, Thera III Simkin, T., 1994, Distant effects of volcanism, Science 264,

conference. 913-914.
Gard'mer Sir, H., 1966, The Sceptre of Egypt. Stothers, R. B.& Rampino, M. R., 1983, Volcanic eruptions
.
Gardiner Sn, H., 1914, Journal of Egyptian Archaeology, in the Mediterranean before 630 AD, J. of Geoph. Res.

pp. 100 ff. 88, 6357-71.

H ammer, C. U., 1977, Past volcanism in the Greenland Ice Thorarinsson, S., 1979, On the damage caused by volcanic

Sheet, Nature 270, 482-486. eruptions, with special reference to tephra and gases, in
Fig. 1. Part of the relief from Ramses Ill's palace at Medmiet Hab'.1, near Ham m er, C. U., 1980, Past volcanism in the Greenland Ice Sheets, P. D. & Grayson, D. K. (eds.), Volcanic Activity &
Luxor.-
,
T,ms
, sIwws the 'Sea r . i thetr
ne a p/es coming by land wit!
women, cu / 'Idren and ox-carts Sheet, Nature 288, 230-235. Human Ecology, p. 125-159, Academic Press, London.
'
. ,
The men with the 'feather head dresses are Peleset (Philistines) ,"'h . ' Hammer, C. U., 1980, Acidity in polar ice cores in relation to V italiano, D. B., 1973, Legends of the Earth, Bloomington,
.

Ii the k nabbed helmet 1s a 'Sherd en ,

,

, e man wit
. . . . .
men : enmy pe1 haps from Sardmw. The men with wigs are Egyptians takti' g ' a Pl,1.1.ist me

pnsoner: absolute dating, Journal of Glaciology 25, 349-372. Indiana.

88 89
 Dayton, J. E.

V italiano, D B. & Charles, J., 1974, "Plini

. . .,,
an Eruptions, Zielinski, G. A., et al., 1994, The record
Eaithqua kes, & Santonm Acta of the Thera of volea
lllsrn .
Conference I 7000 BC from GIP S2 core ' Science 264

i DEFORMATION OF BURN T STRUCTURES

Volcanic Tephra on Crete, Am. J. of A . . . ' 948-952 s nce
rchaeology 78' Zielinski, G. A., 1997, Volcanic aerosol
19-24. records &
tephro.
AND ARCHAEOMAGNE TIC ERROR
chronology of the Summit' Greenland

Wolff, E. W. & Peel, D. A., 1985, The record Ice cores J

of g1o ba1 ourna/
.
poII ut10n .
. poIar snow & ice, Nature 313.
of Geophysical Research 102, 26625-2
6640. HEDLEY, I. G.,1 & BILLAUD, Y.2
'

m
Zielinski, G. A. & Germani, M. S., 1998
Zeigler, P., 1970, The Black Death Pelican Books . , New I
ce
, London. evidence challenges the 1620's BC age fo
r the S an core 1 Laboratoire de Perrophysique, Departement de Mineralogie, Universite de Geneve,
tori":
(Mi noan) Emption, Journal of Archaeological 13, rue des Maraichers, CH 1211 Geneve 4, Switzerland,
sc1ence25,""
2Departement des Recherches Archeologiques Subaquatiques et Sous-Marines, DR ASSM Annecy,
58bis rue des Marquisats, F-74000 Annecy, France

data sets are now available for various regions of the globe, howeve1; the scatter in the directions is larger
Arch aeomagnetic
would expect from a consideration of the stated errors in direction and age. This is despite laboratory tests designed
tha n one
poor quality magnetic data. Various sources of error have been investigated over the years, such as magnetic
to elimin ate
a kiln wall fall-out, and magnetic anisotropy. Little attention has been given to possible movement due to subsidence
refr ction,
overburden. This is because post-abandon defomwtion of hearths and ovens is difficult to assess as these
or pressure from
at high temperature in antiquity. The recent discove1y at Laprade in the
structures could have been deformed whilst functioning
Fre nch RhOne valley of a series of flat hearths dating from the Late Bronze Age /lb has enabled a defomwtion test to be carried
out by AFAN along
out. This archaeological site, between Orange and Montelimm; was one of many rescue excavations carried
the future Valence to Marseille TGV line. One of these hearths was markedly dome-shaped and gives the poorest

archaeomagnetic result of the hearths analysed. However, if the individual specimens from the dome-shaped hearth are tilted
back into a horizontal position the archaeomagnetic result is greatly improved, and in better agreement with the other hearths.
This study shows the importance of applying, where possible, a tectonic correction to the archaeomagnetic analysis of defomied
structures.

KEYWORDS: ARCHAEOMAGNETISM, HEARTHS, DEFORMATION,

FRANCE, RHONE VALLEY, LATE BRONZE AGE.

Introduction deviation of the magnetisation from the direction of the local

One of the most striking features of compilations of
directional archaeomagnetic results, certainly in graphical
form, is the scatter in the data. This is significantly larger than
one would expect from the estimates in the errors (both in date
and in angle) of the individual data points. The possible
source of errors in archaeomagnetic investigations is a
problem that has been addressed by many workers in this field
since the 1960's with a view to improving the quality of the
an alyses.
Measurements on samples from an experimental Roman
pottery kiln (Weaver 1961) showed a systematic deviation of
the directions of remanence towards the centre of the kiln
Which was initially interpreted as due to movement of the
walls due to firing. Hence the term "kiln wall fall-out"
although subsequent measurement of the form of the kiln
(Weaver 1962) failed to substantiate that distortion of the kiln
was the cause of this effect. However, the name has stuck.
A study of the scatter of directions in samples from British
'.111 d Cretan kilns (Tarling et al. 1986) indicates that the cause
is not m
agnetic and the authors suggest that movement of the
st ructures
could contribute to the dispersion.
Following the detection of a magnetic refraction in a series
of mediev
al fireplaces and ovens (Schurr et al. 1984)
measurements
on two experimental kilns by the same group
(S offel 1
990) showed a similar effect, however this was too
large to
be explained by their model calculation.
Ii A recent appraisal of magnetic refraction by Evans and
oye (1991)
using data from 30 Mediterranean kilns shows
that the effect is not an important one. The authors conclude
th at o
nly in the most magnetic strnctures is refraction
Possib le ,
and only in the most unfavourable case could the
magnetic field attain a few degrees in angle.
It would appear that deflection of the vector of
magnetisation is possible in certain cases but that the exact
mechanism is still not properly understood. For this reason
baked structures should be sampled as thoroughly as possible
to evaluate the presence of a magnetic distortion.
Archaeological site of Laprade
The site was discovered in 1996 during rescue excavations
carried out by AFAN (Association pour Jes Fouilles
Archeologiques Nationales) in the French Rhone valley along
the future Mediterranean TGV (high speed train) line between
the towns of Montelimar and Orange. It is situated in the
broad alluvial plain on the left bank of the River Rhone near
its confluence with the River Ardeche. Laprade lies in a
privileged position at the cross-roads of two axes of com
munication; the north-south Rhone valley and to the east, the
Aygues valley leading to the Alps whilst to the west the
Ardeche valley is an access route to the Massif Central.
The archaeological layer is at around 1.2 m depth covered
by a series of pale to yellow silts. The surface excavated
(7350 m2) revealed 7 houses dating from the Late Bronze Age.
Occupation of the site is dated by the ceramic finds to the Late
Bronze II b period and radiocarbon dates give an interval
from 1200 to 970 BC (1 sigma).
A series of flat hearths of baked clay was found associated
with these houses (Fig. 1) and three of these (the best
preserved) were chosen for an archaeomagnetic study. Their
dimensions varied from 70 cm to 1.5 m and their hard baked
clay surface was cut by polygonal cracks. One of the hearths
(2014). unlike the other two 0012. 1019) which were
 Hedley , I. G. & Billaud, Y. Deformation of burnt structures and archaeomagnetic error

Surface of first manual cleaning

VALENCE
after mechanical removal of overburden
T
;
;
Gd House
; Hearth
; Pit
;
0

;
;
Plan Section
;
; Baked clay (floor),
;

yo22uso i
;
;
/
/
/
successive stages (section)

; /
/
/
/ [:-:-:::-:::-=-:-j f:-:-:::-:-:-:-j Partially baked clay
; ..... /
/ /

;
;
/
/
/
/
/
/
l'..-..'.:)l9J21 Gravel
/ /
Silt with carbonate nodules
mi /
/
/
/
I II I
I!!! / /
Cl!/ / /
/
Clayey silt
:;:;i
.
/
/
l:tMtttJ Hlf:Htfl
(!).,
/
/
i-:1

;
; F1012
/

/
Silt, traces of firing (section)

y: 221.1
;
+IF1019 E
;
'8till 4
I

0
i 3 I{)
LAPRADE
; 0
;
;
;

;
; IJ5 0

0 0,50m

n of archaeomagnetic samples.
Fig. 2. Plan and section of deformed hearth 2014 with locatio
bull's eye
0
0
Results / spirit level
M

le
The archaeomagnetic results from the three hearths are
shown in Table 1. All three hearths give acceptable
/ /
'' -...____ ... - '- \
(2014) -
/\ _,,--...../ / \
-
Fig. 1. Geographical location of the archaeological site of Laprade. archaeomagnetic results with the dome shaped hearth
b.
showing a greater dispersion of the directions of the individual
ho1izontal, was markedly deformed into a dome shape mrnw corresponds to the strike of a geological sample. The specimens than is the case for the other two hearths. The mean
. .
(Fig. 2). The discovery of the disturbed hearth along with the inclination of the smface (dip) was measured using an directions of all three hearths are similm with 2014 having a
. magnetic North
others from the same period enabled a field test to be camed electronic inclinometer (Anglestar, 0.1). slightly lower inclination than the other two.
. .1ar to th e fold test in palaeomagnetism.
out smu A portable magnetic susceptibility meter (Bartington MS 2, Considering the longer reversed store period the viscosity
/
probe D) was used to select those parts of the hearths which coe fficients (Table 1) are reasonable and the remanent '-
Experimental study / '
,,,--...../ / \
Sampling had been the most heated. This is due to the large incr ease in magnetisation of the hearths can be considered to be stable.
c.
_

susceptibility of the clay with maximum heating tempe rature. Co ncerning the possibility of a magnetic refraction in the
The b aked clay surfac of the hearths was sampled in the thin sheet of the hearth it would seem that the intensity of
. Elevated temperatures can sometimes lead to a slight lowering

field usmg the g ued-disk technique (Clark et al. 1988). of the susceptibility due to vitrification but this can be eas ily ?1 ag netisation is not sufficiently high for such an effect to be
Fig. 3. Archaeomagnetic sampling method;
A polycarbonate disk 25 mm in diameter and 5 mm thick was recognised due to the greater hardness of the surface of t
he impo rtant. Calculations of Coe (1979) show that for a thin Glued disc technique.

stuck on the surface of the baked clay using a few drops of vitrified clay.
sheet with magnetic properties similar to the baked clay of
the thicker and
instant glu e (cyanacrylate). The plastic disc enables an Laprade one could expect a shallowing of the inclination of subsidence of the poorly fired edges around
.
0nent auon arrow to be easily drawn on the . around one degree. better fired centre.
specimen an d Laboratory analyses to those of
serve s as a ps

1p ort for fragile samples (Fig. 3). Because of the anomalous shape of 2014 it was decided to The mean direction of remanence moves closer
be disting uished at the 95%
A geologist s compass (Brunton) was used to draw an on apply a bed
ding correction to the individual specimens by the other two hearths and cannot
The specimens of baked clay were trimmed, using n
arrow m th e d"Irec!Ion of magnetic north on rotating each of them about their strike so that their upper confidence level.
those samp1es magnetic tools, in the form of cylinders (diameter 22, le n gth
wh ich
.
. were honzontal. The possib
le influence of a strong1y 18 mm) to fit inside the measuring space of the magnetome r,te Utface ?
ecame horizonta l. This is equivalen t to the
magn euc h earth on the compass needle was reduced by usmg
. Ypothesis that in antiquity the hearth was a horizontal sheet
Conclusions
. a Mo/spin fluxgate spinner.
a 10 cm p1 ast1c di stance ed of baked
. .
piece between the compass and the The magnetic stability of the samples was investig at clay. The dispersion is then much reduced with
are alpha 95 Application of a tilt correction to the deformed hearth of
heru1h. The. direc!Ion of the orientati"on anow . was then using a viscosity test (Thellier 1981) where the sa m ple s % dropping from 3.4 to 1.4 and the precision
chec ked usm a sun compass, thus eliminating any influence n .a ara Laprade not only improves the precision of the archaeo
re-measured, after having been stored for one month i meter increasing from 90 to 490. Such a dramatic
of the m agne hc haith on the orientation procedure. n eUC imp rovement strongly suggests that this hearth was deformed magnetic result but also brings the mean direction obtained
reversed position with respect to the laboratory Geomag
In the case of lilted samples a hmizontal arrow was traced w h at fter the last firing and that magnetic instability is not into better agreement with the data from the two other hearths
e
field. The samples from Laprade were kept for a so m
. , import from the same site. The unique chance of being able to carry
on the disc s upper surface using a small spirit level, this longer period (9 months) in a reversed position. ant. The deformation was most probably due to

92 93
 Hedley , I. G. & Billaud, Y.

b N
TOWARDS A RADIOCARBON CHRONOLOGY
OF THE ROMANIAN PREHISTORY

LASZLO, A.

Fae. Jstorie, Universitatea "Al. I. Cuza" Bd. Colou No. 11, 6600 /a:ji, 9, C.P. 1802, Romania

radiocarbon datings regarding the Romanian prehistory. It is remarkable

roposes to draw up a balance of the
The paper p
s spread from the Middle Palaeolithic (Mousterian) until the Late Bronze Age (Noua-Sabatinovka
a ailable 269 dating
thatth ; rox. 50,000 BP - 3100 BP/1300
CAL BC, cover very unequally the various prehistoric periods and geographic
culture , p new datings of Romanian archaeological sites to establish a coherent radiocarbon
as. Consequentl y we need
cu/turazl are
'

Hearth 2014 "in situ" of the prehistory of South-Eastern Europe.

Hearth 2014 ogy in the context
Mean directions 10 chrono
all specimens horizontal 12 1 Otg
and 2014 (horiz. sp KEYWORDS: ROMANIA, PREHIST ORICAL CHRONOLOGY, RADIOCARBON DATING.
. . . ecfmens
Fig. 4. Stereogmpluc pro1.ect10
.
ns a - Heart/1 2014. 1n-slf . .
)
. u d1rect1ons; b - Hearth .
. .
2014.. All specim ens plac Sources of radiocarbon datings represented in Table 2.
c - Mean directwns, hea
rths 1012' 1019 ' and 201 . . ed horizonta Introduction
4 (honzontal specunen l
s). (with further references)

with doubt by archaeologists (see

Viewed,at the beginning,
Structure N D ec1mat10n

Inclinat1"on alpha 95% k NRM #(A/m)o 1: Honea 1994: 145 (Tab. IV. 64 PCB).
Viscosity(%) 1958), starting with the 70s the radiocarbon
oumitrescu
1012 18 8,5 gains in importanc e also in Romanian 2-3: Piiunescu 1984: 236, 237 (Tab.I),238; 1993: I86.
dat ing gradually
62,0 2,8 153 ,8 2,91.2 9.62.4 up a balance of the 4, 6: Damblon et al. 1996: 192 (Tab.7, no.59, 29).
prehistory. The m of this study i
.
s to draw
.
datmgs for the prehisto ry of Romaru a, 25 y ears 5, 7-10: P iiunescu 1984: 239, 240 (Tab.II), 241.
1019 18 6,8 radiocarbon
64,6 2,6 179,3 publication of the first paper in this domain I2: Piiunescu I984: 240 (Tab.II), 241; Mantu 1995: 2I5.
1,8 0.9 7.43.2 after the
1974a, 1974b). For this purpose, all available 14C 11, 13-41, 43-46: Mantu I995: 2I5-225, 231 and Anexa 2,
(Durnitrescu
point for no.2, 4, 9, 15, 17, 21, 28, 27, 33, 38, 44, 46,24, 26, 95,
data at this moment have been gathered,as a starting
2014 21 9,5 60,6 3,36 90,5 3,7 15 ns I00,30,59,62,63,87,88,89,92,9I,IOl,102,109,I07,
5.8 1.9 the evaluation of the actual stage of the investigatio
114, 103, 105, I24, 125.
concerning the absolute chronology of the period between the
2014cor* 21 11,2 64,1 1,44 489,7
Middle Palaeolithic and the Bronze Age. 47: Ciugudean 1996: 145.
48: Popa and Boroffka I996: 56.

* All specimens horizontal. Available data 49-50: Palinca I996: 244-246; Fischer 1996.
N : number of specimens. 5I-52: Laszlo 1993: 28, 32, Tab.I,Fig.I and 3, no.4, 7.
# NRM, (natural remanent magner At the present time there exist 269 radiocarbon datings
ization), average value stan

dard deviati on. Observations

obtained from various European and, to some extent,
Table 1. Archaeomagnetic American laboratmies (see Table 1 and 2., Mantu 1995:
data: Late Bronze Age hea
rths from Laprade. 226-230) succeeded to record 125 radiocarbon datings Unfortunately, the available datings cover unequally the
out archaeomagnetic analyses on both de" concerning the Late Epipalaeolithic, Neolithic, Aeneolithic va1ious prehistoric periods and cultural areas. E. g., from 123
ionned and un- Schurr, K., Becker, H., & Soffe
deformed structures from the same period and . l, H. C., 1984, Archaeo and so-called Transition period from the Aeneolithic to the datings for the P alaeolithic and Epipalaeolithic, I20 regard
. on the same stte .
magnetic study of medieval exclusively the regions situated east or south of the
has shown the importance of using a tectom'c . fireplaces at Mannheim Bronze Age, while Laszlo (1997: 250-265), 200 14C data
. . . correction where
Wallstadt and ovens from Carpathians (see Boroneant I980-1981; Chirica 1984, 1986;
this 1s possible. At the same time it also cons Herrenchiemsee (southern regarding the interval between the Middle Palaeolithic and the
. . t'tut
1 es a fi1eld test
Germany) and the problem Damblon et al. 1996; Honea I994, 1995; Piiunescu 1984,
for the magnetic stability of the baked clay. of magnetic refraction, "Ochre Graves" of the Aeneolithic/Bronze Age transition
Journal of Geophysics 56, 1-8. 1993: 185-186). Concerning the Neolithic and Aeneolithic
period. It is remarkable that Romania is one of the few
Soffel, H. C. & Schurr,K., 1990 periods and the Transition period from the Aeneolithic to the
Acknowledgements , Magnetic refraction studied European countries without a radiocarbon dating facility. In
on two experimental kilns, the last decade, as far as the post-Palaeolithic cultures are Bronze Age, we have the same situation: only a few
Geophys. J. Int. 102,
551-562. concerned, besides conventional (expressed in radiocarbon Transylvanian cultures benefited from radiocarbon datings
The excavations at Laprade were carried
.. 0ut thanks to the Tarling, D. H., Hammo, N.
unfailing encouragemen t given by Vale . B. & Downey, W. s., 1986, The years BP) 14C datings, the usage of calibrated data was (see Breunig 1987: 117-121; Dumitrescu 1974a, 1974b;
ne B e1, an d Fre'derik
,
Letterle and also the perseverance of the

scat er of magnetic direct
ions in archaeomagnetic initiated too (see Petrescu D'imbovita 1987: 22; Gimbutas Mantu 1995; Monah 1978, I987; Monah et al. 1986).
. numerous members
. studies, Geophysics 51, 634- 19 91: 458, tab. 12; Laszlo 1992-1993: 65-66 and 69, tab. 2, Finally,for the whole of Bronze Age we have at present only
of the excavation team. Jacques Metzger help 39.
ed with the fimal Thellier, E., 1981, Sur la
. . direction du champ magnetique for the absolute chronology of the Cucuteni-Tripolje culture), 10 datings (Ciugudean I996: 145; Fischer 1996; Laszlo
vers10ns of the illustrations.
terrestre,en France,durant les at pr esent
deux derniers mill enaires, working especially with the calibration programs of 1993; Palinca 1996; Popa and Boroffka 1996: 56). T here
Phys. Earth Planet. Inter. Stuiver and Reimer (1986), version 2.0 (Table 2, no. 11-41, are important differences between the dating of different
References 24,89-132.
Weaver, G. H., 1961,
Magnetic dating measurements, 43-46), OxCal 2.13 (Table 2, no 49-50) and Pearson and phases of certain cultures. We have no data for the
Coe, ., 979,The effect of shape anis
Archaeometry 4, 23-27. Stuiver (19 "Protostarcevo" and Early Starcevo (Criz-Koros) periods,
otropy on TRM 86) (Table 2, no. 5I-52).
Weaver, G. H., 1962,A rchae
direct1on, G ophys. J. R. Astr. Soc. omagnetic measurements on the T able 1 shows the distribution of the available data by that makes the understanding of the process of neolithisation
56,369_383.
second Boston experimen
Clark,A. J., Tarlmg, D. H. & Noel' M .,198 tal kiln, Archaeometry 5, Perio ds, cultures, phases
and historic-geographical regions; more difficult. W hereas for the Cucuteni A phase we have 34
. . 8, Developments
. 93-107. the last datings, for the Cucuteni A-B phase we have only 3, and for
m Archaeomagnet1c Datmg in column presents their summarized range of time (in
Britain,Archaeometry 15,
ra dioc the Cucuteni B phase 4 datings are available, and the
645_647. arbon years BP and in calendar years CAL BC), after
the eli examples could be continued. It is obvious that not every
Evans, M. E. & Hoye, G. S " 1991, Magn m ination of the data appreciated as erroneus. These
. . . fract1. 0n and
et1'c 1e
data are
archaeomagnet1c fidelity,in Archaeometry based on 52 selected 14C datings, represented in the data have the same reliability and that is why a criticism and
'90, 551-558
.
Bll'khauser Verlag, Basel.
'
Table 2. selection of them are indispensable (as should be done for

94 Proceed
ings of the 31" /11tematio11al Symposium on Archaeometry, Jerem, E. & T. Biro. K. (eds.), Archaeopress - Archaeolingua. BAR - Centi: Eur. Se1: 1.
 gy of the Romanian Prehistory
Towards a radiocarbon chronolo
Ldsz/6, A.
---------- - ;;E'"A(;"EB
r l.ABORATORY MATERIAL'

j__
' 1 P
JPERIODS tv_1B_ E_ R_O_F__- 1_4_D_A _T__
C_ A _ ENTIRE RANGE OF DATA(!
-
1 S\U.-- z:lil:TURE
. NO ANALYSE
-

l _N _U_

t\
--

1---
\ .
:
J - \No: ( l_<:;L__
i h'OT AL
J
-
I
: __ _ _____
I

P hases
Cultures
Historic-geographical regions
DATA 1>------_J
. ; \ . . .. .GrN - 0 5 .
+ ----

I
- ---
D JG B T BP CAL BC
I
l 2
.:: ... ..
,,
.
'B
-.--. , 54000 +
\ Mouste.nan
M W 0 15 5 .
BB,CIW
!
_
- 11230
L--
\
\
f--;--\:Ri p j;;- - ;;i;;; niv.lll Mo
l Bor o:;;tcni
l 1 ustrian GrN 1-.17M
L 1 ! 3 4 5 : 6 7 8 9 10 11
46400

i I 28
IT C +4700 +170{)
1
r;:.-air; H ! I 11 1 14 !>54000146400 -29700
-2900 CiW. A
i
I
.

Cheii" - \Late rvloustcn:m

I
-
-1400 ---- -

! """" rRhmo v
--

"GLIT\ "9700
i i l
-- -

\ n1v.\lb
fUPPER PALAEOLITHIC
-

l Aurignacian
! Gravettian I
23 I 32730 220- 241001300 GrA- 1357
GrN - 10529
32730220
24100 1300
\C
Ci\V. A..BB
s1 4 57
l 28910 480 - 16150 35
i EPIPA LAEOLlTHICi - . ...{.. ... . . . - .. .... .. .
; ME SOL IT HI C GrN _ 12636
c;;N:_1_(;52g----t--16lsiH 350
i 289LO:':_< .. . L.c'. _..............................
! Tardigravetlian 12600 120- 10125 200 + \ C!W. f\
i Schela CladoV"_'_ i -. .
I CIW. A
_-1-
__,_ ___ 1
, 1-+-- i l_l_ +-_ _ 8_0_4_0_ 60_-_7__
_ 1 _ 19_5_
_ 1o o_ 6 2_
_ -t---_1_ 0-_ _5_97_ tl_ -I .
...... j. ............
_,___ _
_. , __
- \ L2600 120
ITardenoisian
_______
!
l NEOLITHIC.
7850 215 7060- 6450 i I
... .. ..
. ; .. .. I
j C.:'\V, A. .BB
....-.

, AENEOLITHIC
l\ii2S .i 200

! Starcevo-Cris lll - TV I
i
i j
4 6 6665 45 - 5860 60 5630- 5494
804().;, 160 ! ("i\V
i i -4835-4715

! Vinca 1-Dudesti) B-C 4 6325 60 - 5865 95 1 5338 - 5233 I

9

um
- 4896- 4621
esti j I j
1
6280 JOO 5330- 5148 i
! Linear Pottery 1 !
5319- 5070 1 1 2 ! 6245 100- 6170JOO

t l 1
52
-------+---l---+'1 -+--i---+---+--.;---+----------1-- 9_::_:2:.?J
! Boian IV (Span\ov), I
! Transition I
'1_'1_-_9''.'"_lfllt<: t---_:_-
:
5060- 4780
-
_J _E_+-_5_ 98_ 5 12
_ _0_-_ 5_7_0_5_
__-+-__471
_ 80 _ _ 3_ -_ 4_4_6_6-ci
I G u meln i Ja A2
___ __ +- _ _
I I :I 14 I. I I 15 5715 70-5360 70 4713- 4481
' I l - 4336 - 4046
! P etr eti A 3 i 5900 100- 5710 100 4933- 4720

- 4720- 4460
i S;kuJa 11 TJI 6 6 5710 45 - 5260 60 4668- 4504
- 4226-3998
_ 1_11_ _____;__-+ _ 2 --'-- 2
-+ -+---"---l- -+-- -+- _ 0
_ _ 5_88 _ _ 7_____
_
_ _ngi a 89
_-+-_4__ 4 _-__47_1 _8 _
j Precucuteni II - 111
;: a
_ _ma o_
5820 50 - 5530 85 4780-4619
H
4 4

t
- 4465 - 4339
i Cu cu e ni A 1-4 25 9 34 5690 50-520.5 I 00 4662-4469 !
i -4222 - 3827 i
I Cucut e ni A-BI 4214-4002 ......i... ........................................
I i
5246 24 - 4996 26 !

\ ic

[-cucuteni B 1-2
-3902 -3715
4 4 5162 37-4890 29 3999 - 3970 ! l CIW
- 3772-3646 !

l "Aeneolithic" 2 i 2 7325 80 - 6660 60 ' 6222- 6087 !

! -5631- 5488 i
j AE NEOLITHJC - !
I ibPERIOD I 3633- 3360 ;
l
1 Cernavodal I
I
4 4 4710 100-4385 100 - 3299- 2910!
-
1l --1--+--4-+ --+-
'-c- .e-1e-i--------+--+ 1 4 4655 55 - 4!35 45 35o s- 335s
1----- ------
i --ii---+--+----
+- --i--i-; --+---+---- - 2875- 2615 !

_ _ _r _1 ----l ---
Coofen i I I 1

, Horodistea I - II
__ -
! ' -'-- -l-- -l
! !
i 3 _ , ___
-
9
__
12
-+- ---
4 570
1 - - - _

60- 4030 75
J
- _ _ _ _ _ _ _ _ -- - f--
- ;_ ;
_ _-;0
-
_ -j
1' j
i 4495 18 -4235 30 3331 - 3101 !
---------+---1-,--!----t-- i l
i +--+---t----+---1------------+-
'
- :::.
2908 _:__ _ i
.::_.:__:_;
.:..: -2783
I Ochre Graves I 4 ' T
i
4280 65 - 3400 150 3011 - 2785 !
I i
! EARLYBRONZE A GE
- 1900- 1520!

! Livezile Group
'MIDDLE BRONZE AGE
. I i
!
4109 44 2700 - 25&0 ,
l 42 li Co1o feni 111 UZ-2 870!ETH-'J278 4010 75
iB
I'
Po ana Ampoiuhu
i
IWietemberg III (C) I
4495 18
5 2 4 _:_

__:_:_.::_
HD-14785
-----C-__:_:_.:.=._
l
!t -+---t--+--1--t---+- -i- ------
\ Horndi$te
_
. 4J Ii Honx\i_::"_'I_.
rLATEBRONZE_ A_G_-E ----i
--
1685-1
1 HD- 1489g . \ 4215 30 .... \
Horodistea .

Ti;\I,<
\ 4 ! Horodistca . !
3270 30- 3200 30
rN 19 !C
! \Te 1/Ve rbicioara lV-V)
-1280 65
, Fundeni - Govora 4 4 1
1610- 1460
:;; ;;;;;;
!H;-
. ... .. \ . .

_

. ..
G

95
: 1o - :-J400c' 150 C
--1

I,
.

' - Bl n 25 \
i'
- --
-1510-1425 .'

\ 46 Gl-._i .......... . . ...{ . .... ... .... ......

I Ochre Grav ... . ... ...
es
.
.. ..... .. .. -- 4- - -
-s1;0( 4- -;;_- 4 t 09 44
I ... .... ........ ..... \ .L1vezi c Gro
l up ...

i
i
--. .?... .L, --'.:._ ..:.'..-:--::
... <. . 1 i_- \vi--;-ili" (c )
. Bl -4622 --1\ ? (: 1 68 5 -t 5'24BC11.
\ 48 l Sih1 oara . -- - .... .
n
. mttent
+ -+--+---+-+--+--+--- -------l- ---__J
_j__-+-- \ I Viilor"

l CiW
--+-- --

I
B
- _______

.
3270 30
o
\ 49 .Popesii
n 6101
u 1 1i
Noual-1 1** 4
_

_j_ \\
f d Ve:rb
e - lcion -
3260JOO- 3100 + 55
Ci w
1 ra rlV-V

a :l.) ,- - ---i--32()(;-;:J"(l-Ci\/:I
1 680- 1430
:, C/ W
--

- - -;;-
I _

105:--
cTi/
-;;;;-;
soh
-1434-1313 l
:
L ---- ---
--- -
-- -
j; -Fundem - Govora B-6 3200 + 30
.
\ 50 Popeti ra IV- \'') .\---- -- - ..l --- . ...... .... .. . .
-
*Abbreviations: M =Moldavia; D =Dobroudja; W =Wallachia; 0 =Oltenia; JG = Iron Gate; B =Banat; T =Transylvania
Bin - 1086

\tTei!Verbic1oa
1

\ . ; ---- ------- ' ,___ ___ 3260 JOO .L.. .. ---- -

_ ... -
* *For the estimated range of data we took into consideration the six 14C datings obtained for the Noua I - II site of Mah ala,
-

N ,ua l
GrN .
SI \. Mahala. 111\ . U a
--
_,___.
31\l(U 55
_ ..-.:'..'. _
j -_.::.;_ _
:..:. ..: :
_ _-'---
near Cerniiufi (Cernovcy, Northern Bukovina, present-day Ukraine). We do not have the pemiission to mention here the four -____j_ ':'._:
ol3.5
l NOlm Ll -
-l_J..:. .:--:::...i._1_';_.-..-1?. .. . ood.
14C datings obtained in the Groningen La.boratory for the Noua-site of Crasnaleuca, Botoani county, North-Eastern - e; C =charcoal; W =w
ONS: A =ashes; B =un
burnt bone, BB - burnt bon
*ABREVIATI
Romania. T hese datings will be published by Mrs. Lidia Dasciilu.
esented in Table 1.
radiocarbon dati.ngs repr
Table 2. Appendix to the
Table 1. The distribution of the available radiocarbon data by ages and regions.
97
96
 wsz/6, A.

the Mitoc-"Malu Galben" upper palaeolithic site Damblon et OF CORAL BA SED ON A MINO ACID COMPOSITION
E ESTIMATION
Fischer, C., 1996, Probele 14C din valul de
e
b
al. 1996). Taking into account these criticisms, the values in de la Popeti (jud. Giurgiu), SCJVA 47(3), rollZu! !G
2
5 NYBERG, J.,1 MALMGREN, B.,1
the last column of Table 1 might suffer slight modifications. Gimbutas, M., 1991, The civilisation of the Go
dess 2
CSAP O, J., CSAP O -KISS, ZS. & CSAP 6 JR.,
of Old Europe, San Francisco. . h ewo 2 J.3
Conclusions Honea, K., 1994, Tranzitii culturale In pale
oliticu1
superj
timpmiu i cronostratigrafia de la Mitoc -M
alu G alb 'Geological Centre, University of GOteborg, G0teborg, 41298 Sweden,
The available . . . enG Hungary,
radiocarbon data do not cover, B otoam). Arheologia Moldove1 17, 117-146. Ud. 2fjaculty of Animal Science, Pannon Agricultural University, Guba S. u. 40., Kaposv{u; 7401
geographically and temporally, all archaeological pe1iods, Honea, K., 1995, Ambiguities of Aurigna Departmen t, Janus Pannonius University, Jjj u sdg u. 6., Pe es, 7624 Hungary
cia n - G ., ra 1 Sciences Natural Geography
cultures and phases; we need new datings to be able to outline raveltj t 0F1Yatu .
J Facul y 'J
'

surfaces at Mitoc-Malu Galben, Botoani . an

cou nt
a coherent 14C chronology of Romanian prehistory in the Prut Valley: 39 14C and AMS radiocarbon valu
es YMMiddle
emoriQ
context of the ancient times of South-Eastern Europe. Antiquitatis 10, 173-183.
'
. n of corals aged between 1 and 250 years was analysed by ion exchange column
"''he ammo aczd (AA) compositio .
age; the greatest
However, through radiocarbon datings, the first absolute Laszlo, A., 1992-1993, Le sud-est de la Transy 1'
that the concentrat ion (g AA/JOO g sample) of all AAs decreased with
vani d hY It was established
datings were obtained for the middle and upper Palaeolithic, neolithique tardif et le chalkolithique . Nouvelle ans
sd n
le chromatogra.p
as observed in those
(Tiu; Se1; Cys, Met, Tyr, Lys,
AAs which are particularly sensitive to environmental influences .
as well as for the Epipalaeolithic. Further, for the Neolithic considerations. The Fourth Millenium BC Pnvc
ee s i e " rease w
uec
ration of His,
Asp, Glu, Pro, Gly, Ala, Val and Phe decrease with age, but the decrase
.
m concentrat1n .F J
' eedmgs e con cent . . _
and Aeneolithic, the "long" chronology prevailed over the ,, Arg). Th acids are the least senslflve to environmental influences. With respect to the
pmtem
"short" one. Moreover, a revision of the chronology for the
the Intrnational Symposium Nessebur, 28-30
Georg1eva, P. ed., Sofia.
August 1 99
' i lle an d L eu was very small. These two amino
AA/JOO g protein) it may be asserted that the
highest decrease can be observed m Tiu; Ser an d Tyr, w h Ii are
zc
beginning of the Bronze Age, as well as for the whole of the 'the cora l (g
OJ
significant m the case .F
o1 M et an d C ys, I
tie two su lPhu1--
Laszlo, A., 1993, Dates radiocarbone et chronolo decompose ve1y easily. The decrease was also
ensitive, and which

oie

. . .,. de la . . . . .
Bronze Age in the Carpathian-Danubian area, generally ve ry s to other ammo acids, or d ecomposltw n. Th e
c1v1
. 'Iisation Noua-Sabatmovka-Coslogen i, . . can be explained by the ox1dat1on or conversion
Culture et am1no acids ' which
speaking, became unavoidable. But, in this respect, one . contammg . .
in the concentrat ion of Glu, Cly, Ala, Val,
au Bas Danube X, 21- 41.
Czvz11satzon slight in the case of Asp, Pro and Arg, and there were no changes
decrease was very . .
mcrease
cannot elude the "delicate" aspects of the contradictions Laszlo, A., 1997, Datarea prin radiocarbon in arh His in the course of 250 years. These AAs are not sensitive to environmental influences. There was a minor
existing between the historical and the radiocarbon
eo/ogie
. Phe and ion of other
(Biblioteca Muzeului Nafional II), Bucureti. vatt ' n 0F Ile and Leu during this time' which was surprising, but may be explained by the decomposit
in the coneent " o 'J .
chronology both of the East Mediterranean-Aegean World Mantu, M., 1995, Clteva consideratii privind cron to relatively higher amounts of these two AAs m
.

the protem .

Plo
tzng
.

the concentrat wn of the AAs as a

ologia AAs, which gave rise .
age.
and of the South-Eastern European Protohistory. of unknown
absoluta a neo-eneoliticului din Romania, SCJVA 46(3-4) ftmot.. wn 0.'JFti ne calibration curves were obtained' which are
' '
useful for the age estzmatwn of a coral sample

213-235.
I

References Monah, D., 1978, Datarea prin C l 4 a etapei Cucuteni KEYWORDS: AGE DETERM INATION OF CORALS, AMINO ACIDS, D-AMINO ACIDS,
A2
RACEMIZATION OF AMINO ACIDS.
I

SCJVA 29(1), 33-41.

Boroneant, V., 1980-1981, Betrachtungen
iiber das
Epipalaolithikum (Mesolithikum) in Rumanien, Veroffent
lichungen des Museums fiir Ur- und Friihgeschichte
Potsdam 14-15, 289-294.
Breunig, P., 1987, 14C Chronologie des vorderasiatischen,
siidost- und mitteleuropaischen Neolithikums, Koln-Wien.
Chirica, V., 1984, Datarea prin C14 a unor locuiri gravettiene
de la Mitoc- Malu Galben (com. Mitoc, jud. Botoani),
SC/VA 35, 1, 74-79.
Chirica, V., 1986, La chronologie relative et absolue des
habitats Aurignaciens et Gravettiens de la Roumanie, The
Pleistocene Perspective, 1. The World Archaeological
Congress, Southampton and London, 1-24.
Ciugudean, H., 1996, Epoca timpurie a bronzului in centrul i
sud-vestul Transilvaniei (Bibliotheca Thracologica Xll/),
Bucureti.
Damblon, F., Haesaerts, P. & van der Plicht, J., 1996, New
datings and considerations on the chronology of upper
palaeolithic sites in the Great Euroasiatic Plain, Prehistoire
Europeenne 9, 177-231.
Dumitrescu, VI., 1958, Pozitia arheologilor fata de rezultatele
metodei radioc arbonului, SCJVA 9(1), 162-170.
Dumitrescu, VI., 1974a, Cronologia absoluta a eneoliticului
romanesc in lumina datelor Cl4, Apulum 12, 23-39.
Dumitrescu, VI., l 974b, La cronologia dell' eneolitico
Romeno alla luce degli esami C l 4, Preistoria Alpina 10,
99-105.
Monah, D., 1987, La datation par Cl4 du complexe cultural
Cucuteni-Tripolie. La civilisation de Cucuteni en contexte
europeen (B.A.J., /), Iai, 67-79.
Monah, D., Cuco, St., Popovici, D. & Dumitroaia, Gh., 1986,
Noi date Cl4 din nivelurile apartinind culturii Precucuteni
din statiunea de la Poduri-"Dealul Ghindaru'', jud. Bacau,
Cercetiiri Arheologice (Bucureti) 8, 137-142.
Palincas, N., 1996, Valorificarea arheologica a probelor 14C
din f01tificatia apartinind Bronzului Tirziu de la Popeti
Uud. Giurgiu), SC/VA 47(3), 239-288.
Paunescu, Al., 1984, Cronologia paleoliticului
mezoliticului din Romania in contextul paleoliticului
central-est i sud-european, SC/VA 35(3), 235-265.
Paunescu, Al., 1993, Ripiceni-Jzvor. Paleolitic i mezalitic,
Studiu monografic, Bucureti, 1993.
Pearson, G.W. & Stuiver, M., 1986, High-Precision
Calibration of the Radiocarbon Time Scale, 500-2500 BC,
Radiocarbon 28(2B), 805-838.
Petrescu-Dimbovita, M., 1987, Probleme der Cucuteni
Kultur im Lichte der neuen archaologischen Forschu ng en,
Acta Praehistorica et Archaeologica 19, 19-29.
Popa, D. & Boroffka, N., 1996, Consideratii privind cultura
Noua. Aezarea de la Tichindeal, jud. Sibiu, SCNA 41(1),
51-61.
Stuiver, M., & Reimer, P., J., 1986, A Computer progra m for
radiocarbon age calibration, Radiocarbon 28, 2B,
1022-1030.
I ntroduction
studies have been published on amino
Few
racemization in corals. Goodfriend et al. ( 1992) determined
the free aspartic acid values in corals over the last 350 years.
Wehmiller et al. (1976) carried out a study on racemization
(epimerization) of isoleucine in late Pleistocene corals.
lfhe aragonite skeletons of scleractinian corals provide a
potentially strong tool for the reconstruction of seasonal or
i long-term variations of various climate variables in tropical
i ns (Knutson et al. 1972; Winter et al. 1991). The massive
rego
coral skeleton produces growth bands of high and low density,
which appear in X-radiographs of skeletal slices cut out in a
direction along the growth axis. There is a general acceptance
that one couplet represents one year of growth, and since the
cor als grow continually for hundreds of years, reliable
chronologies can be developed (Buddemeier et al. 1974;
Dodge & Thompson 1974). However, the boundaries between
the density bands may sometimes be difficult to determine as
the transition may be gradual (Buddemeier et al. 1974; Weber
&White 1974; Kissling 1977; Steam et al. 1977). Also, some
s ections of the coral could have missing bands or stress bands
resulting from environmentally extreme events: for example,
high water temperatures. The coral may, due to such events or
due to natural causes, have died and later begun to grow again.
Thu s the banding does not always provide absolute dating.
Two of the dating methods most frequently used for corals are
14
C- and U-Th analyses. Radiocarbon dating has a moderate
capacity fo
r the first few centuries after the formation of the
coral ske
leton. This is due to the fact that marine bicarbonate
has to be
corrected for the apparent 14C age of the surface
Oc e ans, the so-called reservoir effect, and that the atmospheric
14
C levels fluctuate (Stuiver et al. 1986). By means of mass
spec trometry methods for U-Th analyses the ages of recent
samples can be determined with a precision of 5 years
(Edwards et al. 1987). According to Goodfriend et al. (1992),
only dating of samples from the last few decades using
acid aspartic acid racemization would offer higher precision.
However, since amino acid analyses are easier and less
expensive than mass spectrometric U-Th analyses, these
workers considered that these can be used to screen
prospective samples for U-Th dating.
The objective of this investigation is to enhance the
understanding of how the amino acid composition of a reef
coral changes with age and to establish whether this method
represents a high precision tool for age estimates. Amino acid
analyses were carried out from a 250-year time series based
on a drill core through the reef coral Montastraea faveolata
(Weil & Knowlton, 1994).
M aterial and methods
Sampling: The coral drill core was obtained from Mona
Island, situated between Hispanola and Puerto Rico in the
northeastern Caribbean Sea, in June 1995. The X-radiographs
revealed that the core's annual band couplets spalliled a time
interval to 1682. We were sufficiently confident to assume
that each density band couplet in this coral represents one
year of growth, because the extension rate is on average
6.00.96 mm per year, which is a minor vaiiation. W hen
dense bands (stress bands) occur, the growth rate measured
shows large variation between the years, and no such
identification was made. Samples of 2-3 g were carefully cut
out with a scalpel from annual bands representing ages of 1-2,
50, 100, 150, 200 and 250 years, according to the X
radiographs.
Hydrolysis of the protein, processing of the hydrolysate and
amino acid analysis: Pyrex reusable hydrolysis tubes of 8 mm
I.D. (Pierce Chemical Company, Rockford, IL, USA) were
used for hydrolysis of proteins in corals. These tubes can

BAR- Centi: Ew: Sei: 1.

98 Proceedings of the 31" fmernational Symposium on Archaeomet1), Jerem, E. & T. Biro, K. (eds.), Archaeopress-Archaeolingua,
 Nyberg, J., Malmgren, B., Csap6, J., Csap6-Kiss, Zs. & Csap6,
J. Ji:
composition
Age estimation of coral based on amino acid

contain up to 8 ml hydrolysing agent without contact with A B

the proline, glycine, alanine, valine and pheny . d to the Asp and Glu resulting Asn
PTFE (polytetrafluoroethylene) sealing cup. In each case,
lalanine
decre rnate
na1' or eouple .
value sd value sd SD R p
1 but s1gm
fi1cant c hanges m the concentrat10n jJJOrganiC i (glutam ine). It is well known that dunng
of isol . d Gn

-0.044 0.0200 4.1347 -0.74 0.0920

ml of 6M hydrochloric acid was added to the tubes
for the
preparation of protein and peptide hydrolysate. Each tube
leucine were not observed. These two a Uc n
mino a c i t e
s
(aspa.
ra gine) an . Gin and Asn decompose into Glu and Asp
ctr
y olyst
s
Asp 33.06 3.000
0.549 -0.013 0.0036 0.7565 -0.88 0.0222
had least sensitive to the circumstances of the otein h . Thr 6.08
enviro nm are pr aIJlllloma. .
two PTFE sealing caps to achieve completely leak-fre nt: d . m Ile and Leu. Ser 6.43 0.628 -0.017 0.0042 0.8660 -0.90 0.0158
e The decrease observed in most of the ami
no acids an surpnsm g to observe an increase .
operation during heating at l 10C. 1 8 n veiy It was very. .
.
Glu 13.30 1.030 -0.014 0.0070 1.4225 -0.73 0.0970
close correlation with the decrease in total a t acids increased stgmficantly over
mino a c . ali p hatJc amino . . -0.006 0.0013 0.2700 -0.92 0.0084
10-20 mg coral was weighed into Pyrex tubes previou ids In 1b. ' hese tW0 . ned by the decompos1uon Pro 3.59 0.196
sly most recent sample the sum of the amin o
acids wa f in creases can be explai .
washed with hydrochloric acid and deionised water. One 0.228 -0.004 0.0015 0.3146 -0.82 0.0476
HCI was added to each sample and nitrogen was bubbled
ml mg/100 g without ammonia, and was 78-
80 mg /l
120.
Q2

tiJtl
e These
of t he ot e .
.
. h r anuno actds, while the Ile
and Leu did not change
.
Gly
Ala
5.28
5.17 0.284 -0.006 0.0019 0.0392 -0.85 0.0329
for those samples where the age was between g for d the relativ e conce ntrat10n of these two
c ntr
100 and 25 at o n , an
five minutes through the hydrolysing agent by glass capillary 0 Years. 0.068 -0.002 0.0005 0.0940 -0.91 0.0110
!II con e
1.41
i
Cys
.
. In contradistinction to these results, the co
ncentratio . ds increased. . -0.003 0.0003 0.0556 -0.98 0.0005
After bubbling with nitrogen, the Pyrex tubes . . .
ammorua mcrease d over time. Table l gives . n aJlllno act It can be Val 3.44 0.040
were f
inform at O tlte sho ws th e parameters of linear regress10n. .
immediately closed, and put into the heating oven at ion Table 3 Met 1.95 0.078 -0.004 0.0005 0.1084 -0.97 0.0011
l 10C the quantities of amino acids in the coral, but negati ve correl at10n between
do es no t .0n is a very close
for 24 h. After hydrolysis, the tubes were cooled at t hat there 3.68 0.050 -0.001 0.0003 0.0690 -0.93 0.0080
room any information on the quality of the coral gtve stated al and the amino acids presen t. The only Ile
temperature and the pH of the samples was set to 2.2
protein . o fthe cor .
0.090 -0.002 0.0006 0.1244 -0.14 0.7937
with 4M In Table 2 the amino acid composition of the the age . where r is -0.14. For the other ammo Leu 5.11
protein in n ts 1eucm , e
NaOH. During neutralisation, the temperature was kept excepuo Tyr 4.28 0.271 -0.010 0.0017 0.0373 -0.94 0.0047
below (g ano acid/100 g pr tein) an be seen. This (Arg). There was a
30C by means of a sodium chloride-ice mixture
. After
? _
quan1ty of the respectJ e anuno acids resen
table show : .
acids v ts b
etween -0 73 (Glu) and -0.98
. .
itive correla tion betwe en the age of coral and Phe 4.66 0.153 -0.007 0.0010 0.2112 -0.96 0.0022
dilution with citrate buffer (pH=2.2), the hydrolysates : ? t in 100 g
Cora) ry close pos Lys 5.54 0.723 -0.013 0.0048 0.9957 -0.80 0.0580
were
filtered and applied to the automatic amino acid analyser
.
protem. The concentration of those anuno acids
sensitive to the circumstances of the environm
that are v
e
:UU onia (r = +
0.96).
His 2.37 0.140 -0.003 0.0009 0.1930 -0.88 0.0260
The amino acid contents of the hydrolysates
were The highest decreases were observed in the case
ent de cr ea J References Arg 4.96 0.302 -0.008 0.0020 0.4156 -0.90 0.0139
of Thr, Tyr 0.0060 1.2280 +0.96 0.0021
determined by using an Aminochrom-11 and LKB 4101
type and Ser. The decrease in the case of Met and NH3 13.69 0.890 +0.041
amino acid analysers. Otherwise the analyses were carried Cys can be
out explained by oxidation of the two sulphur-con . os J. E. & Knutson, D. W, 1974,
Buddemeter, R W Marag '
Table 3. Parameters of linear regression (y=A + Bx).
taining amino
as described by Csap6 et al. ( 1986).
of reef coral exoskeletons: rates
.,

acids. These two amino acids are very sensitive

not only to R adiographie studies
oxidation, but also to decomposition. We endeav growt h, J. exp. ma1: Bwl. Ecol. 1 4'
oured to and patterns of coral
Barbados, Part I - zonation and productivity, Bull.
Results and discussion Ma1:
determine the oxidised form of cysteine (cysteine-
sul phonic 179-200. . . .
Sci. 27, 479-510.
, J., Csapo-Kiss zs., & T6th-P6sfai I.,
acid, cysteine-sulphinic acid and methionine (meth 1986, OptirmzatJn
M., Pearson, G. W. & Braziunas, T., 1986,
Table 1 shows the amino acid composition of the ioni ne Csapo,
coral anun o ac1d content m Stuiver,
sulphone, methionine-sulphoxide), but our effor ts
wer e not of hydrolysis at determination ?f _ back to
samples; i.e., how many mg amino acids are present
in 100 g successful due to the very low concentration of the 1, 3-?L Radiocarbon age calibration of marine samples
oxidised food and feed produ cts, Acta Ahme ntana
.
coral. It can be seen from the results that the concent 9000 cal yr BP, Radiocarbon 28, 980-1021.
J., rad10hermcal
Dodge, R. E. & Thom
ration of form. The decrease in the case of lysine content The natura l
can be son, 1974,
J . N . & White' E. ' 1974, Activation energy for skeleta
most of the amino acids decreased over time. The l
typ1c corals "'
vveb er,
highest explained by the reactivity of the e-amino group. and growth records in contemporary herma Platyg yra
decrease was observed in those amino acids which
are very Slight decreases were observed in the case of Asp, Pro and ean.
_
. Sci. Lett. aragonite deposited by the hermatypic coral
fro m the Atlantic and Caribb Earth Planet
sensitive to the circumstances of the environment (threoni spp. Mar biol. 26, 353-359 .
ne, Arg. There were no significant differences between a e s in 23, 313-322. . .
Wehmiller, J. F., Hare, P. & Kujala, G. A, 1976,
g Amino a1ds
Edwards R. L., Chen J. H. & Wasserburg G. J.,
serine, cystine, methionine, tyrosine, lysine and arginine 1987, 238_lJ-
). The the case of Glu, Gly, Ala, Val, Phe and His. These amino acids
ns
concentration of histidine, aspartic acid, glutamic
acid, are not so sensitive to the circumstances of environment. systema tics and t he precise in fossil corals: racemization (epimerization) react10
234U-230Th-2 32Th
the past 500,000 years. and their implications for diagenetic mod.els and
The increase of the ammonia was not surprising, since measurement of time over Earth
geochronological studies. Geochim. Cosmoclum.
Amino acid Acta
Age (years) ammonia can result from the decomposition of other amino Planet. Sci. Lett. 81, 175-192. .
Goodfriend, G.A., Hare, P. E. & Druffel, R. M, 1992, Aspartlc
1-5 50 100 150 200 250 acids. The ammonia is probably absorbed by the matrix ofthe 53, 151-162. .
Weil' E & Knowlton, N., 1994, A multi character
analysis of
acid racemization and protein diagenesis in corals over
&
Asp 36.50 32.13 22.56 th Caribbean coral Montastraea Annularis (Ellis

24.80 23.64 25.84 Amino acid Age (years) the last 350 years, Geochim, Cosmochim. Acta 56,
ta
Thr 6.96 5.14 3.73 3.82 3.83 3.13 Solander 1786) and its two sibling species, M. Faveola
1-5 50 100 150 200 250 3487-3850.
Ser 7.55 5.04 3.94 3.46 3.10 2.97 Kissling, D. L., 1977, Population structure characteristics f (Ellis & Solander 1786) and M. Franksi (Gregory
1895),

Glu 14.45 13.00 9.48 10.62 10.87 10.36 Bull. Ma1: Sci. 55, 151-175.
Asp 27.05 27.23 23.20 24.33 23.11 25.12 some Paleozoic and modem corals, Mem. Bur. Rec
Winter, A., Goenaga, C. & Maul, G. A., 1991,
Pro 3.94 3.10 Carbn and
2.72 2.54 2.29 2.27 Thr 5.15 3.04 Geo!. Min. 89, 497-506.
4.36 3.84 3.75 3.74
Gly 5.69 4.61 4.82 4.62 4.46 4.33 Ser 5.60 4.27 4.05 3.39 3.03 2.89 Knutson, D. W., Buddemeier, R. W. & Smith, S., 1972, Co al ; oxygen isotope series from an eighteen-year Canbbe
an

Ala 5.64 4.71 4.21 reef coral. J. Geophys. Res. 96, 16673-16678.
3.94 4.00 4.02 Glu 10.71 11.02 9.75 10.42 10.62 10.07 chronometers: seasonal growth bands in reef cora s.
Cys 1.53 1.22 1.11 1.10 1.00 0.96 Pro 2.92 2.63 2.80 2.49 2.24 2.21 Science 177, 270-272. .
Stearn, c. w., Scoffin, T. p & Martindale, W., 1977, Calcrnm
Val 3.48 3.33 3.10 2.96 2.88 2.79 Gly 4.22 3.91 4.96 4.53 4.36 4.21
Met 1.98 1.81 1.44 1.16 1.04 0.98 Ala 4.18 3.99 4.33 3.86 3.91 3.91 carbonate budget of a fringing reef on the west coast of
Ile 3.72 3.53 3.58 3.44 3.28 3.33 Cys 1.13 1.03 1.14 1.08 0.98 0.93
Leu 5.09 5.22 5.01 5.12 4.92 5.19 Val 2.58 2.82 3.19 2.90 2.81 2.71
Tyr 4.41 4.10 2.74 2.57 2.14 2.07 Met 1.47 1.53 1.48 1.14 1.02 0.95
Phe 4.63 4.54 3.87 3.41 3.09 3.13 Ile 2.76 2.99 3.68 3.37 3.21 3. 24
Lys 6.46 5.09 2.93 2.93 3.15 3.23 Leu 3.77 4.42 5.15 5.02 4.81 5.05
His 2.51 2.00 1.88 2.10 1.75 1.45 Tyr 3.27 3.47 2.82 2.52 2.09 2. 01
Arg 5.48 4.33 3.60 3.60 3.38 3.14 Phe 3.43 3.85 3.98 3.34 3.02 3.04
Ammonia 14.88 15.10 16.48 19.76 23.49 23.68 Lys 4.79 4.31 3.01 2.87 3.08 3.14
1.41
Total (without ammonia)
His 1.86 1.69 1.93 2.06 1.71
120.02 102.89 80.72 82.19 78.82 79.19 Arg 3.05
4.06 3.67 3.70 3.53 3.30
Total (with ammonia)
Ammonia 11.05 12.81 16.99 19.40 22.96 23.02
134.90 118.00 97.20 101.95 102.31 102.87 Total 100.00 100.00 100.00 100.00 100.00 10 0.00

Table 2. Amino acid composition of corals of different ages

Table 1. Amino acid composition of corals of different
ages
(mg amino acid/100 g coral).
(g amino acid/100 g protein).

100 101
 3. Field Archaeology

OF KITROS
THE AR CH AE OLOGICAL SITE
LED STUDY O F
T NETIC
p E AI COMBINED MAG
!-. (N. GREECE) BY
ETRY METHODS
AND SPECTROM
S, Y. 1
NDOPOULOU , D.1 & SANAK!
SARRIS, A.', KO
AJDONA, E. ' ,
ece.
06 Thessaloniki, Gre
y of Thessaloniki, 540
1 Geophysical
Laboratory, Universit te, Gre ece .
H., Rethymnon, Cre
nean Studies, F.0.R.T
2/nstitute of Mediterra ", Athens, Greeece.
ter "Dem okr itos
3Nuclear Research Cen

"" af magnetic and

;, in,,,tiga"d by the
ulo udi " - Kitto'" (N. G""') l as
ological "" of "Lo oeologital <ite, as wd
dy the a.-chae ch" within the a .-ch
e P""nt ,tu tol kc ted from "'"al "en m o lon g
1n th
al method<. Soil 'am
ple ' wm letted fro
"'"' "ry geo phy<ic ";, ,_le> wm col
t wm "" d fat gla " production. Mo"o the lim i" of th
kiln" which tify
""" around <ite, in ordet to idm
sp rodial trn
f"' wr"' ,1<nting from th mid dle of the a.-chaeologital 'ite and
extending beyond the
t occ upa tion 1M 1' and the boundati" of
in ide ntifying the diffemn
wae '"" "' Ju l with the period' of
t
11<ment. Mea'u"men" t were well correlated
eological ,,1 ity and i ton oxide conten
h ,alue' of magne tic '"" ept ibil effect of the jfring
; ital <ite. Hig '""ey inditated the
<0
he archa log of the magnetit '"'ceptibility
kiln,, tlw me an ,al u" Compati,on of th
acti,ity. Around th the "" I the ldln,.
;,ten3' hu- e fir" "idence concaning
ng a"a and als o ga, e wm u<ed "' an index .for
in tlw '"'roundi enhancement may be
meclumi<m hro pog tni c ,ai l' '"gg"" thot their
of th ant
chemical propetti"
mogMtk and s of arch aeolo gical interest.
as and feat ure
locatin g are
METHODS.
, SPECTROMETRY
IC SUSCEPTIBILITY
KEYWORDS: MAGNET
try analysis was
Mossbauer spectrome
contents. Moreover,
ne the percentage
Introduction applied to several sam
ples in order to defi
.
ros" was content of iron oxides
"Louloudia - Kit
site
The archaeological
after the
Data Collection
Py dna ,
established in AD 4
79 by the Bishop of
e com ple x (80x90
his former seat. Th
Goths' occupation of and
's res ide nce lected fro m the
a basilica, the bishop soil samples were col
meter s) consisted of The More than a hundred
duction of wine and
oliv e oil. were taken from
installations for the pro x. Sixty-eight of them
und the middle archaeological comple
by an earthquake aro s and the rest
settlement was destroy ed
cross-sections (S 1-S
6) of aichaeological trenche
mo ve to another studied trenches
ced the bishop to face. The depth of the
6th century AD, which for were taken from the sm
tive character by also taken fro m
x kept its produc meters. Samples were
area. The rest of the comple
yea rs later, a ranged from 0.8 to 2 the central
facilities. Som e fro m
the creation of new storage radial profiles starting
the residents kilns (F l-F3) along alo ng a long
the complex and lec ted
second ear thquake destroyed ally, samples were col
the locus of part of the kilns. Fin olo gical site
was use d as arc hae
abandoned it. Later on, the site from the center of the
prod ucti on of traverse (T l ), starting lim its of the
the y the
w orkshop activity and especial
ly for ds, in order to identif
, the com plex and extending outwar as wel l as
end al site
ves sels, glas s items and iron tools.
In the ent. The archaeologic
rsio ns, as the archaeological settlem in Fig . 1.
due to incu sho wn
was completely abandoned, possibly sampled locations is
ker s left thei r the distribution of the
that wor
general picture of findings suggests
tasks unfinished (Marki 1997). Results
inguish the different
The purpose of this study is to dist
using magnetic
occupatio n levels of the settlement by s
methods. Such Archaeological trenche
sus ceptibility measurements and spectrometry
ful in the past values versus
an approach has proved to be very use magnetic susceptibility
The diagrams of the
(Gavanagh et al. 1996; Sarris 1994, 1998). gic trenches are
al
en from the archaeolo
depth for samples tak
the aichaeological
obvious that some of
shown in Fig. 2. It is
Methods lity levels. These
ed magnetic susceptibi
layers exhibit enhanc
a good agreement
brown clay and are in
all samples in layers correspond to
Th e magnetic susceptibility was measured for x. Hence, on the
periods of the comple
o fre quencies (0,47 and 4,70 kHz) using the
ilit
Bait
y
ington MS2
XFD and the
with the habitation
basis of these measu
rements, it is possibl
e to distinguish the
se where the
eter. The frequency dependent susceptib an activity from tho
levels of intense hum
ean value of the susceptibility were compute d bas ed
C)
on the
and its complex was abando
ned.
a o ve m easurements. The Le Borgne Con tras t (LB
orde r to emp hasiz e
n o alization (NLBC) were calculated in
rrn
. of the area Surface traverse
aph y
(1th e ancient layer and to confirm the stratigr
magnetic
eBo rgne 19
55). from measurements of
the
pectrometry analysis by means of electron spin
era l sam ple
resonance
s in order
The results
susceptibility inside
and outside of the arc
hae
val
olo
ues
gic
as
al
we
site are
move
R) techniques was carried
out on sev dual reduction of the
othe r magnetic shown in Fig. 3. A gra
t0 e stim and
ate the amount of iron oxides
BAR - Centi: Ew: Sei: I.
haeopress - Archaeolin
gua.
Jerem, E. & T. Bi r6. K. (eds.), Arc
um 011 Archaeometry,
Proceedi
ngs of the 31" lllternational Symposi
 .
Aidona, E., Sarris, A., Kondopoulou, D. & Sanakis, Y. ' Kitro s
archaeologica I site OJ
ometly method s
. (N Greece) by combined magnetic and spectr
A detarle
.
d study of the

Normallitd Ltliorgue Contrs J.0

!::

l.G -i} !i.O .,.

' "''". . -
'
..

A
, ' '. ' ' ,..,

TOPSOIL WITH \ .Jij() ,

CERAMICS

;
.IQ!)

i_
DARK GRAY
SAND
.-. -!Sil
:::::;,.
--c...
-

Q ;

r
-!%

. IJROWNSANDY "::..
... LAYER

I
.... , .]jfl

.i.

-HHi
.)ijij

!
REDDISH

L---'---1:}
CLAY

..\:
)i; "
SuHfplibility

Xfd '?!
Hi

Ont] TOrSOILWrm
CERAMICS
-411

,.,Jj A
.0.5m --
\

"' ,'
H I SANDY-CLAI'
. ..

ltn
UROW:"COLORE.D -ti I

i l
'
{
-1
' i
'
1.JGHT"\WN
;"'
0
! UORIZON -120 '
' I

11 SANDY-CLAY

. r-
BROWNCOLOREll

JI r
' . \!}(J

I
.

. It u / /.
-11)
. .. w II

J["" 1 -H---r-++ -' -

.. < .,

t' /
-. _t

JOI I

REUOlSH l
.?.:{i
-200

IA / 10 c
CLA\'

'I I \ S6.
-io
!!O

1 --
)0 6(1 l.t'. Dnrr;nt Contra!
Suufptibility

II III .
IV V VI VII VIII VI. Fig. 2 Distribution of the magn
etic susceptibility

I
I. tren h
SJ and S2
S5 Tl measurements versus epth for

: ;
.

: :: ;
I r ne Contrast
I
r w
I
100 I-
e i
i : : :1 :,: ;; :v: : ae lo i al trenches.

'.;.!;:
.,,. . - s

Fig. 1. The archaeological site

6) indic ated that, for
and the distribution of the sampled locati ESR analy sis for these samples (Fig.
ons. . ptibi lity value s, the spec trum
samp les with low magn et.ic susce
RO ...., .
h weaker that the spectra
correpond'mg t n o xides is muc
away from the complex is obvious. Nevertheless, at a certain approximately 1.5-2 m away from the center of a kiln. Con , .,
- 6

d F e3+. Hence, we coul d cons ider tha
the
location outside the complex, an increase of the magnetic to our expectations, in the third kiln (F3), the values of magnetic refemng to Mn .
I . contnb u fi on to mag net1zat'ion 1s due to iron oxid es.
susceptibility values is observed, reaching the corresponding susceptibility were reduced towards the center of the ki main . .
shown that in samp les
values of samples from the archaeological site. After further + From the same spec tra, it is also
Y
(Fig. 5). This result conflicts with the mechanism of magnetic
te d b finng (S4-F 3), the cont ent o f Mn2+ is
observation, we noticed that at the specific area, archae obvio usly affec
1es m
Limits of the afchcao1ogioal !'ite
'enhancement' and the results obtained from the other two ki]ns. which n o effect of
ologists processed the potsh erds extracted from the site. For
-
great er than in the rest of the samp
this reason, the particular location can be considered
One could assume that this behavior resulted from a contaminated
sample, or that the particular kiln was not used for a prolonged 40 I- ::.=: r't-:.::,:::u<,,.., firing appe ar to b e i:::
t
High t'requeocy
= -

qualitative analysis, Mossbau er

"polluted" from the soil of the archaeological complex. period of time. In the latter case, the necessary contents of n In an effort t
.
on selected samples. The
meas urements were earned o ut u p
Kilns
oxides, mainly responsible for the increased levels of ma gnetic . .... d in the
o f iron o x1'des cont.,;ne
- 2

20 I-
Xfd % perc entag e contn'bution
susceptibility, could not have been created in abundance. .
by the shap e and the
samples (Table 1) was estimat ed
Several samples were taken from kilns, in a radial direction, in symmetry of the Mossba u er spectrum.
Spectrometry analysis
order to define the variation in magnetic susceptibility from the
I I
40 liO 80 i 00
I

20
I
center towards the outer p ait of the kiln. For kilns F l and F2
Distance (rm)
In an effort to investigate the chemical composition of the
(Fig. 4), the values of magnetic susceptibility exhibited a samples, we peiformed ESR measurements in the Nuclear
significant reduction in a direction away from the center of the Fig. 3 Magnetic suscept1b1l
. . ity 9%
.
values versus distance inside
Sl-12
Research C enter "Demokritos" were performed. The
kilns. After 1.5-2 m the values increased again, reaching the .
1n tiie sa me diag ram th
.
e (Cross-section /gray horiwn)
7%
analysed samples (10 in total) were collected fro m the and outside the archaeologzcal szte.

F3-l

background values of the complex. Therefore, it can be ' 1 ty easurements and

'J
archaeological trenches (Sl-S4), a kiln ( F3) and the surface mean value o+ the magnetic suscept1 b l I m (Center of the kiln)
considered that the influence of the fire is significant to distances a re shown .
traverse (Tl). the frequency dependent susceptlb lTty
I

104 105
 Aidona, E., Sarris, A., Kond
opoulou, D. & Sanak
is, Y.

study of the archaeological site of Kitros (N Greece) by combined magnetic and spectromefly methods
Jm A d etailed

lm MAGNETIC FIELD

T=IOK
so T=IOK
T=IOK
&
Tl-9

E

60

Im l.m
.
.
\
2ra :;;
40
\
\

"""
20
\
'"' ,,,.
t20c111
0
0 lO 100 ]j(I zoo 250 JOU
Distan cc(cm) 351)

/JO T=200K T=200K

T=200K
, T=200K
/\ 84-5 I I

t' S2-3
J \ ('\
- \
I
JOO ;:..
<'.
''.: '''"":
\. \
i

I

:t
High FrcqucnC'y
\ !\\ \ \
\\ )i
) Tl-9 \
Jm lw S4-4
\
f,
80 827 !
\i I

\
'"
\\ /
I

' ""
\'J \
... I i ' I
60 v
\;
u

.
...
'-
- ---!
IOI 40.'G }WJ S000
v,
I
:;;
40 ,.,. '
'
1 (1);1 ,.,., -

Fig. 6. ESR spectra for 10 samples from

the archaeological trenches (Sl-
20
S4) a kiln (F3) and the suiface traverse (Tl).
.llfLIGk.\SS
Sample F3- l , collected from
the center of kiln F3, is
characterized by the smallest conte References
nt of iron oxides. This fact
0
confinned our second assumpti
0 lO on regarding the particula
JOfJ 150 100 r
Distance (cm)
250 30(! HO kiln, namely that it was not Gavanagh, W., Jones, R. & Sarris, A. E.,1996, The Phosphate
used intensively and/or for as
long
Fig. 4. Mean values ofthe magnetic susceptibility around kil
a period of time as
the rest of the kilns. and Geophysical Surveys, in The Laconia Survey,
ns FJ and Gavanagh, W. G. & Crouwel, J. eds., Great Britain.
F2 respectively.
LeBorgne E., 1955, Susceptibilite magnetique anomal de sol
Conclusions
2m superficial, Ann. Geophys. 11, 399--419.
The results obtained Marki, E., 1997, Conclusions from the excavations conducted
in the study of the archaeol
ogical site
"Louloudies Kitros" by 9th Ephorate in Northern Pieria, in "10 year
I.Sm
can be sum mar ized as follows:
It was possible archaeological work in Macedonia and Thrace",
to distinguish the occupatio
so
n levels of the
archaeological Thessaloniki, 12-15 February 1997.
site on the basis of mag
netic susceptibility
meas urements. Sarris, A.,1994, Magnetic Susceptibility Surveying in Ancient
It was shown that the main
occupation layer of
the site can Mantineia, Greece, 59th Annual Meeting of the Society
be correlated to brown clay
s just below the gray
horizon, whic for American Archaeology, Anaheim, CA, U.S.A., 18-24
60
11he study of
h is visible in all studied
cross-sections.
the magnetic susceptibility of April 1994.
15m lm Q,
se ction (T soils along the
"
l), indicated that it is poss Sarris, A., 1998, "Geophysical Issues in Archaeological
ible to identify the limits

of the arc
v.

haeological site from its Research: Paradigms, Uncertainties & Inferences",

" neighboring area.
Both, magn invited talk at the international Symposium on Remote
40 etic susceptibility and spec
;;: me nt s de trometry measure
monstrated that the main Sensing in Archaeology, Boston University, Boston,
contribution to the mag
netization U.S.A., 16-19 April, 1998.
of soil is from iron oxid
and M es and secondly from Fe+3
n+2 ions.
Fi nally,
ESR measurements prov
20
on the ided some first evidence
correlation betw
een the presence of Mn+2 and
effe cte areas
d by firing.

00" ,0- -:-110 -,l _,_

0
'--"'-'
- _,_
_,_....L._
.._ ..:.
Distance (cm)
O 200 25(!

Fig. 5. Mean values ofthe magnetic susceptibility

around kiln F3.
106

107
 IS AND E DGE
PR IN CI PA L CO MPONENTS ANALYS
OF
PLICATION ES FOR THE DE TEC
TION
AP M EN T TE CH NI QU
ENH ANCE ANATOLI A
SI TES IN CENTR AL
OF PREHIS TORIC
ER, A. M.2,
ERDOGAR, N. J.1, OZ
, M. E. 1,
YILDIRIM, H. 1, OZEL
, U.3
GULCUR, S.3 & ESIN
Kocaeli, Turkey
PK 21, 4I470 Gebze,
ent , TU BY TAK Ma rmara Research Center,
artm 3I Ankara, Turkey
l S pace Technologies Dep hnical University, 065
ometry, Middle East Tec
2 Deartment of Archae 59 nbul, Turkey
, Beyazit, 344 Ista
ory, Istanbul University
Department of Prehist

o
en" ;n Centml AnatoU
o.-chaeologkal >ettlem
app Ued ;n ;n, ,,U gmfon of wh;,,odc eme nt tec hn; qu< >
Remo" ,,.
,;ng techn;q
ue' wm
wn e u>ed to ''",;n;ze the
""dy a<ea. Edge enhanc
matk mte lU" ;mo g" nor th-e ast, nor th
ond SP<fT Panchro 'a''' ;n
;magn. The PwwUt op<
Landsat TM andent road' and "tt
lemen" on the mtelWe
(PCA) was used to extr
act
h;g hUg ht the pon ent s Ana lysi s
ed to . Finally, Principal Com
were appU ctio ns wer e app lied app lica tion .
th-west dire e the best results for this
th-east and sou components which giv
west, sou ima ge and to find out the
infonna tion from the
significant
S.
Y, SATELLITE IMAGE
SING, ARCHAEOLOG
KEYWORDS : REMOTE SEN

eigenvectors
A are composed of the
The rows of the matrix
Introduction of the covaiiance matrix
Kx between the plan es. The matrix A
mat rix Kx such
tion of the covariance
performs a diagonaliza
archaeologists to find ima ger y,
The study area
was surveyed by the trix of the transformed
that the covariance ma
lem ents; such as flat
archeological sett
out the types of
anc ien t roads. The exact
uli as well as Ky=AKxAT
settlement, mound, tum
Magellan GPS
were measured by the
positions of these places
historical places nvalues of Kx
tem) to locate the pre se elements are the eige
(Global Positioning Sys is a diagonal matrix who
I on the Landsat TM and
SPOT Panchr om atic satellite images.
arranged in descendin
g value, (Pratt 1978).
Prin cipal Com
rected into bands of
were geometrically cor
I
sev en
These satellite images A) was applied to
arch aeological ponents Analysis (PC
red and fuse d. The
UTM coordinates registe Landsat TM satellite ima
ge.
ge. power of
on this fina l ima ( Table 1) indicates the

I
settlements were marked The correlation ma trix
aeological Landsat
ate the typi cal characteristics of the arch erentiating the ban ds of the
To investig
r eart h surface the PC A analysis in diff dsa t TM
from othe ds of Lan
settlements which distinguish
them sec ond and third ban
wer e app lied to TM ima ge. The first, m their
tech niqu es ecte d fro
characteristics, image enhanceme
nt hly correlated as exp
satellite ima ges were fou nd to be hig spe ctru m.
tion from agn etic
extract archaeological informa ns in the electrom
close frequency locatio
(Erdogar 1997).

Edge enhancement
lied in order to bring
Edge enhancement technique was app
not easily visible
out edges, lineaments and lines existing but
. Prew itt mas k is a compass
by naked eye on satellite imagery
edg es in all directions
gradient mask searching for all
(Gonzales & Woods 1993).
on the SPOT
In this study, Prewitt operators were applied
in north-east
Pa chromatic imagery (Fig. 1) of the study area
. 2c) and south
(Fig. 2a), north-west (Fig. 2b), south-east (Fig
the masks
west (Fig. 2d) directions. In all these four images,
applied,
showed the roads and rivers. After these masks were
'.11'chaeological features and ancient roads were noticed in an
improved fashion (Erdogar 1997).

Principal Co mponents Analysis (PCA)

achieve
Principal Components Analysis was applied to
e in
ze ro correlation among each band of the satellite imag
rdr to obtain a unique component which is arch
aeo
n
ogically significant in our study area. PCA resulted in seve
ponent images of Figs. 3a-g. The covaiiance matrix of
Fig . I. SPOT Panchromatic ima
ge of the stu dy area.
e image was calculated for this purpose.
Central European Series
I.
, K. (eds.), BAR-Archa
eolingua,
efl)'. Jerem, E. & T. Biro
Symposium on Archaeom
Proceedings of the 31" Jntemational
 Fig. 2a. Edge enhancement b .
y th e p1ew1tt 0perator
in the north-east Fig. 3c. T hird component Fig. 3d. Fourth component
d110oCt/Oi
' l.
of Principal Components Analysis. of Principal Components Analysis.

\I Fig. 2c. Edge enhancement b

y the preW1tt
.
0perator Fig. 2d. Edge enhancement by
the Prewitt Operator Fig. 3e. Fifth component Fig. 3f Sixth component
.

in the south-east

I
direction.
in the south-west direction. of Principal Components Analysis.
of Principal Components Analysis.

Nevertheless, we found the second component of the PCA

I (Fig. 3b) significant for archaeological considerations. The

mounds and tumuli in the study area could be better

I detected than the other components. The fourth component

I of the PCA (Fig. 3d) was also found to be a helpful

component for archaeological purposes. The thermal band

I
of Landsat TM, the sixth one differs from the others. The
seventh component of the PCA (Fig. 3g), contains no
information, as the satellite image confirms.

1.000 .983 .944 .574 .811 .202 .873

2 .983 1.000 .978 .612 .854 .223 .889

3 .944 .978 1.000 .572 .878 .310 .892

4 .574 .612 .572 1.000 .635 -.300 .431

5 .811 .854 .878 .635 1.000 .134 .919

6 .202 .223 .310 -.300 .134 1.000 .292

ig 3a. First co 7 .873 .889 .892 .431 .919 .292 1.000
: mponent
o f Pnnczpal Compo Fig. 3b. Second component Fig. 3g. Seventh component
nents A11a1ys1s.
.
of Principal Components Analysis. of Principal Components Analysis. Table 1 : Correlation Matrix

110
111
 Erdogm; N. J . .. .. .

., Ozer, A. M., Yild111111, H., Oze/, M. E, G11/p1rS. & Esm, U.

Conclusion
References
AN E THNOARCHAEOLOGICAL COMPARISON:
Edge enhancement techniques were 1oun c
. d usefu1 m Erdogar, N. J., 1997, Applica E RKENES ARCHAEOLOGICAL SURVEY AND THE LEGEND
tio n
TIIE K

si zing ancient roads. The Princ ip a 1 Components

of Remo te
emP ha . . Archaeology, M. Sc. Thes is Sensin
METU TUr g OF KERKENES CITY AND THE KEYKAVUS CASTLE
is was imprtant to obtam components significant in k ey
Analy s

GonzaIes, C R. & Woods,

R. E., ii 19 93,
logy. In t s study, we observed the archaeolog Dl8l.fa/ ll
.

a rchaeo ical Pmcess111g, Addison-Wesley

Pub cati. on llQ
ents better m the second and fou rth components of the Com any. ERGENEKON, B.
s e ttlem Pratt, W. K., 1978, Digital Image
Processing J P
the others. , 0hn-
pCA , than Sons Inc., Canada. Wi!ey
aeometry, Graduate School of Natural and Applied Sciences, and Dept. of Modern Languages,
Dept. of Arch
Middle East Technical University, lnonii Bu/van, Ankara, Turkey

Th. er aims to present the similarities between some of the findings of the Kerkenes Archaeological Survey, namely those
1ap
t :j ahmurath Ethnoarchaeological Fieldwork and the legends that still exist in the Sahmuratb village located on the
Jrom s/on es of the Mt. Kerkenes in Yozgat, Turkey. The oral history recorded during the ethnoarchaeological study in
r
eastern .
h uratl corresponds to events that took place between the Medes and the Lydians (Herodotus), the Medes and the
l
ah:em enids (Herodotus), the "Kay Kawus legend" mentioned in Babylonian tablets (Lewy 1949), the Persian sources (Taheri
Arabs and the Byzantians (Bakai 1769). The various elements of beliefs mentioned in the legends still can
J;BO) andi thetheAmevi
be found n beliefs and behavior of the modern day Sahmuratlz villagers.

KEYWORDS: ETHNOACRHAEOLOGY, KERKENES, $AHMURATLI, TURKEY.

Introduction city respectively. The altitude drops down to 1250 m within

the western boundaries of the city. The length of the city
Parallel to the archaeological survey carried out by Dr. walls is 7.5 km and their width is 4.6 m (Summers &

Geoffrey and Frarn;:oise Summers of METU at Kerkenes Summers 1994). There is "a minimum of five ancient
Mou ntain top Iron Age City (Summers & Summers 1994, gateways" and a stone rampart envelops "the outer face of
1996, 1997), an ethnoarchaeological investigation was the wall" (Summers & Summers 1994: 13). Inside, the
condu cted in the Sahmurath village (Ergenekon 1996, 1997, average height of the wall is 2 m and the construction reveals
1998). The village is located on the eastern slopes of the that the walls were "designed to carry a massive mud brick
mount immediately below the ancient city walls. The area superstructure" which was subsequently never built
within the city walls is 53.3 km2 and is submerged today into (Summers & Summers 1994: 13). The area within the city
silence as the official pasture of $ahmurath (Ergenekon walls is totally utilized by buildings, roads, etc. There is a
1996a: 10). The Sahmurath farmers (manipulate differently) highly developed water collection and distribution system
an environment somewhat similar to that of the Iron Age City "with artificial channels and reservoirs" (Summers &
of Kerkenes. Childe, the pioneer of socio-archaeology, Summers 1994: 13). Summers & Summers have identified
suggests that "the study of living human societies as two areas, one at the north (1290 m) and the other at the
functioning organisms" is revealing for archaeology (Gjessing south (14 72 m), which distinguish themselves as important
1975: 324). Therefore, "ethnoarchaeological research locations enclosing public places, a palace and a wide street
investigates aspects of contemporary sociocultural behavior (1994: 14). The construction of the city was not totally
with an archaeological perspective" integrating "ethnographic finished when it was abandoned and the city was only about
and ethnohistoric data with archaeological data" (Kramer to survive "perhaps less than a generation" (Summers &
19 79: 1, 3; Mcintosh 1986: 148). Summers 1994: 14), before it was destroy ed by fire. The
pottery found at the site dates perhaps back as far as the 6th
Methods century BC (Summers & Summers 1994: 14). Since no
buildings, roads and enclosures seem to overlap, the greatest
Field-work techniques borrowed from social anthropology, part of the city was not reoccupied, except for two much
uch as participant observation, in-depth interviewing and smaller locations, one (at the peak of Keykavus) which was
mv estigation of
documents and maps are used in this research. inhabited at the Hellenistic period, and the other at the
Ther efore some
techniques of the ethnoarchaeological southwestern end of the city occupied until the early
method are used
as recording oral history, legends, ly rics and Byzantine times (Summers & Summers 1994: 14). The other
plac e names.
sites of the settlement in the vicinity of the city walls span
from "the Early Bronze Age (ca. 3000 BC) to the medieval"
The archaeological survey (Summers & Summers 1994: 15). The Gozbaba burial
mound in the north, the highest point on the mountain
Th e ar
chaeological investigations carried out since 1 993 (1533 m), is "about two kilometers from the city wall" with
Mount Kerkenes, (also
identified as Pteria) (Summers a "late Roman or Byzantine watch-tower" (Summers &
I( 9 7: 81-94)1 have revealed the following: the city of Summers 1994: 14). The archaeologists Summers &
er
t kenes was founded on a grano-diorite rock mass with Summers suggests that this tower may be one of those in the
(: peaks. The
Keykavus Castle (1454 m) and Kirernitlik region that gave "warning of Arab raids corning across the
7 4 m) are located to the east and south of this ancient Capadoccian plain from the south" (1994: 14) .

I 42km
southeast ofYozgat in Turkey.

112 Proce e
dings of the 31" lntemational Symposium on Archaeomefl)', Jerem, E. & T. Biro, K. (eds.), Archaeopress-Archaeoli11gua, BAR-Centi: Ew: Sei: 1.
 of Kerkenes city and the Keykavus castle
Ergenekon, B. comparison: the Kerkenes
a rchaeological survey and the legend
I1aeological
Ane thnoarc

Prince Siavush was

The ethnoarchaeological survey2 lessly was turned Shah Keykavus against his son.
between Medes , Lydians, Achaeme
nids, B . to pray. Their king hope
Yan ti. an s, d 10 t he temple ed and sent back to Efrasi ab with a missio n by his father. He should
and the foundation of Sahmurath b Je soul visit
exist in aSselll cold north
of Russia, and his should war with him.
Sahmur th is located 12 km south of the town of Sorgun in (Ergenekon 1998a: 2-3). There are the
Vi) bU1'1ect in the
.
do not know either force King Efrasiab to trade or
. sym bols in Capadoccia. We
er hi' s city ters but then had
.

. .
Siavu sh to one of his daugh
Yozgat. It 1s a village of 335 inhabitants (1997) who live in 76 beIief m
Sahmurath that remind us of the a n d ideas ed ov s was taking ove r Pten a or Efrasiab married
leg ends piourn app ened when Cym gave birth to Shah
households. The bulk of the population is between 20 and 55 ofI<.e th is h l him murdered. His pregn ant wife
(Kay Kawus). yka wheth r e evi raids on Turkey and Ista nbu
year of age. The e are low birth and death rates, but Arabian Am . .
m Keyhiisrev (Cyrus). To reven ge his son Siavush, Shah
g mg to Hay rett
. d111..- of 717-740. But accord . y afterwards. He
contmuous ellllgrat10n to industrial centers in Turkey and th eYears Keykavus attacked Efras iab but died shortl
The legends of Kerkenes cit IJelWeen , ger, Shah Mur at (who appears agam on
Y anct earn e d villa by his grand son Shah Keyh usrev, who
Europe. An elected headman (mukhtar) and the board of Keykavus Castle the Saer' a
l
a! Gazi6 to conquer the was then succeeded
8th c.) asked Batt on his mother's
elders ovem the village. All of the villagers are farmers by the scene at the by then also had a well of golden
inherited this fight to reven ge his grand father
kavus, which ab fled to the land of the
profess10n. Agriculture is almost totally mechanized We learn about Mt. Kerkenes earliest castle of Key then held by Cluistians side (Taheri 1980: 512). Efrasi
from H.itt. could catch. It was a pool (Tahe ri 1980:
(Ergenekon 1998b). Products of dry ite tab)... n o o ne the Romans (Anatolia) and was killed in
agriculture such as (Gurney 1995). The Hittite King who t . of the Moslem "martyrs" and
' rave1 led ... IJeeS s). The graves ng about the existing
wheat, rye, barley, vetch, lentils and chick-peas are cultivated chanot in a War /Q.yzanUan Keykavus fort1 fi
1cat1 0ns are 511-518). 8 Taheri mentions nothi

from Hattusa, arrived at Zippalanda 1"

immedi. . nediately below the

elynorth chnsuan s 1nu religious beliefs then.

and harvested. Viney rds that once yielded high quality f " .
t (Ergenekon l 997 a). It mu st be
Mt. Kerkenes and then climbed up Mobht Daha evidence this fac and the religious

grapes have een left idle after higher profits were optained is Kerkenes -, sanctified it and went to
-
Which beli. eved to ak meets its When we turn our attention to the story

visit ors wit h
. Ankuw a e that the Gozbaba pe understand that
menuon ed her

s we

from mechamze agnculture and remissions from expatriate 1995; Ergenekon 1998a: 2). He may have"
(Gurn ey ng flights arou beliefs derived from
nd them not Babythelonian tablet
II bees that make warni

w and the first king with

workers. The villagers own vegetable gardens and willow . o roads, acIoud Of Nabunaid, the last king befor e Cyrus
one of which passes through Sahmuratli Th
ey are. stle (Erg eneko n l 998a: 2-3).
of the Sun
woods along the creek east of the village . called .,,.,ne
J{e kavus ca the title of Kay Kawu
e at Pteria (Kerkenes)
s, believ ed in the trinity

. Mount Kerkenes Great Road" runnmg to the east and "The us of the battl
C ds rem ind known in
offers a rich variety of bushes and herbs. The water cisterns 0 f i Road" in hese legen (Samas), the Moon (Sin) and Istar (Venu s) also
. .
the souteas by th
@
agers (Ergenekon l 9
) first between
the Medes and Lydians, then
the Lydians and the
ari sect of Turki ye.10 Nabunaid
the ancient city are now ools of mud fostering frogs and The histoncal ongms of this village are rooted . Christianity9 and the Hayd
this first battle (which
hree folk . According to Herodotus, se he hailed
leehes. These places which have international fame are
I \. Achaemenids (Kay Kawus) was killed in a civil war becau
legends told by the villagers, one about the eclipse on May 28th,
villag , he o five years) ended with a solar his country
beheved to cure skin d iseases such as scabbies, hemorrhms ther went on for higher his uinity than
d by Thales
the only god, Mard uk, of
'd one about Kerkenes city and the third one ab already calculated and announce
. . . .
3
out the Ke k a
Y vus 585 BC, an event Iraq, claimed that he ascen ded to the heave ns on a throne
and 1 ferulit. It 1s believed that one has only to bathe in them C astle. The legends recorded in Y e, Arie nes, the
.;;: ahmurat1I bet ween in Miletus. As a sign of peac
to enJOY therr regenerative benefits (Ergenekon 1996a: 10).
1995 10 his citizens drawn by four eagles, which
King
shock ed the Mard ukian s who
ian
and 1997 (Ergenekon 1996b, 1997b, 1998a Lydian King Alyattes and the Med
Horses and donkeys have been totally replaced by tractors,
) were also daughter of the thought that the heave ns
dedonly belon ged to their god, built
recorded here by Bittel (1960-61) in 1908 . A ' ibly settled at the newl y foun
. ccordmg to oral Astyages, mairied and poss by archa eolog ical excav ations along
cars and minibuses. Animal husbandry has decreased observatories11 supported
een Arien es'
history, the village is said to have been founded d battle took place betw
. 500 ('Ii t city of Pteria. The secon Babylon in Iraq to
bly, leaving only three families who keep flocks for
cons1dera the Tigris, carried the imperial palace from
the
. h_r
2500) years ago by t ee bands of the Turkish
Ogu z ri '
: brother King Croesus
of Lydia and Cyrus the Grea t7 of
1949) , learne d how to interpret the
commercial purposes. A few families have bee-hives in their Balh in east Iran (Lewy
who settled at an ancient site founded by an d . .
Persian Acha emen id Dyna sty. When the Medes Dynasty and the services of
stars and did not need
vin yards. "The vill gers fllow a folk calendar adjusted to called Sah Murat (Dogan 1995: 257; Ergeneko 1 future according to the
by their cousins the
. . 9'. their Empire were overtluown claim ed that the one and only universal
their ecosystem, which dlVldes the year into four seasons ", A combmat1on of all of these stories is told by v1 the Mardukian clergy,
of Cyrus the Great in 547
.. agers as 11 Achaemenids under the leadership he was Sin's proph et (Lewy 1949:
months are referred to in numbers" and "the year starts in II
. .
fo ows.. .. The Greeks lived m Kayseri, the Shah at Kevk God was Sin and that
the prophetesses of the
BC, ng Croesus of Lydia consulted the runic writin g in his dream,
September, when" villagers start to prepare their fields for the 33-56) and that he had learnt
e would fall apait
They traded with each other. Camel caravans went throug
": Oracle at Delphi. They predicted that an empir it before (Lewy 1949: 68). He also
next ye' (Ergenekon l 998b). Traditional houses built of though he had not known
(K1z1hrmak).
.
road by the mountain.4 In those days, Turkey and Iran were if King Croesus crossed the river Halys Mard uk asked Nabu naid in his
grano-d10nte rocks from the mountain have been rep lace d said that one night the god
crossed Halys
.
one and the same country. When the two brothers o{ Iran Interpreting this prophecy in his favor, Croesus city Harra n.12 Nabu naid told
wit
'hb' nck houses and tile roofs with new floor p Ians. dream to conquer Sin's holy
ed and the
. .
fought each other, one of them came and settled with his but was chased back by Cyms. Sardes was occupi s Empi re. Mard uk then
Marduk that the city was in the Mede
TradiIlona 1 weavmg and dress have been abandoned. All of way back,
desc ndence at Kerkenes as a king. He assigned his two sons
Kingdo m of Lydia disappeared the same yeai. On his er the whole empir e one
conqu

the vil agers are related to each other through endogamy to bmld walls around the c1ty. Th ey started as young men at according to Herodotus Cyrus warred with Queen
predicted that Nabunaid
Tomris
would
of the
the Great .
was realiz ed by Cyrus
prefng to m either their parallel or cross-cousins. day (Lewy 1949: 82). This
the same point and worked their way in opposite directions. Sakas east of the Caspian Sea and was killed there. noma dic Chald eo
was introd uced by
Fanulies are patnlocal and patrilineal. They belong to the en they met again The Sin (moon) Cult
both had become old men with white The name Keykavus is intriguing because it is the title inated the desert,
Sunnite sect of Isla m and hold many pre-Islamic beliefs, such accordi ng to Aram eans to Anatolia. While the moon illum
h Ir and beards. Meanwhile, the Kerkenes King's brother, the attributed to the last Babylonian King Nabunaid
night, Merc ury, Venus , Jupiter, Saturn
as the star, ancestor, wood and water cults. Food, pastries and King of Iran, had a son called Murat. When he grew up, his some tablets and cylindrical seals (Lewy 1949: 107). He is people who travelled at
them their direct ions. The sun, on the
sweets m ade of grain, dairy products, eggs, vegetables and father told him to go to Kerkenes and kill his reigning uncle known for his polytheistic beliefs about the Sun (Samas), the and the stars showed
domi nant divini ty for agricultural
grapes offer a variety of dishes and drinks. Poultiy and meat there. The son entered the city disguised as a hunter. But when Moon (Sin), Venus (lstar) and other heavenly objects as other hand, became the
66). Kay Kawu s, who was a
are consurned only on important occasions such as religious Murat was caught he confessed to his uncle that he was sent opposed to the monotheism of his native Mardukians of Neo societies (Lewy 1949:
. . ramea n origin , was some times
and social celebrat10ns like engagements, weddings, maIe tere to kill him. Instead of punishing him, the king disa rm ed Babylonia (Iraq). The tales of these events are recorded as Babylonian of Assyrian-A
. .. . "!star 's Husba nd" to show that he was
Clfcumc1s1 ons, farewell and homecoming parties before and him the Iranian legends by Persian authors (Lewy 1949: 29, 108-109). called "!star's Son", or
. . nd married his cousin to his own daughter. After n (Lewy 1949: 77, 79).

after Ilgnm ge to ecca. Politically the villagers adhere to weddmg, they settled in this city (village), hence the nam e Accor ding to Ebu-Cafer of Taberistan (Taheri 1980) "Kay" is a semi-god by way of famil ial relatio
goddess lstar honored
the nght wmg Nationalist Action Party and the recent Sahmurath.5 a title meaning "The Good" in Persian and is given as a title In another version of the legend, the
that she would carry him like a tiara on
reIi. g10us We1fare Party, the social democrats being m the However, according to another version the king and his only to Shahs (Taheri 1980: 443). Taheri states that Shah Kay Kawus by saying
. . . Like Mose s at Mt. Sinai (Sin's
nunont . There 1s a 100% rate of schooling among the new people were killed by warriors who came out of the bags of Kykavus was Shah Kay Qubad's son. Shah Kavus had many her head (Lewy 1949: 93).
at the moun tain tops, Kay Kawus
generat10n, but the few that graduate from universities seek the camel caravan that entered the city (perhaps through the wives, one of whom was the daughter of Efrasiab, the King of mountain) and Solomon
. place s were closer to heave nly gods.
pro1ess10na
c 1 JObs in cities. A local dialect of the Turkish Contrary Road and the Kayseri Gate in the southeast). The Turk istan. Keykavus sent his son, Prince Siavush, who was also believed that high

obser vatory templ es - the conical

language is spoken in the village. The locals are quick to merchants were allowed to camp in the city square in front of born of another wife, to Turkistan for training. The son came Therefore, he built the
Urfa (calle d Ehulh ul), Ur and other
compose rhymes, verses and poems that fit a social situation th te le (possibly between the Keykavus Castle and back when he ziggurats - for Sin at
was 20. He refused the approaches of his step at their peak like
les carrie d a cresc ent
(Ergenekon 1996b: 12). Some legends which refer to events Kiremrtlik). They attacked the citizens when ever yone wa s mother, who was the daughter of Etrasiab. Offended, she. places. The moon temp

' I extend many thanks to Dr. Geoffrey and Francoise

Sununers, who mspued me' the SahmuratI peop1e, local authorities es ID
'
1
.
A title meaning 'The Wounded Hero''.
1
at Sorgun Town' my colleagu
the Depts. of Archaeometry and Modem Languages and my assistant . and sociaJ anthropoI ogist
Ms. Aylan Erkal (Ankara Univ. and MET U) for thetl' He is known as "Biiyiik Keyhiisrev" in Turkey.

.
invaluable help. Fro m the archaeological survey, we k now that Kerkenes contains the remains of ancient water-reservoirs
,
' According to Babylonian and Persian sources Keykavus is a title attn'buted to the 1ast Babylonian son
King Nabunaid and his successor, Cyrus the Great's The Father, the Son and the Holy Ghost.
10 considering the last as God.
Cambyses (Lewy 1949; Taheri 1980).
. The Hay dari Arabs of Hatay believe the Prophet Solomon, the Prophet Mohammed and the Prophet Ali,
' 11 stairs around it outside.
Mt . Kerkenes was both on the King's Highway and the Silk Road The Sin temple he built in Hanan is called Ehulhul (Lewy 1949), which is a conical ziggura t with
5 .

As mentioned above potential maniage panners for Sahm urati I youngsters are parallel or
cross cousins (Ergenekon l 998a: 3).
12
Hanan by Urla at southeast Turkey.

114 115
 and the Keykavus castle
the legend of Kerkenes city
archaeological survey and
Ergenekon, B
. .
rcIiae .
arison . the Kerk enes
.
ological comp .
j\11ethnoa
. t: How w e
cI nt osh J
. 1986 T he Practical Archaeo
log1s
Koy M
the local mosque and its minaret at $ahmurath today. through periods of fainting (epilepsy) and t 996a, Arkeo
metri: Kerke nes ve Bir
; ' ;
hat w know about the
Past, The Paul Press
B" 1 k o
Kerkenes, which was considered as a holy mountain by the consciousness, going through short periods of
hus lo
st ergeneko'. . .n Sila Y 1l l , Say1 2, Dogus Ma :
tb as1 Yoz gt'
.
;.
lt d 146-173.
. . me n t ia tt
de J(iiJturu,i es Dagi: Bir Dag Efsanes1
mn
1996b, Kerken ac-i Nebeviyeye
Hittites, must have been a suitable place to worship celestial moved his seat from Mecca to Medina, he chos hi h
e g Q
ergenekon ' B., nbu1, 136- 144.
B
Sm'd N ursi, 1991 Otuzbirinci Soz: Mir .
and towers to call his followers to pray to All h Pia
I sta
" '

s1m Sozle1, ASM,

Ka
D ai'rdir, Risale-i Nur Kiilh

. ,
pe1nde,
bodies and honoured as holy during the time of the Medes rg1 s1 yatm dan
Atlas De
.

a es Sahrn urat h
Empire under Kay Kawus. Cyrus the Great, who was Kay ascended into the sky after his death to join All ah ( '. nd he ergenekon B., l
.
997a Arkeometri:
Kerken
593-626.
1? , The Mountain Top c
Sai N11f1i Say1 3, .
ogus M atbaa 1 Yozgat' .
ity
mers, G. & Summers, F., 1994
Kawus' political opponent and successor, believed in the one 1991; Smw; 1997). '.
.. . sii, in Sila
'
Y 1J l , . .. .
. ..
o
J( p
ru
7b, Ekoloj ik Deg1sm e : Geling ullu BaraJl Sum
Cap adoc ia, Ark eolo )I ve
K k e Dag (Yozgat) in
universal god, Marduk. His son and successor, Cambyses The Sin temples were symbolized by a cresc
e nt T ergenekon I B 199 l,
, Y 1l ll'.
Say1 5,
(Kay Qabus), burned down the moon temples when he came ziggurats were conical in shape and had stairs
o uts de
hese
l
that v e Es n g Kasa bas i,
8a Keykavus ve
S1la Der gisi
Kerkenes Efsanelen, m
:
na 1 , Say1 62/63, 3-20.
&
Test Trenches
to power (Lewy 1949: 94), but belief in them lingered on. went all the way to the top. Today, the domes of t
ergene ., 199 , G . S ummers, F ., 1996 , Survey and
y,
hem ko n B at. Summers,
tba as1 ozg on the 1996
Today, the Sahmurath villagers still remember the game of and the narets in Sahmurath and the rest of the v:ues S'la y'11 2,
Say1 6
'
Do gu Ma
.
m Sahmurt1 i Vll 1 age v
at n.er
.
kenes Dag-. A Prelimina1)1
Rep ort
rcha eolo gy ara.
ges I b, Eth noa Archaeol ogy at Ank
jumping over the fire called "Sin-sin" their fore-fathers played surroundmg Mt. Kerkenes have crescents on their
ro ofs ergenekon, .
B.,1998
in Turk ey, in Pmceedmgs of the
Season, British Institute of
Summers, G. & Summer '
ns
.

atio
(Ergenekon 1996a: 14). minarets are tall, cylindrical towers with winding stairs:
. . in side 1'.he by Kerkenes
E xcav
?' ympo s1um, University of
s F., 1997 , T he Kerk enes
B
Dag
. .
ntls h
S 1997
.

haeo met Seas on,

that lead to small balcorues. These rerrund us of the
ziggurat
s
.
JI N ati ona l Arc
(fort hcom ing).
Survey: Prel imin ary Rep ort on the
Conclusion and the temples of Sin. The Sahmuratil villagers
ke e a oza,Spain

of Kerkenes ag and
-
Institute of Archaeology at
Ankara. .
Turkish flag at home as their national symbol. This fl h a
ag Gurney, JRH
Zar .
akl 1 o
1995,TheHittiteNames
. yilk Reprinted fmm Anatolia
. n Stud ies: J. of Sum mer
.s,G., 1997 Theidentification of theiron Age Clty on
: .
Anatolia ' Joumal of Near
There are similarities between Shah Keyhusrev (Cyrus) white rscent and a white Venus on a red back
groun : Kerkenes D ag m Central
chasing King Efrasiab of Turkistan westwards into Anatolia in symbolizmg the aurora, the polar refractions of the
K u
Inst.
'
of Arc haeoloc y .rn
at A n k XLV, 69-71.
tem Studies, University of
.
Chicago.
sun as
.

th e British y Eas . . .
. s.m g, G " 1975, Socio-arche
ology, Cu11ent Ant hrop olog at1,
Taberi's history, Shah Cyrus chasing King Croesus west of observed in Turkey (Tulunay 1993). A red scarf is put disi: Peycambenm1z111 Hay
around GJes Suruc, S., 1997, Kainatin Efen
Halys back to Sardes inHerodotus' history and the versions of the neck of the bride and a green one around the groom 16,323-3 43. Vol. J,11, Yeni Asya, Istanbul. . .
.
at . .
s1, Cllt I,
E . C. M. B. c., 1980, Tarih-i
these mythes told in $ahmurath. According to Taheri (1980), weddings. Here the red symbolizes both the female and <l o tus I.76. . . Taben Tercume
the Hero llca twn s of Ta beri
1979 Ethnoarchaeoloqy:
lmp '
Shah Keyhusrev, who conquered Turkistan (530-532 BC), color of the sun, while the green symbolizes the male and Kramer, C., (ed . ), Konya.
, Co1umbia Univ. Press ,
the '
t. of
ve Gilne, Serm'nar, Dep
Archa eo logy
built a city called "Keykred" (the location of which is belief in Islam in Sahrnurath. Today, the Persia n word Ethnocraphy for
Tulunay, Y., 1993, Evre n
ara.
unknown). He asked the Prophet Solomon to help him and "Sitare",meaning both star and Venus,is used as a girl's name NY . .
Kaus Archaeomet1y, METU, Ank
H 1949 The Babylon
ian Background of the Kay
Solomon sent him his giants. They were ordered to build walls and "sin, sun, san, su" as syllables in girls' names s e!\ as
u Lewy, ., '

of 7 parasangs in length and 4 f loors in height.However,Allah
sent an earthquake and the city was destroyed (Taheri 1980).
This version and Summers & Summers' archaeological survey
show similarities. The very name of the Castle Keykavus leads
us to seek a connection between this Median City of Pteria and
Babylonia. As mentioned above, the name Keykavus is
provoking because it is a title given to both the polytheist
Babylonian king Nabunaid, as well as his political and
religious opponent, the monotheist Mardukian Cyrus's son,
Cambyses. The former is, however, spelt Kay Kawus, while
the latter Kay Qabus (Lewy 1949; Taheri 1980).
The beliefsNabunaid and his opponents represented and the
symbols they used appear as national and religious symbols in
Sahmurath today. Briefly, Shah Keykavus believed the trinity
of Sin,Samas and Istar and other celestial bodies to be holy,he
rebelled against the Iraqian god Marduk's religion (Lewy
1949: 31), he claimed to have ascended to the heavens seated
on a golden throne, he built a tower like temple-observatories
to watch the holy stars, he went through a period of dementia
in Yemen (Lewy 1949: 32), he claimed that god, Sin was the
"only universal god" and he was Sin's closest associate on
earth (Lewy 1949: 33-56),although he didn't know how to use
the stylus on a tablet, he claimed to have learnt to use it in his
dream (Lewy 1949: 68).He moved his capital from Babylonia
in Iraq to Balh in east Iran (Lewy 1949: 31).
The Prophet Mohammed, who lived in Arabia a thousand
years later than the Pterians (570-632),is highly respected and
followed by Sahmurath villagers today. The
Mohammed has similar properties to that of Kay Kawus, in
spite of the fact that Kay Kawus was a polytheist, while
Mohammed was a monotheist. Mohammed communicated
II, 28-109.
"Aysun"13 relating to the moon in $ahrnurath and other places. Legend, Orientalia S V
The $ahmurath villagers use the expression "I will make you
a crown on my head" when they want to show their gratitude
and great respect to somebody, which reminds us of Istar's
expression to Kay Kawus: "I will carry you like a tiara on my
head". This term is widely used for mothers in $ahmurath and
elsewhere in Turkey.
F rom the Keykavus Castle the Sahmurath villagers can see
as far as Mt. Erciyes in the south and Hattusa in the north. It
must have thus served as a proper watch tower for the Pterians
both for reasons of defense and visual communication. The
palace remains identified by Summers & Summers (1996,
1997) join a wide ceremonial street in the east-west axis. Mt.
Kerkenes no doubt was an appropriate place to watch the
movements of celestial objects.
It is still too early to say anything about cultural continuity
between the Pterians and the $ahmurath villagers, because
(although we know a lot about Sahrnurath) the archaeological
survey so far does not lend much evidence about all aspects of
their culture. However, it can be concluded that the religio u s
beliefs and some symbols o f the $ahmurath villagers tod ay
have certain counterparts in the beliefs which are known to
have existed in the 6th century BC in the Media n the and
to ry
Persian Empires. Today the Sahmurath villagers' oral his
la nd
testifies not only to their ownership of Pteria as grazin g
u ally
but also that the villagers identify themselves intelle ct
with the ancient inhabitants of Mt. Kerkenes.
Prophet
References
Bakai, K., 1769, Seyid Batta! Gazi Destam.
ag

with the one true god "Allah" in the Hira Cave of Mountain Bittel, K., 1960/61, Legenden vom Kerkanes-D
Nur. The revelation took place in his dream; he was illiterate (Kappadokien), Oriens 23124, 29-34.
orgu0
until Allah sent the holy script of the Koran to him and Dogan, D., 1995, Sahmurath Koyil, in Sorgun, S
ordered him to read, which then he could. Mohammed went Kaymakamhg1 Killtilr Yaymlan.

13 The syllable "ay" means "moon", the syllable "sun" means "dedicated to". Other examples of such names are Aysan, Aysu, Aymelek, Aylan, Ay dan an AYsel
d

for girls and Ayhan and Aykan for boys.

117
116
 H EOLOGICAL CORING, USING CRYOPROBE TECHNIQUES
AR C A
GE o AN EXAMPLE FROM THE AMERICAN SOUTHEAST
I v 2 3
GARRISON, E. G., SERMAN, N. & SCHNEIDER, K. A.

Franklin College of Arts and Sciences, Department of Geology, The University of Georgia, USA,
1

2Department of Geology, GG Building, The University of Georgia, Athens, GA 30602-2501,

!lj.S. epartment of Agriculture, Forest Service, Southern Regional Office, 1720 Peachtree Road, Nw, Atlanta, GA 30367
D

S' location and characterization in wetland areas or saturated soils has benefitted from the combined use of ground
) and cryogenic soil probes. This synthetic protocol has been developed and successfully applied in the
'ating radar (CPR
penerican South over the past five years. It has been applied to both prehistoric and historic archaeological sites at working
mhs of 2 meter s or more. The CPR systems are standard models familiar to many workers while the cryoprobe as a variant
e
h types developed in Germany and Switzerland in the early 1990s.
of Thee single greatest difef rence between the U.S. and European version is the complete reliance on nitrogen as the coolant in
due to the elevated ambient air and soil temperatur es. Rapid recovery of intact, relatively uncompressed,
the Am erican South
n
sedime t colu mns has been obtained for in-field comparison with CPR data of adjacent archaeological deposits.
Th is pro tocol has increased confidence in the inte1pretation of the radar data enhancing its role in the overall
ch ara cterizatio n of the archaeological site as whole.

KEYWORDS: GROUND PENETRATING RADAR (GPR), CRYOPROBE, SEDIMENT CORING, SOIL FREEZING,
ETOWAH, SCULL SHOALS, GEORGIA, USA.

Introduction Cryoprobes

To characterize archaeologically interesting alluvial deposits "Soil freezing" Cryoprobe technology used in archae
we have used geological coring to obtain soil/sediment samples ological studies has a recent history. Swiss and German
from archaeological sites. A recently developed coring investigators have, in the late 80's and early 90's, deployed a
technique based on cryogenic technology was used to extract variety of coring techniques that freeze saturated soils
nearly 2 m long sediment cores. The "cryoprobe" technique (Capitani 1993; Grebothe et al. 1990; Hochuli 1994; Lassau &
was first used in Europe in the late 80's and early 90's (Hochuli Riethmann 1988) (Fig. 1).
1994). It uses a closed 1" (2.54 cm) stainless steel pipe through The technique is patently straightforward. A hollow pipe,
which a cryogenic fluid is circulated. This pipe, after insertion closed on the insertion end and open at the top, is driven into
in the sediment, freezes a continuous coating along its length the soil by manual or mechanical means (Fig. 1). Into this
which, when extracted, yields an undistorted record of the pipe a cold substance - dry ice, liquid, or gas such as C02 or
lithostratigraphy. This sediment column exposes the depos nitrogen - is introduced in order to freeze the surrounding soil
ition al record for use in a variety of subsequent analyses - to the pipe.
pedological and geochemical. At archaeological sites in The reasons for using this approach for stratigraphic
Georgia the first American prototype was successfully sediment/soil sampling include (a) recovery of relatively non
developed by the University of Georgia Geology Department. compressed samples in contrast to those recovered by

CJ
CJ
C:]
D
0
l
0

a b c

Fig. 1. Insertion, application of freezing media, extraction of cryoprobe (from Hochuli 1994).

Proceedi
ngs of the 31" lntemational Symposium on Archaeometry, Jerem, E. & T. Biro, K. (eds.), Archaeopress-Archaeolingua, BAR- Centi: Ew: Sei: 1.
h
 Garrison, E. G., Se1111an, N. & Sc/111eide1; K. A
. Geo archaeological Coring, Using Cryoprobe Techniques - An Example From the American Southeast

negli gible at an R equal to

. onal corin g methods and (b) recove1y of more 4.5 to 5.5 times ?;' 19th century agricultural practices. These agricultural
ttaditi
complete
. (the
l uo us ) se d 1ment co urnns 1 radius). practices were responsible for extensive erosion of bottom
(cont n
I saturate d s where
+
.
m SOI

freeiing
This is valid for sands and clay
ficatio n (and loss) of the sample c ey soils. R i. s s and upland soils in the Oconee River valley (Ferguson 1997).
li u i maller .
an be a problem.
physical standpoint the freezing process can be as the heat removal in clays During the industrial period over 4.000 acres ( l .200 hectares)
qFIo m a

tr eated
as a reverse of a heat-loss problem in thennodyn allllcs
. .
Necessarily, the freezing time
is muc h sI o wer th a
is roughly prop or .
t1onal
In clay8
n sands
.
/'
.,. were deforested and used to produce cotton for the textile mill
J w & Jaeger 1986). In this case the process 1s cooli ng over the abso lute coolant temperatu to one along with subsistence crops for the workers, managers, and
( Cars a re or
,.H,.o unding medium rather than heating it. The fommla Freezin g Time - 1/ absolute
coolant temper other village inhabitants (Hunt 1980; Stovall 1 984) .
the Su . . ature
is as follows: The freezm g l ime is not linea
for this r follow g, . We extracted two cores of nearly 1 .6 meters each inside the
m instead
h y erb o 11c ath such as seen in mill and along the natural levee on the Oconee River (Fig. 5).
two coolants of _ 0 a
20
40 C. Th e llme required for the a nd These sediments were used in geochemical and plant
-40C cool 1
-20 C c oola n t. Lower temperat mqmili
macrofossil studies. Macro-pedological study of the cores
. ure coolants cut f at of
reez1ng ti
.
0

is the "heat" lost, in our case "cold" gained; Tcr the mcrea se the strength of the
frozen soil and . Ille, delineated the anthropogenic and natural deposition in the
h ere T . Increase
w perature of the "country rock" e. g . the soil and TP, the . g radrns. One observes that mill's sediments at a depth of up to (1.6 m) as determined by
the freez
freezm the
tem mg lt.me .
18
.
rature of the probe, all in degre es Celsius. At the
proport10nal to the square of the cryoprobe borings. The pedologic profiles delineated the silt,
freezing radius as
ternpe
probe
0 . . Well ( g>).
::::20; Tpr- 197 t h en T ==-177. Usmg an
exponentia 1 curve An exact calculat10 n of freezing time t clay, and sand percentages are shown in Fig. 6.
I'f Ter ' f 0IIowi. ng
Joss, as Carslaw and Jaeger su s Khakimov, is:
f0 he at
gge t, we can expect a

t'. \or of 2 "dro " p in the soil temperature -88C , and Con cl usions
c
at 2 cm to
.
c m th e temperature 1s onI y -30C. Factors influencmg . the Ir== t'
at 4
C, Yt ro2f'A.1
fl w of cold include water conten t - the more water increasingly
ake or o hea t conductivity of the frozen soil From the mid-1990's the authors have

where: "-1
: : reater t e latent heat and slower heat loss, slower frezing incorporated technological advancements such as the
=

g
=_in meters
SroJt
.
r, it 1s the water content that detemunes the sohd1ty of cryogenic soil probe into a geoarchaeological methodology
r

w
Ho eve c, =specific heat of the froze
n soil in Kcal/kg:C
sample after it freezes to ice. designed to characterize archaeological sites such as Scull
the core . Yi = unit mass of the frozen soil in
ognized soil expert and pioneer in the science of so ti
3
Shoals and Etowah.
The rec
Kglm
Fig. 2. Map of the Etowah site (from Thomas 1894).
external radius of the freezing pipe
.
w as the Soviet academician, Kh. R. Khakimov. His
f eez ing
ro =
(m)
rt b ook entitled "Artificial Freezing of Soils, Theory and t' determined from tables, an empirical
rctice" (1957) laid the groundw?rk
=

constraint for a given coolant

for ost conemporary
.
ding. Khak i mov descnbed s01 l freezmg as a
u nderstan . Some example values include: sand (alluvium)
phenomena dependmg on:
com plex /1.1=2.5 K ca.mh C (2.34)
r =0.057m
the soil medium to a temperature of
cooling of
of free H20 C1 = 0.254 K cal/KgC
crystallization

allization of H20 at 0C Y1 =2100 Kg/m3 (2670)

the cryst
alterat ion of the thermophysical pro p erties of the soil

freezing of the bound H20 below 0C

Example studies from Georgia

variation of soil moisture.

In Georgia we have used a combin

ed geophysical

fo Khak imov, most formal mathematical treatments geological coring methodology in

Be re the study of two very
. the heat capacity of the freezing body or soil different types of archaeological sites
- ( l ) Etowah , a late
1gnored
in 1 933). He proposed and c o nducted large scale prehistoric Mississippian Culture
center (Figs. 2-3) Scull
(Morosh k
ex pe riments with various soil media (clay, sand, Shoals, an 18th century industrial village
freezing now Jong abando ned
vel, etc.) and coolants (dry ice, liquid C02). Khakimov's to nature. At both sites we have carried out geophysical
a
gr riments were aimed at developing techniques to aid studies of specific site elements - at Etowah, a platfonn
ex pe
engineers m the stab 1 l 1zat10n of water- 1ogged SOI1s mound (B) an d at Scull Shoals, the remains of a water
Soviet

th ose encountered in the construction of the Moscow powered textile mill (Fig. 3). Typically,
'

such as we deployed gro und

(Garris on 1991). penetrating radar (GPR) and magnetic prospection methods
subway
An obvious first result of the early experimentatio n con- followed by geological coring with our c1yoprobe. The results
firmed th e differene in he freezing r s p o se of different
have been encouraging.

f sediments. Silty soi ls freeze outs1de-m" , e.g. external At Etowah the radar has prove to be the most eff ectiv e
soils o
al as the free H20 is squeezed radially outward. geophysical tool for examining the interior structures of the
"

to intern
oil freez es top-down with an upward migration f free 13th century mound . Evidence suggests at least two
Sa ndy s
810. Even in unsaturated sandy soils water vapor nugrates constructio n phases and a possible interior feature. Co ng has
ri
freezing boundary. produced sedimen t profiles to -5 meters withi n the m ound.
oa rd th e .
1 The freezing boundary is termed the "freezing radius", z. the
These profiles have been used
to (a) characterize
aboring the audience with the differential equations sediments used in construction and (b) calibrate the
With out bel
balance, it is assumed that there is a linear relationship geophysica l data (F ig. 4).
he at .
and the distance, R, from the freezing pipe to a At Scull Shoals both magnetic prospection and radar h ave
c

between it
the soil, where T is the same as b efore freezing so: produced useful data. The geophysical
data indicates that
the
point, in
present ground surface represents a ui vale nt
level in the mill eq
R ==a?f' to the first-st01y of the 19th century structure. What th e GR
data show is a signi ficant build-up lluvial
of overbank a
hi
a is a constant for a specific soil type. Khakimov wJt n the mill due to increased flood frequency
at
where
d epos1ts

w " fluence of the freezing pipe becomes

that the m Scull Shoals t hought to have been the result of unch ecked Fig. 3. Tintype of the Scull Shoals mill, mid-19th c.
sho e d

120 121
 Garrison, E. G., Se1111m1, N. & Sclmeidei; K. A.

0.0 meters References OGICAL SITES AS A KEY

UVI AL SE DI MENTS NEAR ARCHAEOL
co L
L MAN IMPACT
E EVOLUTION UNDER HU
Capitani, A. de., 1993, Maur ZH -
Schiff!an
" de. ro rHE PAST LAND SCAP
untersuchungen der Ufersiedlung Die la
'
1989 bis u southern Germany
derSchweizerischen Gesellscha'J'
1991, l the Kraichgau Hills in
ft jiII
UI- un
. . ahrblldi
chaeolo gical case study fro m
76' 45-70 .
d Friihge
schiclue /. geoar
Carslaw, H. S. & Jaege r ' J. C ., 1986
, A. & WAGNER, G. A.
KADEREIT, A., LANG
Sorids, 2nd Edition, Clarendon Pre s
Condu ct'io n
0xford.
of He
at in fer Kernphy,ik,
ajlen am Max-Planck-lnstitut
Ferguson, B. K., 1997, The Alluvial
W1'un>eh
Hdddbecger Akademie der
2.0
ro ess of P
Pie dmo
for>Ch""""dk Archaeometrie der
eide lberg, Gemiany
Streams, in Effects of Watershed it D-69029 H
evelopme
nt alld
Rosner, L A
light Brown Silt-Clay Management on Aquatic Ecosystems,
Ne w y,ork,Amencan Society of Civil En
.
n
32-142. .
gineers,p.. 1 . (ed ), ity of an archaeological exca,atio
le collu,ial "dime nu in the ,icin
E. G., 1991 ' A H'istOI)' of En
. n,
Garnso arch aeol ogic ally almo 't ""i
to ,ial dep'i"
gmeermg a ,Jatmg i' applied ,,ciated by archaeolo gi"' collu
. Op t l n not enough 'ufficiently app
3.6 Technology, Artful Methods, Boca Ra alld
g Neo lithi c and Iron Age "main,. Ofte ulate d lumi ne" ence (OSL)
ton, CRC "im
Reddish Silt-Clay Press' ite eontoinin ecological and "lkf change<. Opti
cally

'toV' to be
Inc. fre docu men ting past
mg a wduable arch w ing fart her
gical in,.'1igotion,, thu' allo
Grebothe ' D., Lassau, G., Ruckstuhl y in the context of geoorchaeolo
& s eifert ' M 'truc t the collu,ial c hronolog
3.8 p' to '"'" "
199() #ng hel
und er hum an and/or climate
impact.
.
Thay ngen SH m
vve1er: Trock eneissondiernn 19 9,
Jahrbuch of landscape chan ges
.,

a
elucid tion
-

un Fru- hgeschi
I

chte
Dark Brown Silt-Clay de1 . Schwe 1zenschen Gesellschaftfiir U 1 G. SOIL
NCE, OSL, OPTICAL DATIN
73, 167-175. OLO GY, OPT ICA LLY STIMULATED LUMINESCE
ARCHAE
l(EYWORDS' GEO IMENTS, IRON AGE, GER
MANY .
Hochuli, S., 1994, Unter den "Bahn 2000" . EROSION, COLLUVIAL SED
, Gefrie rkem
5.0
ch we1. z 17 ' 25 3
Bohnmg in Kanton Zug' Archaolog1'e de1. S t luminescence signal keep
Hunt, C. C., 1980, Historical Su1vey Rep0
radiation damage and a laten
Fig. 5. Clyoprobe 1 .t, S cull Sho- als
0.
Introduction grain s are exposed to daylight as
Fig. 4. Sedim ent descri ption . growing with time, until the
core at extraction, C omm uruty, Greene County, Georgia' USDA Forest . 2). After being transported
Atlanta.
(Fig.
of Mound B cryoprobe c ore.
a consequence of soil erosion
length is 160 cm.
. Service,
ered
s of Middle Europe have suff ral grains are buried by
The old settled loess area
. .
mine
and redeposited downhill the
Khakimov' Akh R" 1957 , Artificw l Freez ing of so11s. Theory e the onse t of agricult ure in
t luminescence signal
considerable changes sinc other colluvial material so that
the laten
Additionally' the prot o t ype c1y ogeruc conng teehniques
.
s of the u s SR
. . pletely
ted in partially or com
p
and Practice' Academy of Sc1ence
Neolithic time, documen are samp led, e.g., in the course
starts growing again, until they
co pled wit geophysical, geochemical, macropedological,
.
s exposed to soil erosion by
p
; _
rrnafrot Institue in V.A. Obrnche, Translation
b ; isrei truncated soils in relief position of an archaeological digging
cam paig n. In the luminescence
. soil material detached and sample is measured
a? plant Illlcrofossil studies provide a robust geoarcheolo- ogiam m Scienti fic Translations ' (1966) water. On the other hand, ence of the
laboratory the natural luminesc
Lassau, G. & Riethmann, p" 198 8, Trockene1ssondi
.
. onmental studies. At Scull : esse s was redeposited, at least irradiated sample
gical methodology for pa1eoenvu erun g, ein transported by slope wash proc addi tiona lly,
as well as the luminescence of
.
. .
topo graphical depressions.
:;
in
Shoals ' Georgia ' this convergence of modem technologies has Prospe uonverfahr en im Seeuferbereich, Jahrbuch der partially, on the foot slopes and tive dose proto col).1 From the
. . . _ material from else portions (multi-aliquot addi
lead to ms1ghts into t he dynaffi!CS of paleoenvrronmental of lost soil added dose the
nshcen Gesellschaft fiir Ur-und Friihgeschicte 71, As corresponding remnants ence grow th with
.
sent an archive with a correlation of the luminesc
changes m a relatively restricted locality. At Etowa h, the where these colluvial depo sits repre also determined the
- Hav ing
paleodose (P) is extrapolated.
empasis has been on the characterization of prehistoric
. ating phases of

M oshkin, Y I., 1933, The Problem of the Formation of Ice memory of the landscape histo ry indic year - the time
.
ral dose in situ per
. 1 organ-
dose rate (D) - i.e. the natu
architecture and its role m Nauve Amen. can socta tals lity in the catch ment area (Fig. 1).
m Frozen Soils, Preventing the Swelling of geomorphic activity or stabi ding P by D.
Rru way Subgiade, Sb. NIT. Puti NKPA
t since burial is calc ulated by devi

. . chan ges were trigge red mainly

1zat10n before Columbus. 28 ]he question, whether these inly zeroed at exposure to
The latent OSL signal is certa
Sto val , A., 1984, Scull Shoals: A Feasibility tudy School of
S by human or climatic impa ct, can be tackl ed once a
e.g. with windblown loess in
' bright daylight - as is the case
ve is avail able, which can
.
E nVIronmental Design' U mvers1ty chronometry of the colluvial archi vial
of Georgia and South ern ent. The conditions for collu
R eg10nal Office, USDA-Forest Service Atlanta
an arid periglacial environm

know n clima tic chang es and

' be analy zed in the view of proc esse s, how ever, are
e wash

eolog ists postulate material borne from slop

Thoma, C., 1894 ' Report on the mound explorations of the erma ny archa
settlement history. For SW-G rial may be exposed not
y in completely different. The mate
Bureau of American Ethnology, Twelfth Annual Rep ort at least two phases of considerable soil erosion alread t has started, transported in a
of sever e ecolo gical befo re the rainstorm even
conse quen ce
of the Bureau of American Ethnology. Ne olithic times, with the and buried by more colluvial
1996b). muddy waterflow downslope
land degradation (Heide 1996a, 1 996b; Behrends the cloudy weather conditions.
%CLAY
material before the end of
STRATIGRAPHY of archa eolog ical sites, collu vial
However, even in the vicin ity
0 . ....
sediments are often highly sterile, i.e. poor in or even free
of tn1:ensiv Settlement History i
for rr r;:,f1f> y\
datable archaeological finds and material suitable
HISTORICAL OVERBANK
SEDIMENT
50 .. radiocarbon dating. <
PREHISTORIC OVERBANK I

Optical dating
BACKSWAMP SEDIMENT
100
and BURIED SOIL

e 1so
d:
Optically stimulated luminescence dating (also calle

optical dating) offers the oppo1tunity to determine the time

ir .. .. ....

<>.
200 elapsed since a mineral grain of a sediment was last exposed
cool.. climatic History
WEATHERED GNEISS t

to daylight and has been buried since. Luminescence is the
SAPROLITE Wet ... .. ...... . .
measurable expression of a radiation damage, which non
Time
250
conducting materials, like quarz or feldspar accumulate, ...
I
according to their own natural radioactivity and their
Fig. 1. Colluvial sedim ents near
300 archaeological sites:
urroundings, mainly the covering and underlying sediment
scape chan ges
ting past land
an arch ive documen
ay e rs. As long as the grains are sheltered from light or are not
in the catch ment .
. I 350
strongly
heated (as e.g. in the case of a prehi
stmic fire place)
Sand %Clay
erative, multiple-aliquot, single
Reviews on the different me tho ds to detem
escence dating (additiv, regen
odose (or equivalent dose) in lumin

( 1998).
une the palae

( 1998)
Fig. 6. Sedimentfi'actions, SrnllShoals core #l.
aliquot) are given e.g. in Aitken and Wagner

BAR- Centi: Ew: Se1: 1.

s.). Archaeopress-Archaeoling11a,
 near archaeological sites as a key to the past landscape evolution under human impact
l sediments
A. & Wag11e1; G. A.
Kadereit, A., umg,
Colluvia
ages corres
samples HDS-499 to HDS-496 with decreasing
covered by loess deposits duiing t chronology
history of erosion colluvium laboratory .
cene, this penglacial mouldi
he co ld
stage Colluvial ponding to decreas ing depth beneath surface .
PI e1sto ng of a s s o
erosion and . mo0th
reUef available The oldest dated colluvium (HDS-499) sample
d from a
the reason t hat m geomorpholo gical t e . r the colluvial depo sits are
deposition rrns the ar
ea is c n results fo depth of 380-387 cm below ground surface gives
an OSL-age
firSI ati g d e ep boring c o re drilled on the southern
'loess hill coun11y'. d
the pre-roman
The Holocene climax soil which u inte nnediate topographical of 2.33 0.31 ka (330 BC 310 y ears) fitting
. '
1.2 m (Eitel 1989), is a luvisol with an A-B
sua11y a
mou n 1s
t oo nb

4'0Jll 8 6ck foot slope in an
ist of pre Iron Age period. Sample HDS-498, which was
taken only 20
- C-p r fferre u Fig. 7). The lower 1.2 m cons
ofile (F sition ( cm above from a depth of 360-367 cm below ground
surface
beneath a dark humous Ah-horizon 'a
Iigh1 de
j p
(oOts lo P1
e
ollowed by 0. 5 m of
the truncat e d, bottom
c alc ifi e n e o e ss f . delivers an OSL-age o f 1.95 0.30 ka (50 AD
300 years).

honzon follows, from which clay miner Cd ffoI0c r 4.3 m present a
a1s hav e Juvisol relict. The uppe
. subs oil um was
out mto the underlying decalcified and fu
be e n f
... rt o .
a nal at the Within the quoted I-sigma-error-margin the colluvi
clay rich and decalc1fied mate
w

latent p . . rt herwe
a1h e v i 1 p file with deposited either in the Roman Period or the Iron
Age La Tene
collu a
honzo n, Ih us b econung a clay enriched B i- in the uppe r part. The
age = . rect carbonife rous material
luminescence 0 .
honzo n corresponds to the unweathered
I-honzo
n. The
bo om
;
an ilty
ical cons isten cy f or the lower 4 Period.
ii b) . . ca1carou ows chr
onolog
c
DI . . 9,_; s01l eros10n progrades from top to bottom
s IGes s
, c1a11n g s h
0 . a comp et
!
a) of correlatmg colluvial sediments would . . eP

c
.. . . ex hib11 a
ve , OSL'
Iayenng m a reverse order of the described .
u m-situ sequ l1i
: ence ample preparation:

c luvisol horizons. WrGGENHORN (1995)

green (500-600 nm) strongly subdued:
e The archaeological excavation site is s1 . illumination:
.2 . tuated on
a hi ll BG18 + OG 515
approximately 200 m above sea level., the he1g ZIMMERMAN (1971)
absorbed dose . . ht diffe re nc
e
grain fraction enrichment 4-11 m
soil chemistry/

the ne1ghbounng dry valley is about 25 m (Fi

. ' . g. 5). Corg-destru ction
A part f rom Neo I 11 hlC pits and La Te'ne . soil physics
time . . penod finds CaCOrdestruction
'
past present future site encloses mamly cellar remains of a late H
. a11statt pen at room temperature
settlement (Fig. 6) (Behrends I 998a 1998b) irradiation:
However 0

r Y: 1 -10 Gy/min
' 90S /90
some o f t h e ceI Jars - once dug some 2 m d .
'

Fig. 2. Application of optical dating eep Into th p

ground - onI y the lower some o.5 m are p 5 dose groups (5 aliquots each)
on colluvial sediments - schematic illustration. . ' . r eserved, th 241Am: 4 G y/min
md1catmg a re 11ef reduction of 1.5 m by soil . . a
a) Sufficiently bleached latent luminescence signal; erosion dunng
the last 2.5 ka. 3 dose groups (3 aliquots each)
b) insufficiently zeroed latent luminescence signal.
Remnats of the Holo

ne luvisol are prese rved
only in measuring: at room temperature

An insufficiently bleached signal however may cause age to ographically deep pos1t10ns. Soil erosion stripped
off all instrument: Rise-Reader DA12
overestimation.2

so an me of the loess material from the hilltop,
the upper
preheating: 2 min/220C
The proper signal reduction of slope wash sediments was n n e slop e and even some of the lower slope, again
near infrared: TEMT484-diodes (880 !:!. 80
run)
. '
md1catmg re !ief lowering of at least l m.
checked b y applying OSL-dating to 22 indepe ndently -
stimulation:
As evealed by drilling cores and excavator ditches the foot
radiocarbon or archaeologically - dated, colluvial samples. detection: photomultiplier EMI9235Q
slope is overed by 4-5 m deep colluvial deposits. This means
The ages showed good agreement within the erro r limits of shine down: ?:. 60 sec
that dunng the Holocen e the relief was equalized by soil
the techniques, with transportation distances of only 50 . BG39+2xB G3+ GG400, KRBETSCHEK et al. (1996)
er s1on and accumulation by at least 6-7 m
violet-blue:
metres proving sufficient for succesful OSL-dating (Lan g ? as compared
with a total of 25 m height difference between hilltop and 390-450 nm 3 mm each
_

1996). Therefore optical dating was applied for geo KRBETSCHEK et al. ( 1996)
BG39 + GG530,
valley floor. yellow:
archaeological investigation to retreive the memory of
The Jd st colIuvium, found in the deepest position on top 520-620 nm 3 mm each
colluvial sediments in the test area Bauerbach. ? . DULLER (1994)
of the n-s1u-s01I remnants, is of a light colour, decalcified analysis: Analyse 5 .22
As the Bauerbach loess derivates are rich in silt and GRON (1993)
and qmte silty. Further pedological studies are necess ary to Simplex 8/93
feldspar content we used the standard Heidelbe rg multiple AITKEN &XIE ( 1 992)
co nfim1 the field hypothesis that this colluvium, which has special trea tmen t : '
'late l ight subtraction
aliquot additive-dose protocol for polymineral-fine-grain
analyses (Table 1; see also Lang et al. I 996), for which
not been OSL-dated yet, is borne from the AI-horizon of the fading tests: uniITadiated + P-irradiated aliquots:
sample preparation (further developed from Zimmermann luvisol.
storage: room temperature
In the field a total of 8 different colluvial layers can be
1971, in Aitken 1985) is carried out under strongly subdued
distinguished, the lower ones being decalcified and - apart measuring: ?:. 3 months after preheating/OSL-measuring
yellow-green light, and luminescence is stimulated in the near
from the above mentioned oldest one rich in clay conten t.
infrared around 880 nm . Shine down curves of at least 60 s are _

Two phases of geomorphic stability can be realized within

measured in the violet-blue or yellow emission range, and the
the clayey deposits, one of them documented in a dark DOSIMETRY
signal mean of the interval 50-60 s is subtracted as 'late light' -
according to Aitken & Xie (1992). The samples are preheated
charcoal enriched layer, beneath which apparently deeply !-co unting : Littlemore ELSEC 7286

before measuring for 2 min at 220C and fading tests are rooting trees once grew into the underlying not yet OSL P-counting: Ris0 GM-25-5
s
carried out after at least 3 months of storage after preheat. dated Al-borne colluvium . Within the dark layer two nail
were found, which might be of Roman age (pers. com. H.
_I-spectrometry:
These however, have n o t yet been practiced for the samples
Eberspacher 1997). lab o rato ry (low level): Ge-detector
presented here. -
Signs of bioturbation mark the upslope transition, wh ere field: portable NaJ-detector
-
the colluvium no longer rests on Et-remnants but on bare NAMBI &A ITKEN (1986)
Test area he !ose-rate-calculation : dose conversion factors
loess. S mall burrowing animals mixed loess material into t
overlying colluvium and vice versa. a: a-counting, y-spectrometry
The study area Bauerbach is located in the Kraich gau Hills -
sa
in southwestern Germany, some 50 km south of the city of Within the uppennost metre of the colluvial sediment P: -counting, y-spectrometry
,...._
layer of anthropogenically dumped, extranous m ate rial R IESE R ( 1991)
Heidelberg (Fig. 3). Situated on the eastern border of the y: y-spect ro m et ry
,__
Rhine Graben, the Mesozoic geological base ment was
intem1pts the n01mal course of slope wash deposits. PRESCOTJ' &H UTTON (1994)
cosmic:
-

Exp eriences of dating insufficiently bleache d sed ime nts with elabo a e OSL metho s are
rt d reported e.g. by Fuller et al. ( 1994), Lamothe et al. (1994) and
ly bleached fine grained sed iments. Table 1. Multiple-aliquot additive-dose protocol fo r the analysis of polymineral fine-grain
fractions - brief overview.
Singhvi & L ng (in print). S o far n o reliable pr oto ol e
a c xistsforrou1 n
i de a1in gofinsuflicient
 Kadereit, A., Lang A & m
, rragne1; G. A.

i
Dresden\
_j')
v
',.

ch.
the test site Bauerba
Fig. 5. View from the SE of 4-5 m thick coll uvial fillin
g.
hill slope cont ains a
to the south of the d nw the hill top.
The drainage line Age ame, ;, >iwnte
eal> 1.5 m >OU ,,.,,,;an >ina Iron
nw
a,aaan >ite, w hich
The a<thaeologicol exc since the preroman
due to soil erosion
coll uvial deposits is
Middle Ages (here:
Results espe cially since the
Iron Age period and consistent with the
%)). These results are
in pro gress 2.8 m of 4.3 m ( 6 5 thern Kraichgau,
erbach is still sou
the test site Bau ( 1 989: 171) in the
As the w ork at 8a sh ows observation of Eitel of colluvial
marized. Fig. met res
results can be sum ce of several
only preliminary an loess who found eviden the Middle
young Wii rmi since
situation with a few hundred years
the pre-holocene ef. Yet the sedimentation within sol- Bt with com
paleo- reli luvi
ing the underlying Middle Ages the
covering and equaliz ntry' is only Ages. Also in the up by soil erosion
'loess hill cou strength was used
ical term periglacial p arably high shear
geom orpholog w point, one mig ht as sion ev ents bec ame
archaeologist's vie high magnitude ero
half truth. From a geo colluvial processes, so that rain storm eve nts.
al and ding
ocene 'soil erosion the case of outstan
.! well speak of a Hol proo vably even more likely in dsc ape and reli ef
be en ant lan
hough the area has dence of signific
Fig.3. Th e loc a landscape' (Fig. 8b). Alt port ion of the D espite the evi
tion of the test . quite a considerable
settled since the Neolithic,
site Bauerba ch zn .
. the loess covered Kraichg au Hills .
zn SW-Germany.
At the top of the
more clayey, subsoil-d . . . .
enved colluvium
samples HDS-49
7 and HD
S-496, taken from
epth >
0.08 ka ( 1140 AD 80
i';;' ) md>0otmg the High Medicro l
50m
270-277 cm
and 25 2 p0<iod. Aoco<ding to kn
Bor Bork (1987) and Bork (1989)
o

'q"'J.''' I0.86 -
57 cm b low
i '
.12 ka (1140 AD
grnund sur ace,
_of
give this is a period well own for high magnitude rainfall and
-%\%%\ -HMM-
---

I
I

120 years) and 0.86 . .

r -

runoff events lead"mg to extreme events of soil erosion by

0m water. r 1

0
0 0 \
Stratigraphically inconsiStent ages appear in core metre 1
"- J

0 00

----
,
-
.---

I I
and 2. For the uppermost metre this is due to the fact that with
00 I

sample HDS-493 at 78_85 cm below ground level no soil 0

.. . - ...: '. i

_
-

wash deposits but the anthropogemc filling layer with

- -
-
-
.

\
A1 extranous and n 0t properly bleac hed matenal .
was sampled.
.
0 -
--
-

As the fill"mg most probabl happened lately, deep plough mg cP

Y 0
. . . 00
and mixing in of this dumped matena 1 mto
. covermg slope
0
wash material must a1so 1ead to age overestimation for sample 0 site
0 0 Outer limit of excavation
1m Bt 0 - -

HDS-492. 0 .- -
-
-
-
-
--
;
Age overestimations ho ever, are also noticed for samp les I- -
-

-

Slit ditch

9
-

HDS-495 and HDS-4 41 t en at l?0-177 cm and 145-152

- --
-

.
cm below ground 1 ve1. t s not un kely that high magnitude Upper Iron Age
Bv h
soil erosional even s as t ey occured in the High Mediev al Upper Neolithic period (?)
Pit house, Latene
Period(cf above) caused the depos 1t1on of not prop erl y
C c/C v Pit of Michelsberg
Culture

. .
n

ne period house
bleached colluvial matenal m core metre 2 .
Eaves ditch of Late

As none of the up er flou sam les fails to produce an
:
Lower Iron Age
Grave of Latene peri
od
IRSL-shine plateau on y strat1graph cal inconsistency wit hin att period
1
2m
c the profile indicates that the top sed ments were obviously n o t

o Cellar or pit of Hallst

NWiW Ditchlike structur

e: loess hollow way
properly bleached before deposition - a situation un-
mnd> J996a).
. >ite Bauabach (Beh
Fig. 4. favourable for IRSL dat1 an d buckel within the""
Schematic pro'J' g, :Vhich leads to paleodose
'ile oif the Ho Iocene climax luvisol.
thus age overestimati n (c Fig. 2, growth curve ( b )).

Fig. 6. Map af the exca,a
tion >ite Hmenbnm nen

127
 Kadereit, A., Lang, A.
& Wagnei; G. A.
Colluvial sediments near a rchaeological sites as a key to the past landscape evolution under human impact
Core Herrenbuckel llb
PRE-HOLOCENE
. 1 996b, Jungsteinzeit - mittlerer Abschnitt (Mittel- Rieser, U., 1991, Low-level Gamma-Spektrometrie zum
B
periglacial loess hill country
JJeideollthlkum), in Behrends, H. (ed.), Faustkeil - Urne - Zwecke der Dosisleistungsbestimmung bei der Lumines
Depth ne
Sample IRSL-Age wert. A
rchaologie in der Region Karlsruhe, Badenia zenz-Datierung, Diplomath.esis, Faculty of Physics and
Sch
[ml Number [B.C./A.D.J [years] K arlsruhe, 55-62. .
Astronomy, University of Heidelberg, 67 pp.
solifluctio
n laYer Verlag, Singh.vi, A. K . & Lang, A., in print, Improvements in optical
M. R., Rieser, U. & Stolz, W., 1996, Optical
1
I J(rbetschek,
I ..-. a
dating: Some lunescene properties of natural feldspars, dating of partially bleached sediments: The differential

-- .J' HDS-491
- . '

n Protection Dosmietry 66, 407--412. partial bleach technique, Ancient TL.

440 A.O. R diati o
colluvium 240 a A 1996, Optical-dating of Late Glacial and Holocene
cb Wagner, G., 1998, Age determination of Young Rocks and
. Mesozoi
!---_ ---_.-1 HDS-493 edrock Lang,
3.340 B.C. 530 test cases of water born sediments from central
ediments: Artifacts - Physical and chemical Clocks in Quaternary
r__ .l_
"

silfy _
lementi di Geografia Fisica e Dinamica Geology and Archaeology, Springer Verlag, Berlin,
urope, Supp
calcarous I J
HDS-494 Sup plemento III, 241. Heidelberg, New York, 467 p.
580 A.O.
,
-

aria
I I 170 HOLOCENE
Quatern
I 'j HDS-495 820 A.O. LaJlg, A., Lindauer, S., Kuhn, R. & Wagner, G. A., 1996, Wiggenhom, H., 1995, lnfrarot stimulierte Lumineszenz von
190
colluvium soil erosional Por cedures used for optically and infrared stimulated lumi Feldspat - Grundlagen und Anwendung als Datierungs
silfy/clayey of sediments in Heidelberg, Ancient TL 1 4, methode, PhD-Thesis, Faculty of Physics and Astronomy,
calcarous '
and colluvial landscape ne scence dating
University of Heidelberg, 127 pp.
HDS-496 1.140 A.O. 7-11.
80
HDS-497 Lamothe, M., Balescu, S. & Auclair, M., 1994, Natural IRSL Zoller, L., 1994, Wiirm- und Rij3lO.fJ-Stratigraphie und
1.140 A.O. 120
b Middle Ages intensities and apparent luminescence ages of single Thennolumineszenz-Datierungen in Siiddeutschland und
- colluvium
colluvium
feldspar grains extracted from partially bleached sediments, angrenzenden Gebieten, Habilitation thesis, University of
... Iron Age I Rom
clayey an time Radiation Measurement 23, 555-561. Heidelberg, 174 p.
HDS-498 - soi/relict
50 A.O. 300 Narnbi, K . S. V. & Aitken, M. J., 1986, Annual dose
decalcified HDS-499
330 B.C. 310 conversion factors for TL and ESR dating, Archaeometry
2 8, 202-205.
Fig. 8. re-holocene periglacial loess hill countr
Prescott, J. R. & Hutton, J. T., 1994, Cosmic ray contributions
soil relict developz towards a holocene soil erosional andy
to dose rates for luminescence and ESR dating: Large
deposzt1onal landscape:
preliminmy scheme.
depths and long long-term time vaiiations, Radiation

Behrends, Measurements 23, 497-500.

loess R.-H., 1996a, Faustke
il - Urne - Sc hwen
Areh" aolog1e m der Region Kar
.
'
lsruhe, Karlsruhe 208
Behrends, R " H., 1996b, P

Jungstemzeit - jiingere
'

. . r Abschnitt
(Jungneohthikum), in Beh
rends, H. (ed.), Faustkeil-
Urne
- Schwert, Archaologi
e in der Region Kar
lsruhe
Karlsruhe, 62-72.
Fig. 7. Co//1111ial c/110110/ogy of the drilling
'

core Behrends, .R - H., 1998a,

Herre11b11ckel llb. Em' vveg aus der Jungsteinzeit
m
nachgew1esen? Archaologi
. sche Nachrichten aus Bade 58
n '
Fre1burg, 3-7.
changes in historic time, there are still older
COIIUV!a .
I n
. . . Behrends, R.-H., l998b,
topograph ically deeper pos1tions (distal footslop e Die Mic helsberger Kultur und ihre
pos1 t10n
. ) Randg biete - Probleme
h h
w i
are not yet dated. On those
opti cal dati ng w der Entstehung, Chronologie und
_ ill
.
de b
apphed to test the hypothes is ofh1gh magnitu
de -1 Siedlungswesens. - Landesdenkmalamt Baden
. . . s 01 eros10 n
Wu temberg, Materialh
in Neohth1c tunes. efte zur Archaologie 43, Komad
Theiss Verlag, Stuttgart,
115_119.
Conclusions Bork, H.-R. Bork,
. H., 1987, Extreme jungholoziine
hygnsche Klimaschwan
kungen in Mitteleuropa und ihre
Folgen, Eiszeitalter und
The first results at the test site Bauer a
. h . . . ch show that b Gegenwart 37' 109-118.
d.
colluvial se m1ents m t e. v1c1ruty of archa eologica1
. sites are

Bork, H., 1989, Bodener
osion und Umwelt, Landschaftsgen e e
s
und Landschaftsokologie
a geoarcha eolog1cal archive of special interest, docume . 13, Braunschweig, 249 p.
ntmg Duller, G. A. T., 1994,
l andscape changes under human and/or climat'1c Analyse, Version 5.22 , Co pute r m
impact program for luminescen
proves an adequ ate instrument ce data analysis.

Optical dating to reconstruct .

Eitel, B., 1989, Morphog
the chronology of these slope-wash d posi ts H e enese im siidlichen Kraich gau unter
. owever, besonde er Beriicksichtig
pe ological and geomorpholog1cal co investigations a
d ung tertiarer und pleistozan er
. ti . . , re re-
-

quired to recog ze nu tmg 1actors for the applica cksed1mente. Ein Beitrag zur Landschaftsgeschichte
_ tion of OD
Sudwestdeutschlands,
and to accomplish data mterpretation. Stuttgarter Geographische Studie ll
111, 205 pp.
Fuller, I. C., Wintle, A.
References . G. & Duller, G. A. T., 1994, Tes of
Ptrnl bleach methodology
as applied to the in fra-red
stim ulated luminescence
Aitken' M. J., 1985, The11110/1 1111i11esce11ce Dating . of an alluvial sediment fro!11
.
Archaeological Sc1e11ce, Acadentic Press, 359.
, Stud' 1es ll1 anu be, Qua ternmy Scie nce Reviews 13, 539-543.
Aitken, M. J., 1998, An i11tmd11c
Grun, 1993, Simplex, Version 1993, Computer progr am
, 0x1or for
tio11 to optical dating
. . c d
lummescence data ana
University Press, m pnnt. lysis.
Heide, B., 1996a,
Aitken, M. J. & Xie, J., 1992, Optical dating using infra-re Jungsteinzeit - alterer Absch nitt
d (Altn eolit hiku m),
diodes: young samp les, Quatemmy Science in Beh rends, H. (ed.), Faustk eil- Urne
Reviews 1 1
' Schwert, Archiiologie
1 47-152. in der Region Karlsruhe, ad ni a B e
Verlag, Karlsruhe, 34-
54.

128
129
 PRELIMINARY GEOARCHAEOLOGICAL REPORT
TEL KEDWA, SINAI, EGYPT

PAVLISH, L. A. 1 & REDFORD, D. B.2

1 rchaeomet1y Laboratmy, Department of Physics, University of Toronto, Toronto, Ontario, M5S JA7 Canada
A
2Near and Middle Eastern Civilizations, University of Toronto, Toronto, Ontario, Canada

gical survey was conducted at Tel Kedwa in the North Sinai in conjunction with archaeological excavations
A geo a rchaeolo
uipose of ascertaining the site's length of occupancy through the determination of the depth of cultural material. T his
'th the p
WI accomplished by coring the site. Also, a topographic map was generated and the relative elevation with respect to sea level
was
was deter min
ed.

J{EVWORDS: GEOARCHAEOLOGICAL SURVEY, WATER TABLE DEPTH, TEL KEDWA, TEL EL HER (MIGDOL),
TEL ABU SEIFI, TEL FARAMA (ANCIENT PELUSIUM), TEL EL-MASHKUTA, QANTARA E AST, SINAI,
SUEZ CANAL, NECHO II, AUGER HOLES, TOPOGRAPHIC SURVEY, SAITE.

Introduction depth of cultural material approaching three meters, much of

A geoarchaeolo gical survey was carried out at the site of
Tel Kedwa during the 1997 field season. A grid was set up
using the inner comer of the northwest fortification wall.
Measurements show that the transcendental beach to the south
of the site is at an elevation of approximately 1:0 metre above
sea level. A relic lake bottom effectively separates Tel Kedwa
from its rather better known neighbour to the southeast
(2.5 kilometers) Tel el Her, or Migdol.
A series of 10 cm diameter auger holes were dug with the
objective of ascertaining water table depth, wall depths, sand
foundation platform depths, moat locations and depths in
addition to the spatially varying depth of cultural remains.
The 2.5 metre contour line describes a roughly rectilinear
pattern that is angled at approximately 45 degrees with
respect to the foundation complex representing the extant fort
foundations. These results suggest that at least one earlier
architectural manifestation at this site had a very different
alignment. The two bum layers present at the site are
consistent with such findings and probably date to the
destructions of either 600 BC or 568 BC and 525 BC.
Location
Tel Kedwa lies approximately 25 kilometers north-east of
Qant ara East on the Suez Canal, and 7 kilometers south-west
of Tel Farama,
ancient Pelusium (Map 1). It belongs to a
sequence of about a half dozen sites which stretch eastward in
an arc from Tel Abu Seifi on the outskirst of Quantara to
mod em Beluza on the road to Wady
el-Arish. These sites
conform
to the lie of the land created by the now defunct
Pelu siac bran
ch of the Nile, and were intended to block access
from the east by any group seeking entrance to Egypt between
the sp it of land
between the river and the shallow lagoon to the
sou th. The
lagoon is identified with the Shi-Hor ("Lake of
lforus") ment
ioned in the Bible.
History
While Tel Kedwa is sometimes characterized as a "one
? od" site, it appears to have passed through several
Uilding p
hases. C01ing in the centre of the mound revealed a
it dating before the present wall was built. The earliest phase
probably dates to the late 7th century BC during the time of
Necho II, and comprised some kind of fortification the
remains of which were identified in the 1997 excavations at
the outer side of the northwest comer of the fortress
foundation wall. The exact date of the early foundation can
not be ascertained as yet, but a small-find of a fragmentary
scarab recovered in the excavation provides a possible
terminus a quo. The scarab bears the name Mn-hpr-rc written
twice. This prenomen of the great pharaoh Thutmose III
(1504-1451 BC) was widely reproduced in later centuries;
and, was, in fact, taken by Necho I (d. 664 BC) as his
' prenomen. His son, Psammetichos I, was founder of the 26th
Dynasty. As a terminus a quo, the death of Necho I provides
a reasonable reference point that is consistent with the pottery
record from the site which is largely Saite in its makeup. Both
the excavation and coring records indicate that the site
suffered partial destrnction in the early 6th century BC (Neo
Babylon invasions of 600 BC and 568 BC). The Fort must
have been rebuilt and appears to have functioned as a
settlement through the parts of the middle quarters of the 6th
century BC (568 BC-525 BC). This view is substantiated by
the recovery of both Samian and Chian ware wine jars
suggesting the presence of Greek mercenaries which textual
evidence has shown to have been in the employ of 26th
Dynasty Pharaohs. Animal bone remains recovered show a
conspicuous absence of bovids, while sheep, goat, pigs and
fresh water fish were common.
Rationale
There is no mystery as to the threat against which the
fortifications of Tel Kedwa were raised. Psammetichos I had
established himself first as protege of, then in opposition to the
Assyrian invaders of Egypt (671-663 BC), and, while the
menace that Assyria represented was soon finished, other
enemies arose to take their place. The iising power of Babylon
confronted the Egyptians in north Syria, and in 605 BC
annihilated an Egyptian army at the battle of Carchemish.
Through the next five years Nebuchadrezzar of Babylon cut a
swath of destrnction down the Levantine coast, subverting the
Phoenician states and Judah, and wiping out Ashkelon and

Proceedings
of the 31" lntematio11al Symposium 011 Archaeo111et1)>, Jerem, E. & T. Biro, K. (eds.), Archaeopress-Archaeolingua, BAR- Ce1111: Ew: Sa 1.
 .
sl/1at, Egypt
gical report: Tel Kedwa,
P reliminary geoarchaeolo
Pavlish, L. A. & Redford, D. B.

NORTH
SINAI

HIL1CN'OUS
.'!l\!
\

\,
:::
-
'

.
-

Eastern
....

Western
Desert Desert
.',
- ---------------- ... __

Map 1. Location of Tel Kedwa in northern Sinai.

boreholes at Tel Kedwa.
location of the JO cm
Fig. 1. Map showing the
Gaza. In 600 BC the Babylonians appeared on the edge of the between two hostile jurisdictions, and fortifications like that of nd at depths
. sterile sand was fou
eastern Delta and were beaten back by the Egyptians with Tel Kedwa were no longer needed. metres m depth but
3). Water table
'

at some holes (Fig.

great difficulty. But the Babylinian threat continued, as aPProaching 4 metres rected for
.
2 5 to 3 5 me tres bel ow site surface (uncor
Jerusalem was overwhelmed in 586 BC and further attempts Geoarchaeological survey averaged
metres to l 75

k walls averaged 1.2

were made to break into Egypt in 568 BC and 525 BC. elevation). Mu d bric .
. strongly sugge ts.
consistency m depth
Undoubtedly, it was during one of these attempts that the fort A preliminary geoarchaeological survey was carried out at metres m depth Their
that they do n t

; :: :
lt to that level and

was burnt and partially destroyed for the first time the site to Tel Kedwa during the 1997 field season. This 1 ) that they were bui
ls, bu a
of heavily decayed wal
:;
(600 BC I 568 BC). Based on parallels with Saile fort Tel el survey had two major objectives: 1.) asceitain the dept!\ of
r present the remains
ed stru ctu re; or, . h
an unfinish .
first few courses of own pend
Mashkuta located to the southwest near present day Ishmalia, cultural remains on the site; and, 2.) measure relative
systematically at som
eu
bricks were removed
the site ran d
which shows three distinct destruction levels at 600 BC, elevations on the site and in the surrounding environs to l
cultural materials on
568 BC and 525 BC, a likely candidate for the destruction calibrate the depth measurements. after construction. The
3 metres. ig.
ent to aproximately
would be 568 BC. The fort was rebuilt and appears to have To accomplish these objectives a grid was setup using the depth from being abs
nt section (OE/ON).
survived for almost a half a century before being again inner comer of the northwest fortification wall. This location the the site. shows an typical sedime
re sec tion through
destroyed sometime late in the third quarter of the 6th Century (60 metres East, 103.45 metres North) was the benchmark for Rig. 2. T hree-hundred met

BC leaving a thick stratum of ash and reddened brick. Again a the survey. The elevation attached to this point was 2 metres
rebuilding was planned almost immediately, incorporating above sea level which is very close to the true elevation for
walls 13 metres thick with foundations 1.20 metres deep on a this point on the site. This observation was confirmed with off
sand pad in excess of 5 metres deep with a surrounding "moat" site measurements showing that the transcendental beach to
canal approximately 10 metres wide and several metres deep. the south of the site is at an elevation of approxi mately I
The moat served both defensive and engineering purposes as it metre above sea level; and, that the transient lake bottom
in
helped to stabilize the mudbrick foundation walls which have sediments are 10 to 20 cm below that of the beach
Ke dw a
been built to ground level, but which appear never to have been elevation. This lake bottom effectively separates Tel
sou th ea st
completed. No stratum of deposition is associated with the from its rather better known neighbour to the
walls, the present ground surface running directly up to the (2.5 kilometers) Tel el Her, or Migdol. .
t
face, and the foundation trench descending from the present The major axes of the site grid are two lines running at ngh
O E/O N to
surface. There seems no doubt that this last fortress had been angles to one another. The East-West line went from
th
300E/ON crossing the inner wall line at 60E/ ON on
planned, but never finished and put to use. Events must have

sid e 0
caught up with construction, rendering the plans useless. But western side of the site and at 249E/ON on the eastern
N /6 0E to
what event, clearly dated to the third quarter of the 6th century the site. The North-South line went from 120
could have overwhelmed a state administration able to 103.45N/60E.
Sixty-three 10 . cm diameter auger holes were dug with th
conceive of and implement such a massive foitification? There
objective of ascertaining water table depth, wall depths,
s
is only one: the catastrophic defeat in the northern Sinai in
de pth s .10
525 BC of Psammetichus III, last king of the 26th Dynasty, at foundation platform depths, moat locations and
re m
addition to the spatially varying depth of cultural
the hands of the Persian army of Cambyses. The collapse of

e
the Egyptian state opened the door to foreign occupation, and (Fig. 1 ). Thirty-nine of the auger holes were dug alo ng th
mete East-West gri line .at ON providing a reasonable c o
: ; l material at Tel Kedwa.
for 120 years Egypt became a province of the Persian Empire. the depth of the cultura
a Fig. 3. Map showing
The eastern Delta and north-west Sinai ceased to be a frontier sect10n through the site (Fig. 2). The average borehole w
133
132
 Pavlish, L. A. & Redford, D. B.
Two-hundred and twenty-five elev
ation measurements
ere taken usm _ g
a standard military tran
sit (400 degrees - -
circle). In adelit10n to
the measurements take .
Unconsolid
at ed INVES TIGATION OF ARCHAEOLOGICAL SI TES
n for the d Sediments

setup on the site to acco

mmodate the systematic
aug er w : ITH T H E INTEGRATE D APPLICATION OF AERIAL PHOTOGRAPHY,
_ had
the transit _ con , She.rd Lay W
a stadia version of 100 which . er 1
perrrutted an GNE TOME TER SUR VEYS AND ARCHAEOLOGICAL EXCAVATION

asy mea urem nt of the
distance to a survey poi
nt as well as
MA
Its elevat10n. Fig. 5 sho . 1
ws that the 2 5 metre
ACZKY, P., PUSZTA, S.,2 CZAJLIK, Z.,1 HOLL, B.3 & MARTON, A.4

Mediu m B
contour line rown
des nbes a roughly R

rectilinear pattern that Sand and Cl

. is angled at ay
app oxim ately 45 degrees with 1 (10YR4/4)
respect to the founda 1Institute of Archaeological Sciences, Eotvos Lorand University, 1088 Budapest, Milzeum krt 4/B,
complex representmg . tion
the unbuilt fort. These
hat at least ne earlier
architectural manifestati
results suggest
on at this site
e-mail: raczky@ludens.elte.hu, czajlik@ludens.elte.hu,
zDe partment of Geophysics, Eotvos Lorand University, 1083 Budapest, Ludovika ter 2, e-mail: fractal@elende1:hu,
ad very different alig
nment. The two bum laye
rs present at ent of Informatics, Hungarian National Museum, 1053 Budapest, Magyar u. 40, e-mail: balazs@widor.hnm.hu,
the site are consistent with Burnt Se ds.
in 3Dep a rtm
such findings. 4Budapest Historical Museum, 1014 Budapest, Szent Gyorgy ter 2, e-mail: madam@mail.btm.hu
(10YR4/4)

Shercl Layer 2

Sand Lense
to present some case studies of our non-destructive researches in Hungary in the framework of M3 highway
in (5Y7/1) This article seeks
grey-green cla an d Frenc h-Hungarian cooperation. To develop the aerial archaeological, geophysical, etc. technologies for pmspecting is
y roject
(10YR7/l)+San
d ow ava ilab le in
aborat
Hungary.
ion of
However;
many
the integration of measurements and archaeological data needs a highly-developed GIS-system
specialists. T he next step is to analyse the superposition of measurements and the archaeologically
and the coll
data (e.g. pits, post holes, etc.) if we want to understand the spatial layout of sites and features. As a result, we
obtained physical
Sherd Layer 3

can of e
f r a sequence of data collection which could be quicker and more efficient than non-integrated, single-stage methods.

KEYWORDS: AERIAL PHOTOGRAPHY, MAGNETOMETER SURVEY, GIS, HUNGARY.

Light Sand
(2.SY 812)
Although aerial photography and various techniques of
geophysical investigation have been applied in Hungarian
Light Sand archaeological research since the 1950s, 1 these techniques
(2.SY 8/2) have rarely been combined.2 It is also rather striking feature
that although textbooks on aerial archaeology3 and various
catalogues4 often offer an archaeological interpretation for the
features visible on aerial photos,5 there has been little research
Fig. 4. Shows a 3.65 metre sec
tion at OE/ON. T hree sher
layers are present. Wat d on the archaeological background of anomalies that can be
er Table is bel ow presen
t-day sea measured with geophysical techniques.6 The most likely
level.
explanation for this seems to be that there is very little in the
way of archaeological data feedback - and, in our experience,
this problem can only be resolved with the use of an
integrated GIS system. 7
The archaeological investigations linked to the construction
of the M3 motorway and the launching of the Hungarian
French aerial archaeology programme in 1993 offered an
opportunity for the coordinated and large-scale application of
our experimental investigation which we have conducted
since 1987 and 1992.8
The efficiency and costs of non-destructive techniques for
surveying archaeological sites largely depend on the extent to
which an area has been archaeologically investigated. Aerial
photography is the most efficient in the case of uninvestigated
or poorly investigated areas, whereas only geophysical
surveying may yield additional information in the case of
well-researched areas. In general, it is a combination of these
two techniques which offers the best results, especially if
aerial photography is followed by a GIS evaluation since the
data thus gained can be used in subsequent geophysical
surveys. The combined processing of these data, in tum,
offers optimal conditions for the excavation itself and the
excavation too is fitted into this system as a new information
element.
Techniques
1. Aerial photography
Archaeological aerial photographs were taken with a Leica
narrow-film camera from a single-engine airplane. The
position of the photos was defined using GPS positioning, the
coordinates were converted into EOV projections and plotted
on a digital map.
2. Magnetometer surveys
Archaeomagnetic surveys were conducted with a proton
magnetometer of 0.1 nT sensitivity; the surveyed area was
covered with a lxl m grid. The sounding of the magnetometer
was 70 cm above the surface. These geometric data determine
the resolution of this procedure. A special, synchronous data
collection technique was developed for noisy environments.
2.2. Processing of magnetometer data
Time variations in the magnetic field was removed, the data
yielded by the moving instrument were calibrated with the
data of the base instrument giving measurements at intervals

E.g. Gyula Novak.i's research at Velem-Szent Vid-hegy and in the Sopron area: Szekely et al. (1992), Szekely & Puszta (1996), Kolto & Bartosiewicz (1998)
271-2 74, with further bibliography.
With the exception of a few experiments: Cucarzi (1992), Jerem et al. (1992).
Braasch (1994).
Goguey & Szabo (1995).
,
F r the a
6 o rchaeological control of the results of aerial photography of Neolithic rondels, cp. Zalai-Galli ( 1990).
Becker (1996) is a notable exception. For methodology and background research, cp. ibid., 265-283, Stanjek & Fassbinder (1996), Fassbinder & Stanjek
F,. 7 Cl 996) and, more recently, Powlesland et al. (1997).
.
ig. 5. Map showin Czajlik
g elevation above sea leve & Holl (1996), Czajlik et al. (1997).
l at Tel Kedwa.
Raczky et al. (1998).

134
Proce edi11gs of the 31" !1Zternario11al Symposium on Archaeometry, Jere111, E. & T. Biro. K. (eds.). BAR-Archaeoli11gua, Cemral Europea11 Series I.
 sites
vation at archaeological
.. , eys and archaeological exca
. ' p., Piiszt a, S., Cza1lrk Z Holl B &
Racz/.y
.,,
mart on, A. of aeri al phot ography, magnetometer surv
on
'

applicati
.,
,

rate
/nteg
of a few seconds. The data were .
hen linearly filtered: and the results of data collectio
.
geological and archaeologica n. Wi sha
I anomalies were d'istmguished ll the n
results of our archaeological d

by band-pass filtering The data were

for noise reduction and the data were

th en optimum filtered
application of our experimen
o
:i ::
ctmg th
- e first
arch on
Scrj
ge.
then converted to the . - the t.1
r1 a,i d6
Earth. s magnetic poles Th :;; .
neu. image ws enhanced by
county sect10 n of the M3 mot orway. .a
direction filtering an th d : !
netic an mlies caused by
? Nagykaracsony-Men
,
ploughing were eliminated Th
agnetJ c ima e was then

e smajor10
improved by non-linear fi tering, i . .
statistical differentiation The site was identified by Re ,
enabled the transformafwn of both Goguey p
signs mto a manageable c

low- and high-mtensive
101mat. Data selec t'wn enhanced

.
m 1993.11 Round and rectangu
of 30--40 m, can be seen on the
c
t ilot-ar
h
ai 1eatures, h . c ae oJ
avin g a
. Ph otos ta di
image elements which reflected a

greater spatial coherence. . ken at

altitud e 400 m (Fig. l). w,e chose a a el
Processed data were then PIotted rectanguIar r
on a map. feature on the western edge of th and a c'
e area, both
of Whi hil'c
excellently outlined , cont rast.mg . c
3. GJS pmcessing sharp!Y With
the ligh \\I
of the wheat field (Fig. 2). te r to
The magnetometer survey reveal
The most important phases in ed that the
GIS processing are the rect an site,
feature which appeared as a U of the Nagykaracsony
following: digitization of the
.
paration of a digital eleva t10n
topographical maps, pre-
. as
sh
in fact a closed square. Simil :r
d feature on
o the ae ial
the :
ot
Q
Fig. 2. Field sun1ey
e f rences in wheat
dife
(1994).
gmwt h
model, d'1g1ta I geodetic
of the excavation squares, d'1g1t1z . . .
fitting
at10n of the excavat10n .
circular feature was also more blurr r;
on the mag ne
p h
ot o,
tometer
the
showing th

. map than the rectangular feature

drawm gs, creation of a n excavat10n .
data base, creat10n of the .:"'.--.-:"':.....--=---.--<! vvvv
vv
database-drawing Iink s and colou
r c0d'mg based on the
Folio wing the evaluation of th abov
.
e data, the 1
994 control
I _.
vvvvvvvvvvvv
vvv vvvvv
excavat10n only investigated the . vvvvvvvvvvvv
. . most important . vvvvvvvvvvvv
vvvvv Nagykaracsony site,
database, followed bY mtegr atmg the d.igita mformation
1 .
. points' the Fig. 3. Geophysical survey of the
. four corners of the quadrangle Syste sur vey data
from aerial photography, geophysic
al surveys and archae-
matJ c soundings
revealed with superimposed fiel d
that the differences in the height . lts (1994).
ological soundings.9 of the vegetat10n were and the exc ava tion resu
c ause<(
by a system of multiple ditch s
In the following we shall demonstrate
.
. the most important
.
photos and the magnetomete
s revealed both by the a ri
rveys (Fig. 3) One strikin
e al
tion and the excavation
data in an
steps in this research on a site chosen more for its advantages . g evaluation of this informa
feature was that these <litch es were I
only dug mto the sub em.
f r demonstrating investigation soil to archaeological GIS syst
M

techniques than from trad- a depth of 20-50 cm (Fig. 4). These . struction

. . ditches can most likely be ed to the M3 motorway con

lt10n al archaeological cons1'deratw ns, and h ow optimum The excavations link
associated with a system of corrals.' showing the ditches whi ch could
. at the same fime, howev 4. Section of the excavation, d by aerial photography
procedures can be selected m kn
owledge of the environment er, Fig. were in six cases precede
no finds providing secure chrono 1 . netometer surveys. exc ava tion, 13
poses of a subsequent
tography and mag
og1cal anchors for dating detected by aerial pho be evaluated for the pur on
con duc ted
netometer survey was
vided by and a preliminary mag
apolation of the data pro chosen two sites to pres
ent our resu lts.
were recovered. The extr twelve sites.14 We have
ey and the exc avation of bot h sites
physical surv cal resu lts
aeliial photography, the geo Since the most importa
nt arch aeo logi
corrals sim ilar to the centrate on
once held ed, 15 we shall here con
suggested that the entire area have already bee n publish
ery foun d in the nort hern tion of non-
investigated ones. The med
ieval pott of the integrated applica
feat ures wer e also the archaeometric lessons
similar circ ular
part of the area - where d destructive methods.
plex can be tent ativ ely date
observed - suggests that the com
2 -dul6
to the Middle Ages.1 Polgar-Cs6szhalom
n that it
Integrated applicatio The evaluation of the topo
graphy of the site showed
and ma gneto alon g the
of aerial photography consisted of an extensiv
e horizontal settlement lyin
g
pro ces sing lem ent,
meter surveys with GIS outer curve of a former
Tisza oxbow and a tell type
sett
exc ava tio ns the Lat e
in the archaeological which was part of the form
er. Both can be dated to
ed lin e of the sett lem ent
co nducted on the plann Neolithic. The site also
yielded a few Sarmatian
-B iha r co un ty
M3 motorway in Hajdu features. rondel
-time river bed and the
The outline of the one
ay and the Hungarian the aerial
The construction of the M3 motorw are clearly visible on
encircling the settlement
laun ched in 1993 created tifie d with
French aerial archaeological project e rondel was also iden
photos (Figs. 5-6). (Th
a unique opportunity for the exte nsiv e application of non aled that the
gnetometer surveys reve
aeological aerial subsurface probes.) Ma The
destructive methods - primarily arch
concentric ditches (Fig
. 7).
-, and for the ron del consisted of five
photography and magnetometer surv eys
in the turf
d not in a wheat field, but
1998. These, however, were note
" s . gkut -Spo rtrep iil6te r in the spring of
thide
mnlar features were noted at Budapest-Pes
artificial but natural. which had in part
and it is therefore possible that they were not hly 4 km long section,
iraly-erpart, along a roug
" the follo wing sites : - the settlement at Polgar-K Sar rn atian settl ement of Polgar
Useful aerial photos were also made at perhaps, houses) at the
ogical features (pits and,
g field surv eys; - identification of archaeol ar-K engy elko z whic h was not detected during
already been identified durin - a rondel at Polg
ally uninvestigated area;
rse and in the archaeologic
Kengyelkoz beside the one-time watercou
rt. Certain
14 the field survey.
m at Polgar-Kiraly-erpa
of a Copper Age ditch syste
the follo wing sites: - identification iden tifica tion and
:-;;::::=::=- --Fig. cond ucte d at in their fill; -
Successful geophysical surveys were also ry sherds and burnt finds
--1.-- --
Nagykara-
csony -M,
.
enesma;or, aerial photo ve anom alies, probably dependin
g on the amount of the potte
elko z; - identification of a Middle
- ive/n egati ar-K engy
:-:- ' taken by R G oguey
(1993). pits caused very strong posit
interpretation of the internal structure - doub
le ditches and sunken hous
es - of the Sarrn atian settl
paris
ement at

on of the results of the

Polg
magnetometer survey with
the archaeological data
The com ky
, the Polg ar-N agy-Kasz iba site.
ry sherd s. Cp. Puszta (1997), Racz

:Uenof,1 thepe.French
ditch es at othe rs, potte
For a descnpt10n of the s Neolithic rondel of two containing, among
io T
Raczky et al. (1 998).
as well as of the sunk en houses and refuse pits
his excavation was a re enabled the identification of this rondel,
11 an
-Hung an coope rat10n and was led by ever ,
Goguey & Szabo (1995) 67. V:aJk Cserrneny1 (Szent Istvan
, Kiraly
, Museum, Szekesfehervar). (1998). (1992), Raczky et al. (199
4).
(1997). Cp. also Raczky
" ky et al. ( l 997b), Fodor
Cp. Raczky et al. (1997a), and esp. Racz

136
137
 cal sites
excavation at archaeologi
eys and archaeological
aphy, magnetometer surv
A.
n of aeri al pho togr
Raczky, P., Puszta, S., Czajlik, Z., Holl, B. & Marton, ated applicatio
/11fegr
1200
1100
1000
.
intensive anomaly of the innennost ditch
- Which,
strength of the archaeological evidence was the . on ! :mo
e li e

. ar st '
caused by the burnt daub fragments m Its fi1ll
Its fonn
rectangular with rounded comers, rather than .
. C trc u l
mam s1.des are at iight angles (90o) to each oth
er. This
....

was north-northeast oriented and computer anal di

. Yse s revA
. . .....1.
that It was onented towards the smg1 e po mt v
1s1ble
t
p.
o
naked eye from the settlement ' namely the p eak 0
ivtt
T
o
The straight sect10ns
of the second innennost <lit .
c h mo
re
Iess followed the first, innennost ditch. The three
16
o utenn
ditches were more rounded. The excavat"IOn revea1
. e d that
outer ditches were the latest and their fill .
di consiste
d of so
The entrance, whose direction is perpen cular to
the Toq
. j
eI The
mas, was cut into the southwestern side of the rond
.
entranee sect10ns cutting through the fiIrst and seco nd

. di. tch 100

were magnetically more intensive ' while the entran wce sec .
ons ..;
Wtder,
80

i
through the third, fourth and fifth ditch . ere

cuttmg
. ..

The entrances on the northern and the southem sides' aIi

gned
80 I ... .;. .. ...
f m
...
8
0
.
the main direction, were less intensive The contmuaft o
...>

..;
_,
m ' N l>
" .J "'
m 40 Iii m m "" I\) ii> c
i m c

n of (JI a; tit th
w
m
0 I\) A Ill "' I\) A
0
Ill
0
"'
0 0 0 0 0 0 0 0
l> Ill 0 0 0

0
the entrances could be traced within the ronde1 The cent
1\1 0 0 0
0 0
0
. ra)
Fig. 7. Magnetometer surv
.
zone of the tell was also magnetically i'ntens1ve complex.
and tlle 1ater ey of the Csffszhalom site
.
excavat10ns revealed that these anomalies were cause d m ai. n1y
st oriented
also revealed an east-we
bY house and hearth remains. the possible The magnetometer map
knowledge, of and turning
to our present the one-time river bed
The smaller, non-continuous anomalies v1's1b1Y ceased in According feature starting from
, buildings, wells and mad e out on
tures - such as graves r section could also be
the nort hm part of the horizontal settlement, correspondin archaeological fea towards the tell; the latte
se positive anomalies
). This was a double
the aeri al photo (Fig s. 6-7
the
e d.
h from
as the aenal photographs showed - to the one-time riverbg pits - only the
latter or the latter two cau ditc
ber of pottery sherds in neto met er map ,
ng to the high num according to the mag
These could be correlated with the boundary of the sett1ement of this type owi fitting of the Sarmatian period whi ch, ed
firmed by the GIS turn
their fill. This is con
then
Fig. 5. Aerial prospecting oif the Csffszllalom s1't e comp1ex' -time watercourse and
as estabIished by the field survey and thus these anomali -continuous ran parallel to the one
non aerial photo
taken by 0. Braasch (1993). can also be associated with settlement features (Fig. 8 information layers. Sin
ce in the wes t thes

at the Cs6szhalom-du1
e
6 site can be southwest - and thus the enigmatic feature on the
anomalies - which could now be interpreted.
pits bes ide the houses - the tell, the
primarily linked to the Lat
e Neolithic uded the central area of
as defined The excavated areas incl
the bounda ry of the site pho tos and the
could be noted well beyond revealed by the aerial
site is larg er than rondel of five ditches the M3
indicate that the line of
by field surveys, it may as well as the planned
magnetometer surveys,
previously thought (Fig. 9).

-
-::----------- -- ,, ha1om site, taken by O. Braasch 0993).
-- of .the csosz
(1989-1997).
Fig. 6. Aerial prospecting

Fig. 8. Excavation of the

Csffszhalom site complex
" This could be explained by both cultural and . .
envrronmental reasons' in th e 1atter case we may suspect that Mt. ..,.
10kaJ was no longer v1S1ble.

139
138
 Racz).y, P., Puszra, S.,
Cza':/'lik Z"
Holl, B. & Marton,
A.
'

n of aerial photography, magnetometer surveys and archaeological excavation at archaeological sites

te d ap plicatio
Integra

the rondel and the Srumatian

. ar fe atures (such as
, line buried and filled-up ruchaeological
as other
es' ) as we11
as refuse pits and sunken houses). The
......._ (sue h . . .
l"'v- .
of remote sensmg tee hmques wit h topo-
b' auon
g re t
eoJll n data is suitable for definin the structu and exte?
al
fllP)tic ae logical sites (such as settleme nts and ce1trun
o f arch
ceJlletetY
ypes) lyin g on
.
plainland and filled-up basins

cavation.
\\'I't h0ut ex
tric and methodological
aluation of the archaeome
The ev data integrated into the GIS system
. pJicau ons of the . .
ove can be hoped from a detailed analysis of the
jJJ1 'b d ab
e;; d al feature
s of ruchaeologial sites and from the
.
detailed geomorpholog1c and pedolog1cal data.
: nection of

Summary

examples clearly indicate the relevance of this

The above
site investigation, which has two main elements:
00mplex . . .
(a) The sequence and orgamzat10n of arch aeometnc and
collection;
archaeological data
(b) The continuous GIS evaluation of the data and the
results.
integr ated compruison of the
we found that the best sequence for data collection and the

GIS evaluation organization was the following:

_ the collection of detailed topogiaphical data and earlier
information (including satellite photos, old archive aerial
photos, maps) on the location, extent, type and date of the
Om archaeological sites and their integration into a GIS system;
- the preparation of archaeological aerial photos depending
D
10QQm
F:1g. 9 i-ala eohydmlog1cal map of the

on the size and the topography of the site, as well as on the
Cs{fszh a 1om site
. .
complex, sh
and the boundaries of th owing the field extent of its investigation, combined with a traditional
e geoph ys1c
.
ally
survey dat a
surveyed area. archaeological field survey following the GIS evaluation;
motorway. The latter in effe - the laying of a stable geodetic grid to which all
. ct gave a north-south sect
ion o f
the honzontal settlement; this techni que. O
excavation conducte d on ne interesting subsequent non-destructive methods (artefact collection,
. an feature of the .
imp
ress1vely large scale, allow con ducted in . mvestigations

ed the extrapolation of this area is th at microsynthesis, geophysical survey, subsurface probes,

. the the g eophys1 cal
excavation results in the light results comple and excavation
. of the data and GIS proce . mented each oth
er topographical
phosphate analyses, etc.) and the excavation itself are fitted.
ssmg fittin g of the dat ly, and the GIS
descnbed above (Fig. 9). a ga ve a r epr Geophysical surveys must obviously be adjusted to the
esentati ve map
(Fig. 1 1). for the entire site
morphology and pedology of the site, as well as to the extent
Hajdd rog-Csardadomb1 The most imp
ortant im Ii cat10 . it is built-in, its environment, etc . ;
? 7 and n o
survey conduc he magnetometer

HaJ d udorog-SzallasfO!dek ted on the Ha'
- the non-destructive research phase is followed b y an
tidorog-Szallas .. .
a m ere 2
00 m east of the foldek site, lying
. integrated GIS analysis and the archaeological investigation
:
hree successive sites were
identified during the
field
which were reg
istered as tw0
fo e1. site, wa

m ependent sites
s hat the e sites
of the site - which can simply involve the focused
sm vey of a roughly 1.5 km field sur vey were . dunng the
log section of planned line . . m iac ,, t one site investigation of the site (soundings, cross-sections), while the
M3 otorway. Although aen
of the
mdicated that the The survey data also
al phot ographs did not wes t m sect 10n . results of the GIS processing of the excavation data are
reveal
ano of the site probably
nythin, the magnetometer survey conducted ther Sarmatian features extended to the areas investigated only with non-destructive
bunal ground
over an
with grave dit con tammg burials encircled
Impressive, m long area , revealed a variety of che techniques.
?OO s The su bsequ
interesting
representative en t tna I excavation yielded
feat ures (Fig . 10). The . It is our conviction that the method outlined above is not
exca vatio n of the Hai' du'd 1nfonnat10n . .
. orog- for
Ii th e entrre site
Csardadomb site was begu pat ches of intens . 19 The dense simply
,
n after the evaluation of ive anoma es . . quicker than the traditional investigation and
th ese m th e rru'ddle section
data. is '!_'he straight-lined featu a rea probably indi of the evaluation methods which can often take years, but also more
res were part of a corral syst cate a settlemen . .
. t of the S a rmatian
0 the adian Age, while I is clear from peno d.
giav e ditches of a Sarmatian
the circular features were
burial ground The ano
yie :
t
ld useful infonn
the a bove that
.
at10n under
.
while a erial photos only
efficient since considerably more information is gained for
roughly the same costs if the sequence of the individual
. malies favoura ble crrcu .
caused by the graves encl (mo n ocul ture mstances p hases of investigation is optimal.
osed by these ditches w cultivat' wn,
. . ere care fully cho se
sometimes also registered, geop hysical sur vey n time of day),
indicating the sensiti vity . s al ways The greater part of the above-described research techniques
of this ofter useful backg
mforma tion 20
Magnetometer round have been known since long decades and they have more
surveys mva na bly revealed the recently begun to be applied extensively. However, little work
" This excavation was led
by Istvan Fodor (Hungarian Na1iona
l Museum,
has been done in the way of the comparison and systematic
18 Fodor ( 1997). Buda pest).
i .
ev aluation of these techniques in terms of usefulness and Fig. 10. Magnetometer survey
T h e excavators noted that m certain cases the magne1ome1er
_
trad1uonal archaeological
survey indic
med the bounda
costs, proposals for suitable work procedures and the of the Hajdudorog-Csardadomb and Hajdudorog
methods (Alexandra Anders' kind
ora1 comm
ries of the fea .
20 Alth ough .It must . .
ture even w
hen It couId not . integrated GIS compruison of partial results .21
be borne m nu nd that aerial
prospeciing allows 1 h .
unicafIon)
. guished usmg
be distm Szallasfoldek site, integrated with the field survey data.
.
e mvesttg
lower costs. alton of extensi
ve areas Wit
. hi n a relative ly
sh ort penod of
.

time and at much

1
2 E.g. Becker (1996) 77-81, 155-158, 293-295.
140

141
 n at archaeological sites
archaeological excavatio
magnetometer surveys and
Racz/..y, P., Puszta, S., Czajlik Z Holl B & 1narton,
,,, A, . licat ion of aerial photography,
ed app
teg1at
/n
' ., ,

Past. Az M3-as aut6pdlya

a nniltba - Paths into the
neto me ter- kut atas az M3-as aut6palya cue Excavations on the M3
5 1997, Mag regeszeti leletmentesei - Res
zta , " Arc ha eom agn etic al Survey along the Tudomanyegyetem - Magyar
pus von alan
- Moto1way, Eotvos Lorand
0Y0 f the M3
mo torw ay, in Raczky, P., Kovacs,
T. &
Nemzeti Muzeum, Budapes
t, 34-43.
a o hs into the Past. Az

tr ers, A. (eds.), Uta k a nnt ltba
eti
-
lele
Pat
tme ntes i Resue Raczky, P., Czajlik, Z., Hol
l, B. & Marton, A., 1998, GIS
alon g the
and
M3
-as au
t6pftlya
v ons on the
reg esz
M3 Mo tor wa y,
.

Eovos orand
the evaluation of rescue
Motorway in Hungar)', Poro
exca
cilo ,
vati
in
ons
pres s.
exc a ati mzeu Muzeum,
yeg yete m - Magyar Ne Fass bind er, J., 1996, Bodenkundliche
an Stanjek, H.
Tudom
&
zum V erstiindnis archaologischer
, 151-152. Untersuchungen
Buda p est lem ent pat terns in the Tisza H., (zgst.),
lith ic sett , in Bec ker,
zkY P., 1992 Neo tlement patterns
Strukturen im Luftbild
)laC ' Hungary, in As pes , A. (ed .), Set . Luf tbild arch aolo gie und
Archiiologische Pro spektion
'

egion of ck Sea 5th to 2nd Millenium desa mtes

Bla Lan
eiween the
Alps and
azise ,
the
77-86.
Geophysik, Arbeitshefte des
Bay
Bayeris
eris
ches
chen
Lan desa mt fi.ir
B.C., Verona-L Lat e Neolithic Site fiir Denkmalpflege 59,
l Con text of the 5.
zkY p 2000, Cultura Denkmalpflege, Miinchen,
249-25
)lac ' in Hiller, S. & 2,
p lgar - Cs6szhalom (Hungat)'), B., Mag yari , 0., Stei nbach, P. & Toth, T., 199
at III, Beitrage zum Szekely, of
(eds.), Kar ano vo Ban d eying in the inve stig atio n
Nikolov, V. s Verlag, Results of geophysical surv
hik um in Siidost-Europa, Phoibo al sites in the Gyomaendr6d region,
Neol it archaeol ogic
), Cultural and landscape
40 5-414. Hajdu, Zs. & Hungary, in Bokonyi, S. (ed.
, Kur ucz , K., gmy I. Reports on the
, Meier-Arendt W.,
changes in South-East Hun
RaczkY, P. c sett lement in the
1994, A Lat e Neo lithi haeolingua l, Budapest,
Szikora, A., Gyomaendrffd P roject, Arc
on and its cult ura l connections, A
Upp er Tisza regi 41-59.
Evkonyve 36, physical
a Andras Miizeum 1996, Magnetometric geo
Nyiregyhftzi J6s Szekely, B. & Puszta, S.,
ma-133 , in Bok ony i, S. (ed.),
231-240.
1997a, Utak a research at the site of Gyo
And ers, A. eds. , Sou th-E ast Hun gary
acs, T. nges in
Raczky, P., Kov Cultural and landscape cha
&
into the Pas t. Az M3 -as aut6pdlya an and Late Ava r
multba - Paths /I. P rehistoric, Roman
Barbari
ei - Res cue Exc ava tion s on the M3 nty Mic rore gion ),
regeszeti leletmentes (Bekes Cou
16
Magyar Settlement at Gyo ma-133
and Tudomanyegyetem -
300 Motorway, Eotvos Lor Archaeo lingua 5, Bud ape st, 15-25.
apest, 200 p. korarokrendszerek kutatasa
Nemzeti Muzeum, Bud Zalai-Gaal, I., 199 0, A neo litik us
K., Hajdu, Zs. &
Raczky, P., Anders, A., Nag y, E., Kur ucz , rschung der neolithischen
:
Fig. 11. Hajdudorog-Csd da d omb magnet meter survey,
..

excavation of the Sarmatian burials encircle by a ditch and village from the Early Middle Ages. Meier-Arendt, W., 199 7b, Polg ar-C s6sz halom-dul6. a Del-Dunantulon - Die Erfo
Transdanubien, ArchErt 117
,
zred b6l - Late Kreisgrabensystems in SO-
es sfro k a Kr. e. v. eve
Ujk6kor vegi telep 3-23.
es from the 5th millenium
References far Denkmalpf1ege
59 ' Bayensches Landesamt fiir Neolithic settlement and grav
'J' .), Uta k
T. & Anders, A. (eds
Denkmalpflege, Miinchen, 256-263. B.C., in Raczky, P., Kovacs,
Becker,
(H g.), 1996, Archiiologische Pros ektion
Fodor, I., 1997, Hajdudorog-Csardadomb. Szarmata temetke
.
Luftb1!darchaolog1e und Geophysik, Arbeitsh e de ; ,
zesek a II-III. szazadb6l - Sarmatian burials from the
ayenschen Landesamtes far Denkmalpflege 59, B e- A.D. 2nd-3rd century, in Raczky p ' ., Kovacs T & '
nsches Landesamt fiir Denkmalpflege Miin h n, 33 i '
Anders A (ed ) ' utak a multba - Paths into the Past.
,

Braasch, 0., 1994, Das archiiologische Luft ild i p ek

.
b ., rf Az M3-as autopdlya regeszeti leletmentesei - Rescue
Braasch, 0., Oexle, J. & Schlichtherle ' H , untennd1sc
. 1ws ' '

Excavations on the M3 Motorway, E"t

.
o vos Loran d
,,..
Bden- ,rrurttemberg,
. ,

Theiss, Stuttgart ' 78-96 Tudomanyegyetem

, - Magyar Nemzeti Muzeum,
.
CucarzI, M., 199 2, The integrated geoarchaeolog1cal Budapest, 110-113.
. .
approach within the temtory. the case of the
. .
Gogu !<
& Szab6, M., 1995, L'histoire vue du ciel -A
.
M1croreg10n. First results and further proposals, m tortenelem maddrt, avzatbo'l. Photographie Aerienne et
" "

.

Bokony1, S. (ed.), Cultural and landscape changes m rche l gie en France et en Hongrie - Ugi fenykipezes
South-East Hungary I. Reports on the Gyomaendrffd

es regeszet Frrn .... czaorszag

, ban , es Magymvrszagon,
,

:

.
v1ect, Archaeolingua I, Budapest, 13-40.
.
Institut Franrai
v

s - consetl Regional de Bourgogne - .
CzaJ , Z., Holl, B., 1996, Archaeological Chronology and Eotvos Lorand Tudomanyegyetem ' Budapest 127 p.
.. .. ,

E xcavat10n Data Bases, in The F uture of Our Past Jerem, E., Kiss, Zs., Pattantyus-Abraham' M. & "arga ' A. '
'

v.
.
'93 '95, Hungan National Museum, 144-150. 1992 ' T he combmed use of archaeometric m ethods
. . -
CzaJlik, Z., Marton, A. & Holl ' B., 1997, A z M3-as autopalya,
, .
preceding the excavation of archaeological sites' in
regeszet1
, , leletmenteseinek " S. (ed.), Cultural and landscape changes in
"konyi,
terinformatikai eldo lgozasa
, - B0

The GIS processmg of the rescue excavations associated Souh-East Hungary I Reports on the Gyomaendr6d
. .
w1th the M3 motorway in Hajdu-Bihar County' in
Pro1ect, Archaeolingua 1. Budapest 61-98 '

al
'
R aczky, P., Kovacs,, T. & Anders, A (eds ), Vtak a
. . , 0 o, L. & Bartosiewicz, L. (eds.), 1998 Archaeometric
K"lt"
multba - Paths into the Past A z M3-as autopalya
, . , Research in Hungary//., Budapest-K posvar-Veszp rem
regeszet1
, leletmentesei - Rescue Excavat'ions on the M3 322 p.
.. ..
M otorw y, Eotvos Lorand Tudomanyegyetem - Magyar
Powlesland, D., Lyall, J., & Donoghue, D., 1997, Enhancing
nd
emzet1 Muzeum, Budapest, 153-155. the recrd through remote sensing: The application a
. . st ng
Fassbmder, J. & Stanjek ' H., 1996, Magnet1sche Boden- .
mtegrat10n of mult'I-sensor, non-mvas1ve remote sen
. .
baktenen und deren Auswrrkung auf die Prospektion . d
techmques for the enhancement of the Sites an
.
?
archii log1 cher Denkmaler, in Becker, H., (Hrsg.),

.
Monuments Record, Heslerton Parish Project,
N .
. tt p://
Archaolog1sche Prospektion. Luftbildarch" aolog1e und (h
. _Yorshire, Egland, Internet Archaeology 2,
Geophys1'k A ibettshefte des Bayerische11 Landesamtes
' .
mtarch.ac.uk/joumal/issue2/pld_index.html).

143
142
 O HYSICAL CA MPAIGN AT THE NEOLITHIC SET TLEMENT OF
A GE P
KANDOU - KOUPHOVOUNO S (CYPRUS)

SARRIS, A.,1 BALL, S.,2 GEORGILA, K.,3 KOKKINOU, E.,3

KARIMALI, E.4 & MANTZOURANI, E.5

1[,aboratoiy of Geophysical, Satellite Remote Sensing & Archaeoenvironment, Institute of Mediterranean Studies,
Research & Technology, Hellas, P.O. Box. 119, Rethymnon 74100, Crete, Greece, asaris@ret.forthnet.gr
p; mdation of
lenn G. Black Laboratmy of Archaeology, University of Indiana, Bloomington, IN 47405, sball@ucs.indiana.edu
3Laboratory of Applied Geophysics, Dept. of Mineral Resources Engineering,
Technical University of Crete, Chania, Crete, Greece
4Foundation of Hellenic World, Akademias 15, Athens, Greece
5Department of Archaeology, University of Athens, Zografou, Athens, Greece

The g eophysical mapping of the Neolithic Settlement of Kandou-Kouphovounos, in Cyprus, was conducted as part of the
continuing archaeological research program in the specific area. The goals of the project included the mapping of the shallow

depth architectural remains of the site in order to assess the limits of the settlement and plan the future excavations of the site.
t
Mag netic surveying was successfully applied, together with soil resistivi y prospecting. Both techniques resulted to a number of
fea tu res that have been correlated to the existence of architectural features. The electromagnetic survey (EM38) encountered
various problems related to the balancing of the instrument due to the extreme high temperatures, the high resistivity of the
shallow bedrock and the lack of contact with the suiface due to the dense vegetation islets and bedrock outcrops that were
scattered in the area. The magnetic susceptibility maps, covering an area with existing architectural relics, resulted to a detail
mapping of their inner details, in close correlation to the other techniques. Subsequent excavations in the following year
revealed a number of architectural features which were located by the use of geophysical prospection techniques. The
geophysical maps indicate that the site extends in the north, south and west directions with no evidence of a surrounding
defensive structure. F urther geophysical work is planned to map the relics on the slope of the hill. The final product will consist
of the superposition of the excavated regions on the geophysical maps to provide a tool for the management and preservation
of the site and its environmental settings.

KEYWORDS: GEOPHY SICAL PROSPECTRY, NEOLITHIC SETTLEMENT, CY PRUS,

MAGNETIC SUSCEPTIBILITY, EM.

Introduction resistivity survey correspondingly (Fig. 2). A l m Twin probe

configuration was used in the resistivity prospection of the
A joint team of the Institute of Mediterranean Studies, the site (Fig. 3).
Technical University of Crete and the University of Indiana
conducted a geophysical survey at the Neolithic settlement of Discussion of results
Kandou-Kouphovounos, in Cyprus. The past few years,
systematic excavations by the Archaeology Department of the The results of the geophysical survey were characteiized by
University of Athens have revealed various architectural a general uniform trend, with the exception of a number of
residues, such as rectangular residential units, pits, fire extreme values due to the existence of metal poles at the edges
hearths, graves, and lithic tools (Mantzourani 1994). Most of of the 20x20 m archaeological grids, which were set up
the architectural features were lying on the top of the bedrock, <luting the topographic survey of the region. The presence of
0.2-0.5 m below the ground surface. A few test excavations in metal fragments, bushes and outcrops of the bedrock were
the southern part of the hill, where the settlement is spread, responsible for numerous extreme magnetic values that
did not produce any finds, raising questions about the limits of masked specific areas in their vicinity. Despiking techniques
the site. and bandpass filteting in the spatial domain removed the most
Geophysical techniques were employed for dealing with intensive anomalies that were caused by non-archaeological
problems related to the layout of the residential units and the features. The close registration of the geophysical maps to the
limits of the settlement. The gtids covered a total area of records of the surface anomalies was valuable in the
3.800 m2, towards the south side of the hill (Fig. 1). A small recognition and removal of these anomalies, without any loss
region to the north was also surveyed to vetify the existence of information (Fig. 4). Magnetic data were most satisfactory
of archi in detecting the presence of architectural features in the W and
tectural remains. Magnetic (vertical magnetic
gradient),
soil resistance (twin probe), and electromagnetic SW sides of the hill, close to the excavation trenches (B & E).
<EM38) techniques were used for prospecting the above areas. Both magnetic and electromagnetic data revealed a
In a ddition, measurements of the surface magnetic constellation of architectural features in the northern part of
suscept
ibility were obtained in a small region, in order to the hill, approximately 30-40 m away from trench A. The
correlate
them with the corresponding results of the magnetic presence of these candidate targets was confirmed by the
and EM surveys. Sampling was performed at 0.5 m and 1 m superposition of the soil resistance anomalies. A number of
step interval for the magnetic/electromagnetic survey and linear features in the south portion of the prospected area are

Proceedings of the 31" Imematio11al Symposium 011 Archaeometry, Jerem, E. & T. Biro, K. (eds.), Archaeopress-Archaeolingua, BAR- Ce1ltl: Ew: Se1: 1.
 Sarris' A ., Ball' s., Georg1la,

K., Kokkinou, E., Karimali, E. & Mantzoura A Geophysical Campaign at the Neolithic Settlement of Kandou - Kouphovowws (Cyprus)
ni, E.

. 1'.:..\l;}V .i;,.:t_:f{'\.'V'l}l',}.;!i'i:'i!iY:Ci\:-1 :.>J..L!i E

Et:7:1J'.!-!'!'E ;:- ::_!!rn.:,E-.-p:r:-.;_:; :.F: !": '.<'..};.

1so
240 ' 0

.
220 Ill 220

200
Giophy1'1Gnd1

200' SoilR;J11nc1>511rn:_r(rnklP1ooc)

M'fQnlt i Conduli"Y Survf1f

180
'
180
160

140

120

100

60
.... X.!J.Vll )XJJVlll xx1x...

40

,xxxv
20

x.xxy111 )<.XXIX. .. .... L... . ... ; JLI . ... .....LU '---c....,--.,.....,..---,,...;.-.,.,-'-c,..,...,.-,_,..,----,--'

oO 20 40 60 80 100 120 140 160 180 aoo
EAST(m)
XLV XLVI XLVll XLV//I xux
40 60 80 100 .::""'lt;;\;;k
II :-,.rre.'rl&:-:cr.r:o::les:
fuf,
SOIL RESISTANCE DA TA & PROBABLE_SCE_ TT?E
0 20 fy a number Fig. 4. Interpretation of the geophysical anomalies,
Fig. 3. Soil resistance survey was able to identi
40 60 80 100 120 140 160 180 200
s, althou gh signal to noise ratio was high superimposed to the archaeological remnants
EAS T {m) of potential target
m outcro ps of the shallo w bedrock. found by excavation.
enough due to the rando
the targets was possib le by compa rison of
Identification of
all three data sets (soil resistance, vertica l magne tic gradient
Fig. I. Geophysical grids superimposed on the archaeological grid system. and electromagne tic data) and elimin ation of the anoma lies
resulting by the surface charac teristic s of the site.

Details of the Electromagnetic Survey_ 8.00 10.0 OW 00 00 600 600 1M

2.00 4.00 6.00

Fig. 2. Magnetic, soil resistance and elec .

u tr<'magn
ettc tec11111q
. ues were used or coverin

The coverage of the area by fi g most of the area of interest.

multi .
P e te e1mtques was
1 Fig. 5. Electromagnetic survey. The outline of the subswface features is clearly represented
necessmy due to problems arising
by tie
1 geom01phological char
acteristics of the site. in both gray scale (left) and contour (right) maps.

146 147
 Sarris, A., Ball, S., Georgi/a, K., Kokkinou E Karimali' E & Man
'
t.zourmu,. E.

probably related to variations of the bedrock's anaglyph, registration), intensive soil corrosi
_ on Phen o THE ISLAND OF AMORGOS:
rn ena
whi ch could be considered as constituting a natural defensive s1gnaI d1. stmc t10n) and unfavorable pr . O ac "1.
eserva11o n

NSING
MICRO-SCALE & MACRO-SCALE REMOTE SE
border for the settlement to the south. Evidence of intensive condit
Kantou-Koupho v o u n o s, the recog
nit" ions
. 10n of th
soil corrosion to the south enforces the supposition that the e geop .
signatures (depen d ing on the metho
d used) rne hy8j,.. 1
UROU, A.,3 KAR ATHANASIS, CH.,3
. t a nu
ARRIS, A.,1 MARAGOU, L.,2 GKIO
settlement was mainly expanded in the northern pru1 of the d1fficu 1Iles d u e to the rough geo mo rnber"<IIf

rph o 1 ogy, th o
hill. thick vegetat1.0n, the outcrops of the
e fre S GIANNOULI, E.,7
LI, M.,4 MAVROIDIS, TH.,5 KAR IMALI, E.,6
dr qu ency 0f
sTEfOU
. . be ock
In ntrst, the north section of the hill appears to be more su ffic1ent thickness of soil, and the
the 1a
ck of
GAVALAS, G.,2 AS VESTAS, G.,3 GEORGILA, K.,3
'
size a n d
n ature

pronusmg m relation to the existence of architectural remains. potential taigets ( some of which were of the
even engr av
1.
A specific region was surveyed by all methods, in order to be bedrock) (Sanis 1998). The parallel prosp
e d I.nto
the IOANNOU, D.3 & VRONTAKI, E.3
ec ion of
used as a guide in the interpretation process. The internal . th e s.u
diffi e by
. .erent .techniqu es and intensive filtenng of th
e data nt, Institute of Mediterranean Studies, Foundation

details of architectural remains are evi d ent in all data sets. cnt1cal m th e enhancement of th
e 1,,eatu r e 8
were
1 atory of Geophysical, Satellite Remote Sensing & Archaeoenvironme
.
S?il resistivity was especially successful in outlining mterpretation of th e m.
an d t
he [JI b or gy, Hellas, P.O. Box. 119, Rethymn on 74100, Crete, Greece, asaris@ret.forthnet.gr,
of Research & Technolo
differences that were caused by the existence of wall 2Dept. of Archaeology, Universit y of Ioannina , Ioannina 45110, Greece,
structures and/or corridors. Similar results were produced by ring, Technica l Universi ty of Crete, Chania, Crete, Greece,
References 1 ophysical Laboratory, Dept. of Mineral Resources Enginee
the electromagnetic survey (Fig. 5), c ontraiy to the cor Ge Mesogei on 70, Athens 115 27, Greece,
4Institute of Geological & Mineral Explorat ion,
responding ones in the sou them portion of the site. s Engineering, Metsoveio Technica l Universit y of Athens, Zografou, Athens, Greece,
Mantzourani, E., 1994, Ekthesi Apostelesmaton t' An 5Dept. of Mineral Resource
18 askafi8
st1 thes1 K a n d o u-Ko uph o vounos , Epi.stim 6Foundation of Hellenic World, Akademi as 15, Athens, Greece,
oruki EpetiJi

C on cl us ions . da 17236, Greece

toy Tmimatos Archaiotiton Kiprou. 70ifeos 27, Dafni, Athens

.

.
Sams, A., 1998, Geophysical Issues in Arc
haeological

The emp oyment of geophysical prosp ection techniques in .
Research: Paradigms, Uncertainties & I c . s
nterencie
the srveymg of Neolithic sites needs special attention, Int ing and macro-scale satellite remote
. m on Remote Sensin
Sympos1u has become the target of micro-scale geophysical prospect
g in Archaeology, B '
oston, The island of Amorgos
applying a wide spectrum of remote

especially when dealing with a dry enviro nment (weak signal USA, 16-19 Aplil 1998. of the project was the formulation of a general strategy for
sensing investigations. The goal framewo rk of archaeological research.
es and integrating the corresponding results to the general
sensing techniqu site and a hilly site dated
le only by foot, a coastal Roman
conducted in two remote areas, accessib
The geophysical survey was r sites for mapping
e surveys were carried out at the particula
from the Early Cycladic (EC) period. Magnetic and soil resistanc
the same grids. The correlati on of the geophys ical maps and
suiface sur vey was applied on
the subs urface relics. A systematic g was also
results about the boundari es of the EC site. Geophys ical surveyin
the swf ace sherd concentration has drawn specific
are either covered complete ly by alluvium deposits, or are
site, most of which
able to detect architectural remains of the Roman
photogra phs were used for creating the aerial mosaic of the
Aerial
submerged within the sea due to the past seismic activity.
and both layers were superimp osed on the DEM of the
aerial images
wider region. The geophysical grids were registered to the
satellite mosaic of the whole island. Processi ng of the diff erent
region. Two Landsat TM images were combined to produce the
image was also superimp osed on the DEM of the whole
bands was used for creating a number of thematic maps. The satellite
added for producing a GIS. Supervised classification
island and other layers such as the digitized geological maps were
the island. The island of Amorgos has been used as a pilot
techniques have been used for modelling the settlement patterns of
study for the application of large and small scale investigations of the archaeological sites of Greece, proposing a model of

ar chaeological site assessment and the creation of an electroni c archaeolo gical and monument record through the use of

Geographic Information Systems.

G, GIS, AMORGOS, GREECE.

KEYWORDS: GEOPHYSICAL PROSPECTION, SATELLITE REMOTE SENSIN

The second module of the research dealt with the macro

Introduction
scale management of the archaeological sites of the island.

In the current presentation we will deal with the application Aerial and satellite imagery was employed to capture the

of micro-scale and macro-scale investigations in the island of geomorphologic characteristics of the island and provide the

Amorgos, in the Aegean. A nationally funded campaign was geographic context for the accurate registration of the known

Carlied out in the island of Amorgos, in the Aegean, as a pilot archaeological sites. The digitization of topographic maps

project for the application of different remote sensing
tech niques and the integration of them in a Geographic
Information System that could be used as a tool for the
man agement of the archaeological sites (Sarris 1994).
The micro-scale module of the project included the systematic
surface survey
and geophysical prospection in two remote
eas located in the north of the island, SW of the capital of
atapola. The targets of the geophysical campaign were the
coastal site
of Kato Akrotiri, consisting of Roman/Byzantine
: chitectural remains, and the hilly settlement of Madres of
1'oussos dated to the Early Cycladic period (Maragou 1990).
he magnetic and soil resistivity surveys were conducted in
er to locate and map remnants of architectural remains.
e geophysical data were correlated to the results of a
system investigate
atic surface survey, in order to
habi_ tatio n
trends within the sites.
provided useful information on the altitude, slope, and aspect
of the archaeological sites and became the base for the
production of 2-D & 3-D thematic maps of archaeological
interest.
The digitized archaeological and geological data were
correlated to the satellite images in an effort to recognize the
spectral signatures of the archaeological sites. Supervised
classification techniques have been applied to identify areas
of specific archaeological interest. A number of thematic
maps were produced, regarding the archaeological sites of
different era and "risk" areas of similar interest.
Methodology and results
the The site of Kato Akrotili was surveyed by magnetic and
soil resistance (Twin probe) techniques with a lm sampling

ss -Archaeolingua, BAR - Centi: Ew: Se1: 1.

148 Proceedings
of the 31" Intemational Symposium on Archaeometry, Jerem, E. & T. Biro, K. (eds.). Archaeopre
 Sarris A , M,
' . ""'"' L,

Gk;,,ro,,, A . Kw"''
"'";,, Ch.. S"fa
Cav a/ as, G., . "U, M., M"""'d", a 1

Asvestas,G., G
eorgi /a, K., Ioannou,
Th, Kanm 4 E. . c"'""""
inervl (Fig. 1) The pr D. & Vront aki, E. /', ., The Island of Amorgos: Micro-scale & Macro-scale Remote Sensing

x .
gnds mtluenced the resis1Jty of the c o a st to the geophysical c
v11y ommon coordinate syste
sea. S?aded retie maps an readings in the direction of the pro m was helpful
for the s
d di rec tional filtering emph cessing of the data. imult .
the eXJstence of linear featu asi zed
aneo
lls Magnetic grad'zent sun1ey at Mandres tou Roussou -Amorgos 1996
res, Which co Geophysical survey
ing was able to
the existence of coastal archi uld be correlate
d to de te c t archit tu
tec remains of the R oma
of the residuals nd downw tural remains. The calculation com n site, most of w hi ecrJa

. c h are ei
ar . ther c
vertical magnetic gr d con tinuation re pletel y by allu vm m epos ts ' or are ovel'ed

adient duction of the . su b m erge

sea due to the past se1s d Wit 70
enhancement of the above was used for the fu1ther
.
ffilc ac1Iv1ty hin th
. e
an o m alie s . Finally, traces of The macro -sca le
w avelength anoma li.es are sma ll
coponent f the
rese arch gr
. proj included the incorporat1 . Pro aJJun
church. Together With the ectin g away from a modem
e
0n of aenal and s .
atellite im
exi ste nc e of the gen eral assessment
of the archaeolog agery fi
(in situ), the above featu
res could sugg an ancient column island. Four aerial images of ical sites
of :
60
built on the top of an ancien est that the c 1 983 and 1988,
t hurch is & l :30,000 correspo of scale
bu ilding. 1:8 0Qo 40 nT
Ma dr. es of Roussos ndingly, provided a
general ov
1as mainly the region of Kato
Akrotiri (Fig. 3). Phot
er vie w
of
35 nT

resolution (0.5 m) magnet c surveyed o-interpre

with high tation
30 nT
i tec time-change analysis 50 .
measurements wre taken at hnique s (Fig. 2). Resistivity of the ae1ial images
of differen
a nd 25 nT
s (1945, t se
has been leveled In order to pecific areas of interest. The site have 1983 & 1988) verified the changes of the landfo asons 20nT

be u sed for cu been pe1fonned in the

recent years . The
rm that 15 nT
pile of stones . (a lot of Whic ltivation and a
large also been accelerated se chang
es have 10nT
h were by the tectonic act
building matenal for the anc probably u ivity of t
sed as the - 40
i he are
been fomied a.t the cent e o e nt structures or shelters) has
(Tataris 1965). a g
f t he regio The digital elevation
model of the isla nd
:c
data were subjecte to Inten n of inter
est. Magnetic was pro duce
....
a:
5 nT

si a 30 m step inte d by
enhancement te.c hni ues, ca ve processing, including edge
10 nT
rval digitization of 0
the 1 :5000 z
lculation topographic maps (Fig. scale 1 5 nT
4). Although the superp
-

dow nward . continuation filter of the res

iduals, and aerial mosaic onto the osition of t -20 nT
in
together with the superpositi g. The above manipulation, DEM of the reg ion wa he
s successful, . -25 nT
on o f the surf corresponding registr
ation of the geophysic the
the results of the smace sur ace anomalies
and al grids onto
.. -30 nT

ve aerial imagery or the the

targets of archaeological inter ying, indicated a few potential diff digital elevation mo -35 nT
del proved extrem
T?e osaic of the geo e st. icult' due to the abrn
pt changes of the terr
ely 40 nT

p.hysic al grids ain in the area

interest. stressing the
nee d of a mo re det
of 45 nT

applicatwn of the. appropnate was achieved

by the ailed (l-2
m) -50 nT
c orrectio n fa topographic mapping
of the area und er stud
statistical analysi s of the c o ctors through
the y.
m
adjacent grids. The above mon rows and columns of the sate
Two Landsat TM ima .
ges wer e use d for
producmg the
procedure llite mosaic of the isla
p r ocessing of the geophysic w as crucial in the nd. Of the t wo available image ,
a only one of them ( cov s
differences of the mean valu l data in smoothing out the ering the low er part
of the island) was
e of the grids, cloud free, providing
satisfactory visi bili ty
change of base of the resisti resulting by the of the area.
Furthennore, the topog ra vity meter or the gradiometer.
Convolution of the raw
data with the bin ary fonn
phic registrati of the DEM 10
was effective in isolatin
on of the g the ma inla nd of the island (Fig. +

allo; Inclined level .
grids in a Geometric correcti 5).
on of the different spe 0 concentration of rocks: i
ctral bands of the m threshing floor

Soil Resistance
sur vey at Kato Akrotiri
1 L:=====-=-.: -Amorgos 1996
I
__
:- :- .
:-- 'J Roussou.
Fig. 2. Magnetic Gradient Survey at Mand res 0.r
__
__
- --
--

I
70
I
I

60 " 079 7 49 Mal:a.ra

:I
so
.. 079 149

N
0 .. 078 549
R 40
T
H
. _, 077 9'9
(m)
30
' . .. . . .... .. 077 30
.

ii
. .

. ,....
Bi 20
' 076 7'9

I
10
' 076 149' ... 076 149
I

\
I ' 075 549 ... 075 549
\
. .. ... \
10 20 30 40
..
-.;
" 50 60 70 80 .. 07' 949
.. EAST (m)
.

.Mat:a.ra

Fig. 1. Soil
Resistance Survey
at Kato Akrot iri. .
F.1g . 3 . Mosaic of aena
. l image!)' of the wider area of interest.
15 0
151
 sing
. & Macro-scale Remote Sen
.FAmorgos. Mi"cro-scale
The Is/and OJ
Sarris, A., Maragou, L., Gkiourou, A., Karathanasis, Ch., Stefouli, M., Mavroidis, Th., Karimali, E., Giannouli, E.,
Cava/as, G., Asvestas,G., Georgi/a, K., loannou, D. & Vrontaki, E.

Fig. 4. 3-D representation of the aerial imagery of Kato Akrotiri (view from the sea).

UI . 457 551 4 57 554 457 557 01 510 07

'

1, 2, 3 ).
l La ndsat imagery (Bands
ime nsio nal rep rese ntation of the real co our
Fig. 6. 3-D

4 O
l:J 14
7
1 '
-<

4 IJ81 l.of1 ....,..... .. .....,............,..... ..... . 4 011 147

4 0 1 147 - ... ... ............ .................

4 073 147

4 07:1. 147 . 011 J.47

059147 Motv-t-.-----;-+--;.---;-;-;-----;-+---;-...;---;-+-..---;--;--
li.53, 1151 IM>tu:a lilil 4117 lili1 457 H4 451 li57 451 510 4117 573 457 1115 4117 li7!1 451 iU 07

Fig. 5. Pseudocolor representation of the island of Amorgos.

satellite imagery, as well as the archaeological data, to the preference towards the north and south directions. Finally, it
Transverse Mercator System was based on the rectification of can be observed that in the Classical-Roman era, most of the
the images using the affine transformation. True color and already discovered settlements are built in the northern side
of
nd has a
pseudo-color maps were produced by the combination of the island. Given that the northern side of the isla
ve
different spectral bands. Both aerial and Landsat imagery much smoother slope than the southern side of it, the abo
were superimposed on the DEM providing a 3D represen observation suggests that the access to the sea was of prim ar}'
of
tation of the island (Fig. 6). importance in the historic times. Furthermore, a network
Statistical analysis proved that in all times settlement was towers has been created in the last historical times, possibly to
confined in regions of lower elevations. About 70% of all sites serve as a system of communication, control and eas y
are found in elevations of less than 240 m above the sea level, warning of the inhabitants.
as
indicating a continuous trend to coastal and plain areas. In In order to test the above hypothesis, viewshed analysis w
fact, most of the recent villages of the island are built in the performed in both the sites of historic times and the ww
ers.
_
The viewshed process calculates the observation bo un d a ne s
proximity to the coast or valleys. Furthermore, most of the
d ata
lower elevation hinterland has been exploited for cultivation from a specific point of reference, based on the DEM f
purposes based on a ten-ace land use system. A smooth slope Viewshed parameters considered a 6.3-10.8 km distanc 01
of less than 30% is also observed in a similar proportion of sight, a 360 horizontal sweep angle and a +/- 80 ve
rUC
analysis gical sites of the island
of Amorgos.
sites. Similarly, the orientation of the sites shows an obvious sweep angle (Fig. 7). The results of the viewshed s for selected archaeolo
Fig. 7. Viewshed analysi

153
152
 . sing
.
: M icro-scale & Macro-scale Remote Sen
The Island of Amorgos
Sarris, A., Maragou, L., Gkiourou, A., Karathanasis, Ch., Stefouli, M., Mavroidis, Th., Karimali, E., Gian no
uli, E.,
Gavalas, G., Asvestas,G., Georgi/a, K., loannou, D. & Vrontaki, E.

were patticularly successful for most of the island with the There was a clear distinction between the spectral s
i gnatures
exception of the NE side of it, which is also the least explored. sites - no sites and between the Mycenean settlem en Of
ts and
For example, the central part of the island, including the gulf rest of the sites. In the final model, the confusio e
n
of Katapola, was mainly controlled by the sites of Minoa, exhibited an accuracy of 69-100% (Fig. 9). The app
lica
:
atrbt
Arkesini and the port of Kato Akrotiri. This observation, of
together with the results of the geophysical survey,
the classification model to the satellite mosaic of
island produced similar results. A fmther refinement
the
;0
Ole
strengthens the role of the port of Kato Akrotiri. In another th
model and veiification of the preliminary results is exp
ected e
example, one could have found difficult to explain the reason be carried out by the addition of the unpubli shed sites
of existence of three neighboring towers in the SW part of the archaeological database.
to
island. Viewshed analysis suggested that the particular
network not only had control of the nearby valley, but it could Con cl us ions
also establish communication with the northern part of the
island as well. Indications of architectural remnants have been pro
vided
The superposition of the archaeological database on the by geophysical techniques. Natural and anthrop o
geni c
digitized geological map proved that there is no preference of changes of the landform impose specific limitations in
the
the settlements with respect to the geological regions of the survey of archaeological sites and the interpretation
f o
island. On the contrary, most of the sites are observed at the geophysical anomalies. The high-resolution magnetic survey
boundaries of geological regions, suggesting that there was a conducted at the E.C. site, in an effort t o locate its boun daries
tendency to have access to various natural resources (Fig. 8). and recognise residues of past habitation (shelters, to mbs,
A similat conclusion can be drawn by the watershed analysis. etc.), had limited success. The nature of the targets on one
In the particular process, watershed areas (namely hydro hand, consisting mainly of rock-cut shelters and other similar
logical drainage regions) and flow paths were calculated based features, and the different levels of the terrain on the other
2, 3, 4, & 7.
on the elevation values. Drainage patterns were also clearly est to spectral bands 1,
hand, imposed specific obstacles on the survey and the .
as OJ
,f'p rob able archaeological i nter
represented by the combination of Principal Components 4, 3 interpretation process. Still, the methodology used was the F.ig. 9 Classiti
'
" cat ion model rela ting are
.
es
h e spet ral signatur
& 2. Most of the settlements of the island have been found at hou h, sup erv ised clas sification of t .
only way of detecting the specific remnants, compared to . .
ncuon of the arch aeo log ical info rma tion Alt
has been relatively sati
fac to i
: m t:
h
the boundaries of the drainage polygons. This is also in other prospection techniques, even to the traditional surfac e system, and the rest i a1 !
of arch eolo gica l sites
data The spe ctra l sign atu re of arch aeo log . .
t h e kn o w n arch aeological sites, th
agreement to the general observation that most of the survey. Similar restrictions due to the bad preservation of the tothe publis hed

.
rec om zed on1 w he _Y d ling with correct registration o overestimated
sites can be con fide ntly maps h av e probably
settlements extend on the top of the hills of the mainland. monuments and the changes of the landform were also .
: : har act er cor resp onding thematic . .
env iron me ta , the accelerated
sufficiently large are as
wit h sim ilar l ogical mtere st. Still
Prediction modeling was also perlormed based on supervised encountered in the case of the Classical-Roman port of Kato
par ame ters on the the are as of arc hae o d f or an
. . men tal the nee
isucs. The variability of
the environ . ural pre ssu res indicate
classification of the Landsat spectral signatures. Modeling was Akrotiri. of arc hae olo gical environmental and cult an d use d
ility ned
ited availab can be con tinu ous ly refi
.
limited to the lower part of the Landsat imagery, which was Changes in land use strategies and soil erosion processes one hand and th e lim . s on arch aeo1ogic aI GIS that
rest rict ion (F 10).

d, imp ose cert am an d ig.

me nt pro ces s of the is
d 1
cloud free. Classification included all bands but 5 and 6. The were studied through aerial imagery belonging to different information on the other han .
as a too l in the dev elop
patt ern s of t h e i s1an d.
lement
training assemblage was based on a 4x4 or 3x3 cell size for a eras. The importance of aerial photography can be stressed in the modeling o f t h e sett
limited number of sites representing all classes. Seven categories areas containing a number of surface remnants. The analysis
were totally considered based on the already published data: AMORGOS
1) of the satellite imagery was obscured by difficulties arising
Neolithic, 2) Early Cycladic, 3) Middle Cycladic, 4) from the manipulation of data belonging to different scales,
LANDSAT TMl
Mycenaean, 5) Historic times, 6) other sites and 7) no sites. the registration of images and maps into a common coordin ate

011 141
D

a 11

85

EASTING

.
. ,f' known & published sites).
(mapping OJ
haeological map ,f' the island of Amorgos
OJ
Fig. 8. Correlation of the digitized geological map with the archaeological inventory. F.1g. JO . Electronic arc

155
154
 Sarris, A., Maragou'
L" Gk'1ou1vu, A., Karatha ' '
Gava las, G" Asvesta
nasis' Ch" SteJ'F
0 &. d"
. 11/1', M., M.avro1 1s' " ' " Kan. ma /'
111 .
s, G., Georoi/a .1, E " Gwn
noufi' E

, K., loa1111oi1, D. .,
vrontak '1.' E
o

R eferences

Maragou, L., 1990, Eviden

ce for the Early Cyclad
ic Reno
.
d on
ANCIENT ITANOS (ER IMOUPOLIS, LASITHI):
Am01gos' Cye Iad'ica, .
Studies in memory of
.
Goulandris, London, 99- N p ,i\N ARCHAEOLOGICAL SITE AS A REMOTE SENSING LABOR ATORY
1 15.
Sarris, A ' 1994, Geophy
sical Surveying in Gre
'. ek Archae . ARRIS, A.,1 VAFEIDIS, A.,2 MERT IKAS, ST.,2 GUY, M.,3 V R ONTAKI, E.,2
ologica l Research: Retrospec
t & Futuv" S
"' Plans, Inter
nat10nal y p osium on - MANAKOU, M.4 & KALPAXIS, TH.1
"

"Science and Archaeolo

.
A Mult1disc1plin. ary gy
Approach to S tudym . g the

!l .
arvard Uruver . , Bos Past", 1raborato1y of Geophysical, Satellite Remote Sensing & Archaeo-environment, Institute of Mediterranean Studies,
sity ton, USA., 14- 16 Octobe
1:atans, A, 1965, The geo r. un dation of Research & Technology, Hellas, P.O. Box. 119, Rethymnon 74100, Crete, Greece, asaris@ret.forthnet.g1;
tectonic position of Amorg Fo
os island ' z m of Mineral Resources Engineering, Technical University of Crete, Chania, Crete, Greece, vafidis@mred.tuc.g1;
Bull. Geol. Soc. Greece
6, 239-247. oepart ent
328 Montcalm, Ramonville, 31520 France,
4Geophysical Laboratory, University of Thessaloniki, PO. Box. 352-1, Thessaloniki, Greece

For the past 4 years, a coalition of European researchers has been studying the archaeological site of ltanos in North-East
rete, Greece, from various archaeological, environmental and geophysical aspects. The project, supervised by the Institute of
C
Mediterranean Studies in Crete and the French School of Archaeology in Athens, has integrated a number of surveying
q accessing the archaeological and environmental parameters of the wider archaeological region. The purpose of
tec hni ues for
the geo phy sical project has been to map the buried archaeological relics, including remnants of buildings, streets and walls in

the ex tend ed area of the archaeological site. Furthermore, the site has been used for testing a number of high resolution
co nve ntional and modern survey techniques. Seismic refraction and reflection techniques were used for detecting the ancient
port of Jtanos and mapping the bedrock of the area, covered by alluvium deposits. The ancient port was also the target of CPR
and electrical tomography prospecting, which encountered serious problems due to the shallow depth of the water table.
T he geophysical, topography and archaeological survey data have been superimposed on to an aerial mosaic of the region.
The overall assessment of archaeological sites has been extended through the use of Landsat and SPOT satellite imagery (the
last of which has been re-sampled to 5m accuracy, through pixel-mixing techniques). Sub-centimetre accuracy with CPS
re ceivers has been used specifically for the above image registration as well as for precisely locating the archaeological,
environmental and geophysical features. The archaeological site of ltanos has been evolved to be a natural Remote Sensing lab,
where dife
f rent scientific approaches have been applied to effectively extract the archaeological information of the site.

KEYWORDS: GEOPHYSICAL PROSPECTION, SATELLITE REMOTE SENSING, GREECE, CRETE.

Introduction urements of the vertical magnetic gradient and soil resistance

Since 1994, a joint expedition of the Institute of
Mediterranean Studies - F.O.R.T.H., the French School of
Archaeology in Athens and the Technical University of Crete
has been studying the Early Christian/Hellenistic site of
Itanos from the perspective of non-destructive surveying
(Sarris et al. 1998; Vafidis et al. 1996; Vafidis & Sarris 1998).
Land-based and satellite remote sensing techniques have been
used for mapping the subsurface relics of the site and
reconstructing the environmental settings of the ancient
settlement and its surrounding region.
The site, an ancient Hellenistic/Early-Christian port in
Eastern Crete, lies close to the Vai Palm Forest, surrounded by
sea on the east, a mountain on the south and the provincial
road from the west and north. The structural remains of the
settlement, found in the area of the two hills consisting the
two acropolis of the site, include remnants of temples, a
cemetery and a number of residential units. The location of
the harbor used to be an open question, which stimulated the
prospection survey. The site covers an area of more than
16,000 square meters and it was soon realized that the
ss essment of the archaeological monuments of the site and
Its surroundings could be accomplished only through the
Utilization of geophysical and satellite remote sensing
techniques. At the same time, limited archaeological
excavations and restoration activities are in process in order to
Prom ote the importance of the archaeological site.
Mapping of the subsurface remains was carried out with a
num ber of geophysical techniques (Fig. 1), including meas-
156
Proceedings
of the 31" Imematio11al Symposium 011 Archaeometry, le rem,
and electromagnetic techniques. Ground penetrating radar
surveying and electrical tomography were used for
maximizing the information inventory, along transects above
features characterized by a strong geophysical signature. The
purpose of these experiments was aimed towards the
acquisition of 3-dimensional information of the subsurface
(since there are at least 2 occupation layers) and to the
refinement of the prospection strategies and methodologies
used in the particular geomorphologic conditions. Seismic
techniques were also applied for locating and capturing the
form of the port's basin and aerial and satellite imagery,
combined with GPS surveying, was used for the further
assessment of the archaeological relics.
Methodology and results
The goal of the Itanos campaign is the reconnaissance of
the monuments of the site and its surrounding environmental
settings through the use of archaeological and remote sensing
techniques. Both surface and subsmface archaeological relics
are mapped and analyzed via topographical measurements,
geophysical prospection techniques, aerial photographs, and
satellite imagery.
Geophysical mapping was carried out in various grids
through vertical magnetic gradient, soil resistance, and
electromagnetic techniques. The depth of investigations
varied from 0.5 m to 6 m. The subsurface alluvium layers of
the site contain at least 2 occupation levels at varying depth
from the current surface of the ground. The complementary
E. & T. Biro, K. (eds.). Archaeopress -Archaeolingua, BAR - Centi: Ew: Sei: I.
 laboratory
al site as a remote sensing
lis, Lasithi): an arch aeologic
a e1'd'is, A " Mert1kas, St., Guy, M., Vrontaki, E., Manakou, M. & Kalpaxis, Th.
Sarris' A " Viif.

Ancient ltanos (Erimoupo

6). The
h of the two acropolis (Fig.
n techniques was identified in the region sout
by different prospectio the theoretical assu mpt ions , which
.
g of the site sical model is in agreement to
s e
in orde
r to examine the
behavior of the geophy
tati on proposed the specific loca
tion as a better cand idat e for the
nce level of the interpre ic
d1d1 and in
crease the confide
ieve d coastal installations of
the site due to its geog raph
sical images was ach
51gna 5 Enhancement of geophy
s and properties.
proces volution of gradient,
Laplacian, high-pas
ion survey was implemente
d by
the con The ground-based prospect
tbfO:
ball .P
ass ope
rators (Fig. 2). But terwmth and Gaussian
domain have been proven
effective geodetic surveying using an
Ashteck total station and
the
a
kine
mob
mat
ile
ic
the frequency e was applied for
n g in
related to the unit. "Stop & Go" techniqu
fjlt en sho1t-range anomalies
.

a num ber of
ing the on of Itanos, taking
utl in and other surveying of the wider regi
.

ill te ctural remains of
the site. Linear features
ugh the application of dire
ctional high-accuracy read ings of grou nd control points (GCP) to
and sate
be
llite
arc ' ls were emphasized thro correction of aerial
: tal
te rin g (1 st and 2nd
horizontal derivatives).
evident in the electroma
The rem
gnetic
ova l of
dat a,
used for the geometric
images. A number of expe riments of static surveyin
accuracy of the syst em
g were
and
lo ca l trend, especially 3). conducted for testing the
tbe ies (Fig.
essary to enh ance the residual anomal grids and profiles to the gene ral
was ne c . collect field data for registering the geophysical
was used to e obta ined
g I Swift system site. Measurements wer
The Stin ys, topographic layout of the
nner and dipole-dipole arra to the Greek Geodesy Syst
em
imaging. Both We in UTM and then tran sfor med
resistivity sure
1 m, were employed to mea measurements were used
for the
ctrode spacing 0.5- of Axes ('87). The above
wi th ele ). The 2-D
at different depths (Fig. 4
Seismic Survey (Seis-gun) l ima gery .
t resistivity values atic and multispectra
appa ren ugh registration of SPOT panchrom
arent resistivity data, thro
of the measured app
jnversion and a non-linear least
ce forward modelling Final remarks
finite-differen
into true resistivity was
optimization technique,
squares n and interpretation
accurate depth determinatio ns of
following the same directio
necessary for ography was Site recovery will continue
Barker 1 996). Electrical tom sical prospection wor k will be
of th e data (Loke & avations verified the surveying. Fmther geophy

area of grid H, where exc use of conventional and non
applied to the tified by other carried out through the
ber of wall structures iden ing the geophysical sign atur e of
existence of a num conventional techniques, refin
th of the two
es, and in the open area sou ng the interpretation proc
ess.
geophysical techniqu subsurface targets and imp rovi
nd penetrating
a pulse EKKO 1 000 grou only be required to inve stiga te
acropolis. In addition, In this way, excavations will
. 5). Pre
in the same regions (Fig rest, providing a feed back to the
radar was employed regions of significant inte
saturation
signals included a signal n. The goal is to study in dept
h the
proce ssing of the radar process of data manipul atio
ity of the
level removal. Continu methodologies used and
take the
correction and a DC dynamic potential of the
by the application of a gain t of the
reflecting signals was assessed appropriate actions tow
ards the improvemen
ortio nal to the signal strength. valu able
control filter, inversely prop thereby supplying a
techniques and sensors,
appl ied along the profile of the . The
A horizontal average filter was e prod uctive application of them
flat infrastructure for a mor
manner for emphasizing port's basin will be inte grat ed by
Global Positioning System (Base Station) Electromagnetic Survey data in a trace to trace 3-dimensional model of the
ctors in the grou nd (Bev an & be fed to
lying/slow1y dipping refle the resulting model will
e further seismic surveys and
. The purpose of the abov eate the
Kenyon 1 975; Goodman 1 996) ounding region to recr
the the DEM of the surr
in a clear picture of stion.
experiments was twofold: first to obta of the particular area in que
ains and second to environmental settings
signal expected by architect ural rem ronm ental
, geological and envi
g and seismic survey SPOT Panchromatic imagery
correlate the data with the results of corin regi on will
al data of the wider
parameters, and archaeologic
Info rma tion
(Camerlynck et al. 1 994). ractive Geographic
be synthesized to an inte
to map the top of the ent
Seismic surveying was performed for a more rational man agem
of the overburden, System, which could be used
basement and calculate the thickness regi on. This
ental resources of the
reflection and of the cultural and environm
which consists of alluvium deposits. Both of grou nd and satellite prospection,
GPS
and hammering type of integration e
refraction methods were employed. Seis-gun will continue in an even mor
ic waves that and GIS technologies
were responsible for the generation of seism llanos as a natural rem ote sens ing
The seismic systematic way nominating
were recorded by 48 units of 1 4 Hz geophones. nts wou ld allow us to expand and
modify
orth and lab where experime
trave rses were set up in approximately south-to-n the future.
es were the research strategies for
east-to-west directions, whereas parallel profil
hone
separated a distance of about 1 5-25 m and geop
at
References
separation was 2 m for all profiles. Shots were performed
of vary ing
e middle of the arrays, at both edges and at offset 1 975, Ground Penetrating
Radar for
eve, depe ndin g on the Bevan, B. & Kenyon, J.,
distance when this was poss ible to achi ca News Letter 2( 1 ), 2-7.
all Historical Archaeology, Mas
restrictions of the landform and vegetation coverage. In M. & Panissod, C., 1 994,
the Camerlynck, C., Dabas,
s ections, processing of the data resulted in three layers of and four Elec trom agn etic
Comparison Between GPR

s bsurface. In addition to seismic refraction techniques, a
Methods for Stone Fea
tures Characteriz atio n: An
ed out
high resolution seismic reflection survey was carri Prospection l, 5- 1 7.
Hz Example, Archaeological
along one of the profiles, with the use of a seis-gun, 00 1
Pen etrating Radar Simulation
in
Goodman, D., 1 994 , Gro und
rec eivers and a 0.5 m geophone separation. The optim um 224 -23 2.
y, Geophysics 59,
) was 7 m. Engineering and Archaeolog
wind ow (offset between source-first geophone R. D., 1 996, Rapid Lea st-S qua res
Loke, M. H. & Barker,
Global Positioning System (Mobile Unit) Vertical iHagnetic Gradient Survey
J Pro cessing of the seismic reflection data included geometry
co rrections, trace muting, AGC, stacking, deconvolution, and
Inversion of App aren

Quasi-Newton Method,
t Resistivity Pseudosectio
Geophysical Pro spec
ns by a
ting 44,
. ed the
nugration. Processing of the refraction data has offer
1 3 1 - 1 52,
fir st 3-dimensional model of the ancient port which has been
Fig. 1. Details of the Geophysical survey in ancient Itanos, Erimoupolis (E Cr,ete, Greece.
)
1 59
1 58
 Sarris, A., Vafeidis, A., Mertikas, St., Guy, M., V rontaki' E
., man
u akou M &
'
valp
" A ncient Jtanos (Erimoupolis, Lasithi): an archaeological site as a remote sensing laboratory
axis

, Th.

Bandpass filter Grid H (M

w
agneticil_ J :rr AN9$ .........,C.RI
1997FIELD SEASON
if ..gTEh .. hG... N ....TJC. GRA..P. J:E:.N..T ::GXJP....9.7.l?.

14

12

10

_g
8
;r.:
E-<
""
0
:z
4

2 4 6 8 10 12 14 16 18 20

EAST (m i

lstD :irecdonalD erivat:Ne

14

12

10

_g
8
::i::
E-<
""
0
z

2 6 10 12 14 16 18 20 22 24 26 28 30 32 34

EAST (m)

R es:iduaJs - h:igh pass filtering

14

_g
8
::i::
E-<
6
0
z
4

2 4 8 10 12 14 16 18 20 22 24 26 28 30 32

EAST (m )

Fig. 2. Top: Bandp ass filtering of magnetic data. Bottom: A: Grid H. Upward con tinuatio'.1 ofmagnetic Fig. 3. Vertical magnetic gradient was successful in mapping the shallow depth archaeological relics of the site.
abo ve the suiface). B: Grid H. Butte1worth filtering of magnetic data (cut-off: 0.125) C: Gnd H. un;;:rt
(8 m T he application of directional filters and the calculation of the residuals emphasized
of magnetic dat a (cut-off: 0.250) D: Grid H. Butte1worth filtering of magnetic data (cut-off: O. ' a number of features probably correlated to remnants of wall structures.

160
161
 Ancient ltanos (Erimoupolis, Lasithi): an archaeological site as a remote sensing laborato1y

0 .9

1 .7
2 .2
2.1
3 ,3
3,9
4,6
i!JH.J; Ila
64. 0 .. - -
128 25 6 5!2- -
Unit Electrod
e Spac
ing -
_ Le
M

5eud0 1 .0
J)eJ'th

9 ,5
1 .0
1 .5
2 .0
2.6
3.1
3.6
4.1
4,6 cl A J'arent Resistivit
p y Pseudosecti on
re
easu

5eudo 1.0
l
Del'tl

9,5
1.0
1.5
2.0
2.6
3.1
3,6
4,1
4,6 "AJ'J'arent Resisti
vity Pseudosection
ate
a1c:1.1l
iteration 9 RHS e.r.ro:r = 3. 3 X
5.0 9.9 1.3.9
1.0
DeJ'tll
0.z
9,8
1.4
2.z

- le
D.pole Dipo (TOP) and Wenner (BOTTOM) tomography (a=I m), para
Fig. 4. i llel to an excavation trench.
Fig. 5. G
.r gn'd H
round penetrating radar cross-section in the area OJ - P1V1

along the direction of the trench (W to E).
.+:fe
162
163
 Sarris, A., Vafeidis, A., Mertikas, St., G11J\ M., Vivmaki, E., Manakou, M. & Kalpaxis, Th.

I 3 DHvfENSIONALMODELOFTHEAl"lCIENTPORT OF ITANOS. E. CRETE I THE GEOPHYSICAL IMAGE OF A PAR T OF THE ANCIE NT

ROMAN TOWN POROLISSUM IN DACIA

SCURTU,E. F.

S.C. GE/ - P roseco S.R.L., Bucharest, Romania

-20m
-nm
-24m
-26m
The paper describes the results of a geophysical (magnetic and geoelectric) siavey on an area of more than 2 ha where no
-28m ace of ancient Roman buildings of the town (that had about 20,000 inhabitants in the 3rd century AD) is visible at the surface.
-.Hlm
-32m
-34m
he main result of the judicious use of geophysics (especially a high accuracy of field measurements and an appropriate
the data) is a veJ)' precise plan of the area (Fig. 5), that s hows streets, buildings and even room entrances.
filte ing of
-]6m r
-3Sm
40m
KEYWORDS: GEOPHY SICS, ARCHAEOLOGY, DACIA, ROMAN TOWN, FORT, BUILDINGS, ROSETTE.

Classical archaeological methods need a huge expenditure La Tene epoch due to some Dacian small forts built up during

o f human energy. More than that, as someone said, the 2nd-l st centuries BC around a large one on the Magura

-2m arc haeological excavation, in fact, is a controlled destruction. Moigradului hill.

-4m That is why modem techniques, first of all geophysical ones, A strong military zone was built there in the Roman period
:-6rn which can provide a three-dimensional non-destructive (the 2nd-3rd centuries AD). It was the most important
...
-7 Jll search, are more and more used in archaeology to increase the defence area of the north-west Roman limes and it included
-9m
effectiveness of fieldwork. large forts where troops were lodged (Gudea 1989).
-llm
We unde1took such an application of geophysical A flourshing town, Porolissum, was developped also in the
-12m

-14m (magnetic and electrical) methods on a smface of about 2.2 ha area. It was a big production and commercial transit centre of
-17m in the Salaj county, Roumania, right to the south of the Roman about 20,000 inhabitants (Forni 1976). The civil settlement
-18m fort built up on the Pomat hill (Fig. 1). already existed in 106 AD, when a Roman veteran was
established there. After its permanent growth, the town was
-12 m
declared municipium at the end of the 2nd century.
-6m
An other outstanding moment in the history of the town
-30m

-34m was certainly the visit of the emperor Marcus Aurelius

-38m Antoninus (Caracalla) in 213 AD, when special activities of
-42m embelishment of the town were probably provided. A colossal
equestrian bronze statue of the emperor was also built up there
on that occasion.
The map of Roman Dacia in the 3rd century AD is
Fig. 6. Three-dimensional representation of the ancient port of Itanos, presented in Fig. 2. The northern border of Roman Dacia
produced by the synthesis of the results of the seismic survey. (divided into three provinces: Dacia Porolissensis, Dacia
Apulensis and Dacia Malvensis) was the limes itself and the
Sarris, A., 1996, Ground Penetrating Radar (GPR) Survey at Assessment of Itanos in Eastern Crete, Greece, southern one was Danube (Danubis). To the east of Roman
Chalasmenos (Pahia Ammos, E. Crete - Final Repo11), Co nfe rence on Computer Applications in Archaeology, Dacia, Moesia inferior extended till the Black Sea (Pontus
Technical Report, Athens. CAA 98, Barcelona, Spain, March. Euxinus). On the map in Fig. 2 the known Roman settlements
Sarris, A., Vargemezis, G. & Karimali-Sani, E., 1996, Vafidis, A. & Sarris A., 1998, Geophysical Survey in the are also shown. Their known latin names are in capital letters
Geophysical Investigations at the Archaeological Archaeological Site of Itanos (Erimoupolis, Lasithi) - (actually Napoca is Cluj, Potaissa is Turda, Apulum is Alba
Research of Athienou - Malloura (Cyprus), 3rd 1997 Field Season, Technical Report, Rethymno. Iulia, Drobeta is Tumu Severin, Tomis is Constanta). It seems
Symposium of Greek Archaeometl)', Athens, 6-9 Vafidis, A., Sarris, A., Oikonomou, N. & Kalpaxis, Th., 1996, that Napoca was the capital of Dacia Porolissensis, but
November 1996. Geophysical Survey in the Archaeological Site of It anos, Porolissum was probably an important town, giving its name
Sarris, A., Vafeidis, A., Mertikas, St., Guy, M. & Kalpaxis, Lasithi, G r e ece, Ist Balkan Geop hysical Congress, to the province.
0 50 100 150 2C>C 250 rn
Th., 1998, Remote Sensing Techniques & Computer Athens, Greece, 23-27 September 1996. -
..:;:j
At the moment when our study was made, the position of the
Applications for Archaeological Monument & Site fort on Pomat hill, an amphitheatre and a few non-important
civil buildings were known, but no trace of old constructions
Fig. I. The area of geophysical works, was visible in the area geophysically investigated, the ground
south of the Pomat hill Roman fort. beeing completely covered by the soil.

Geomorphologically, the studied area is a wide terrace The geological frames

slop ing
about 10 south-east. Its south limit is on the brim of
a st e ep
slope. In the Pomat area, sedimentary rocks of Oligocen age
outcrop. They consist esentially of clays with interbeddings
The archaeological frames of sandstones and conglomerates, overlayed by sandstones
and conglomerates with charbonatic cement. The upper part
The most ancient traces of habitation, known in the area of the geological pile is occupied by colluvial rocks of
c ome
from the Neolithic age. They include materials from the Quaternary age.

Proce
164 edings of
the 31" J11tematio11a/ Symposium on Archaeomell)', lerem, E. & T. Bir6, K. (eds.), Archaeopress -Archaeoli11gua. BAR- Centi: Ew: Sfl: I.
 Scurtu, E. F.
The geophysical image of a part of the ancient Roman town Porolisswn in Dacia

A The petrophysical background

/ '
'
-

/
.......

/ '
/ ' '
/ ,,.,. --- ', \ The petrophysical background of the geophysical survey at
I ,,..
---...

Porolissum is the high susceptibility (about 2000 emu) of

I /"' ', ',
"vi / .... ------ ' ' a ndhesites and microdi01ites in the area and the higher
II ' I /' .... , \ \
I ;01 <:::i / ,...----- , , \ , electrical resistivity of the sandstones and conglomerates as
I I ';'/ <:::, " , \ \ \
/ I I / \ I I I comprued with that of the colluvial sediments.
I I I I / <-3J,,... , "")- __/' II II I
__

I I '/' I
I /
I I I -" . --/ I Geophysical results
I I I "' /
I t ,,_,.,. II
I I
I, I"'--:"/ . I
I \ ' -- . t\ I The magnetic survey started with measurements on an area

I '---
'\ _,/,:
.. f "t\:)\:) '///}; l)fJI \.:,\'

,-!! l/i / '\\)
S
JI 111U I
\
........ _,/
/

/
/
/y
of 400x250 m, on a 20x5 m giid, with the aim of separating
areas of shallow magnetic sources from those of deep
magnetic sources.
" I
\,
.,-- ,
/
t!j
1\
I I\.

'],
/ ", I.,
.
/!/
. I
'.... -- ,,,,' The next step was to make a pilot survey in a very dense

"
grid (lx0.5 m) on an area about 100 m long and 20 m wide.
I\ I\
I . .____.- /
_,,./'/ <::;
. , . !;
\\ -.--"" // I
After data processing, filtering and graphical presentation, the
I
\ ' ........, .//' I / underground remains of the walls are quite visible, as we
/,,,
'--- =.:"-,,,.. : already concluded from the mathematical modelling made
\
,,.,,

..... ___ ,,,,.,.,,,,,,,.,.,,,,.

before the field work. They appear as NW-SE and NE-SW
alignements, parallel to the walls of the known Roman fort on
Pomat hill.
Once the possibilities of the method were confirmed, we
Fig. 3. Magnetic anomaly due to a vertical
slab
continued the survey on a larger area, of about 200 m by about
(in the northern hemisphere).
140 m, just south of the Pomat hill fort (Fig. 1).
pseudo-section (Scurtu The field data, corrected with the influence of the diurnal
profile g ive an image called resistivity
the changes of the variation, are shown in Fig. 4. On this map some trends are
1971) which shows, qualitati vely,
profile . visible (for instance in the squares AS, D5, D4, E4, F4, GS of
resistivity with depth, along the
quite the map}, which suggest the presence of constructions in its
The shape of the electrical image of an object is also
its actual shape. NW part and of a road changing in direction at 90 just south-
distorted as compar ed with

D E F G H J K
A B c

l
8
F. SCURTU

POROLlSSUM, 1996
I
I 7
'it I
m I
Q

21" 22 2,.
6
Fig. 2. Dacia in the first half of the 3rd century AD.

Volcni rocks (quartz-an dhes
ites and quartz-po h ritic
. Th magnetic method makes use of the property of some 5
nucrodontes), epresented
Sarmatlan age, pierce the sedim
by subvolcanic bo e
.
of matenals especially those contrumng iron or iron oxy des
entary rocks m some areas

(magnetite, hematite and others

.

(Stefan et al. 1986). Their mag ) of becoming magnetized in

3'fo
netite content is between
the agnetic field of the Earth
and 6.5%. Some of the bodies . . Quantitatively, this quality is
are of isometric sha e, like
expiessed by the magnetic susce t..
those from Magura hill, Citer ptibility of the material.
a hill, Pomat hill, b! some
The magnetic image of a body
dykes also outcrop south of Pom
at hill. does not fit at all on the
3 shows the magnetic image (in
actual shape of the body. Fig.
he volcanic rocks outcropping
in the proximity of the
anc ent ton were ce1tainly an
the orthem hemisphere) of
a vertical slab that can repres ent
impo rtant source of material
. .
for its c1v
for mstance a brick wall burie
d underground.
11Jan and military constructions
ior
.
is used especia11y
In archaeology magnetics

determining the p resence

Geophysical premises . . of campfires, kilns, h eart s,

h

bmldin s and objects in baked
clay, walls built up in 2
magnetic, volcanic rocks.

e alls of the known buildings
in the area are built up from
lly make use of the
. The ge electrical methods genera
an es1te blocks linked by mo1tar, . 20
they are about 70 cm wide
diffrence m electrical resisti e
and lay at about 50 cm depth. . vity of different material s. Th 1
Hence' the mam geophysi.cal
v ertical lectrical soundi ng a t t h e
met hod to be used for mapping the (YES) is based on the fact th
. ancient walls is ma etics 260
penetratwn depth of an electri e 180 200
cal current, injected into th 140 160
The geoelectncal ethod could give
the bottom of sedimetaiy deposits
r
information on the p th t f .
ound betwee n a prur of electrodes,
increases as the distanc e
A
60
8
80
C
100
D
120 E F G H J
of Quaternary age .
etween the two electrodes
increases. More VES along a
Fig. 4. Magnetic map of the surveyed area.

166
167
 /issum in Dacia
t of the ancient Roman town Poro
Scurtu, E. F.
The geophysical image of a par
objective
ological methods, this
Using classical archae
: ::;eo:o; but te map is _still rather confused. 6x6 m each (E4), just NW of the rounded
Part of the file (AB
in Fig. 1) of
vertical electrical sou
ults "".ere qua ntit ativ ely
ndings,
inter would take probably
dozens of years, wit
hout
large
tak
sur
ing into
face by
t, whose res truction on a very
Oflent
roac1,
account the land des

are c ear on this map because the image 1s clear enough to show even the
west-eas

roo ms ' _ it between the colluvial

p (the pilot survey) an
rse, arc haeolo
e

;: ;::
s
:n
: : s
e squares 13 and 14 and
. .
Some trends point to a kind of wall ms1de t
its signature is different to the external o
he big
e
rntran

o otn ed 7s
n
a ve th
e depths

and the
under
of the lim
lay ing sandstones and
conglomerates
s rocks in the
uncovering the bm ied
gical excavations on lim
constructions. Of cou
ited areas are necessary
, but the y must

es . It see us that the hard

and less po rou
be planned together by
the geophysicist and the
arc hae olo gist
half of the square 14 were no measured due to the presence of represent a wall in the underneath of the ma
6) is obvio wed water
m buildi
ng or jedi!D It
tion have a relief
wh ich allo
imum efficiency.
of the sec in order to ensure max

a compact thorn bush in that area. older wall destroyed and covered bY a new co

(fig p art plying of
ter correcting the map with the effects of the latitude ' of
.
alignement of pillars supporting a hypocaust
nst ruc tio
n r iower la tio n
in their dep
ressions, so the wa ter sup
um u n
de acc0 :: was possible
directly from und ergr ound by
Acknowledgement
s

:suiting :'alues were mathematically filtered to g:;

the opography and of the volcanic rocks of the b building floor. d{e 1ement . pth .
.
3. The NW wall of the large buildin desc . ed a
nb bov e I.
s
!be n of relatively
fountai

small (few meters) de
the County Museum
of History and
The author thanks to
t easy to eark in that image (Fig. S) tens of walls f
oq ent image of the ancient constructions. mterrupted somwhere in its middle (E7 7) to
ma ke plac e
Conclusions most part of the
f nia, for supporting the
a rosette of l S m diameter, consisting o seven p Art at Zalau, Rouma
o ss ible st an Foundation
w c ; entI; covered by soil, almost all of them pedestals around a central one As the 7 petals ro
sette is a
atue
ch at Porolissum,
south of the necessary financial exp
enses, and to Europe
si paper in Barcelona.

oriented NW E or -SW, parallel to the fort walls. which appears very often on all kind of monum gn eo physical resear for its aid to present the
. ents found. Th e g
, allowed us to pre sent evidence
io11owmg ones
The most evident features are the c the poro 1.issum area, it seems to be the town embl Ill on the Pomat hill
rt

1 . Two parallel walls, at about 7 m distance of e ch other,
. .
case this building including a representation of
e m. In I tha
flm an fo
number of ancien
t constructio ns, absolutely
References
the to a large ent ed in the
0 arly repres
. wn face but very cle
markig ?ut a Roman road climbing from SE (F2' E3), mblem may be
one of main importance fo r the . vis ible at the sur
town. 1lte rk. gli amfiteatrei in
the geophysical wo dagine demografica e
changmg its direction after about 70 m from the south border
. . .
image of the central pedestal of the rosette may be .
mte rpret ed age due to
spectacul ar res ult of this research is the
map Forni, G., 1976, L'in
-lSl.
of the map (E3'E4), contmumg about 80 m to NE and gettmg as a s1ope (stairs?) descending to the un derg The m ost tte r of Dacia, Apulum 13, 141
round c measurements. As
a ma arheologic daco
olis sum, un complex

out of our map (H6). The route is divided longitudina11y mto . m the magneti Gudea, N., 1989, Por
deduced fro
construction described above.
.

anc ien t tow n lui Roman

. . n of this zone of the de nord a lmperiu
a very precise pla roman la marginea

two equal parts (as It is v1S1ble especially in F2, but t races are 4. A construction of circular section a d small (about
2 m) fac t, it is al complex at
. . .
, . 17 centuries ago. Romanian archaeologic

also V1S1ble m F4 and GS). As the f:ort s gate porta principalis diameter, visible inside the road arch (F , seems to be o mans more than (Porolissum, a Daco-
also a left b y R on a limited
. rical me asu rements, made only of the Roman empire
), Acta Musei
dextra is also d1"v1"ded mto two parts' the westward one statue pedestal, or may be a fountain. The g eoelect inf ormation on the northern border

resting
lack of time, adds inte Porolissensis 13, 1-1
178.
reserved for the carts and the eastw ne fo r the pedst an,
.
S. Eastwards of the route a lot of bm1dmgs (some o em fth area due to the
a. ei (Atlas for the
structure of the are Pascu, S., 1983, Atlas
pentru istoria Romani
it seems that this route enters the by porta przncipahs "".1th rounded comers generally parallel to the route change of the geological of
. _ were obt ain ed by a judicious use Bucarest.
dextra. The archaeo1og1ca1 trench dug in F2 (the two parallel direct10n) and streets are visible. These results ing the history of Roumania),
stage (inc lud of resistivity
. ting with the project Computer calculation
alignements oriented NE-SW reflect the heaps of soil taken 6. Westwards of the road some othr build.ings are visible geop hysics, star Scurtu, E. F., 1971,
sic al signature of the ductor body,
ing of the geo phy a buried spherical con
out from the trench) have confirmed the geophysical image in (A7' A8, B7' B6' BS' CS)' but their walls direct1ons are mathematical model pseudo-sections of

h accuracy of the
. continuing with the hig g 20(3), 60S-62S.
the area. vable and generally different from NW-SE or NE-SW expected targets) and Geophysical Prospectin
processing of the , E., 1986,
.
2.
large building of 70x40 m (columns D-G ' rows 4-7), whic are characteristic fo r the east zone, much more field measurements,
with an appropriate
proper interpretation
of the final Stefan, A., Rusu, A.,
Bratosin, I. & Colios
in the link zone
field data and with the the alpine magmatites
mcludmg a smaller one' of 32x15 m, and three others of orgaruzed. Petrological study of
-Gutai-Tibles
geophysical data. Mountains and the Oas
between the Apuseni
absolutely non-destructive, uresti 70-71,
The geophysical research, Institutul Geologic Buc
volcanic chain, DdSS
st be exte nded to a larger area,
quick a n d reasonably cheap, mu town 242-262.
8
map of the entire ancient Roman
in order to draw the
ient Rom an
capital of the anc
Porolissum, probably the
province Dacia Porolissensis.
7

6
(.__,
2
:.../
... I"' I/
v i'
I\
5
v

4
' '
["...lu- 7 \ v" I/ .
4 6
'
I ' I/
\.
3
8

I 1'. i/ I
10 .....

2
12
\ IJ i

14
340 350 360
300 310 320 330

X (metri)
260 no 280 290
230 240 250
Ii (rnetri) J9Q 200 210 220
150 !GO 170 180
110 120 !JO 140
RO 90 100

. 1.
ng the AB profile in Fig
ermeable basement alo
Fig. 6. Relief of the imp
Fig. 5. Filtered map of the surveyed area.
169
168
 ENVIRONMEN TAL CH ANGE AND HUMAN ADAP TATION
IN THE C ARPATHIAN BASIN AT THE LATE
GLACIAL/POS T GLACIAL T RANSI TION

SUMEGI, P., 1 KERTESZ, R.2 & HERTELENDI, E. t3

'Department of Geology and Palaeonthology, University of Szeged, 6701 Szeged, P.O.B. 658, Hungary,
2Damjanich Museum, 5001 Szalnok, P.O.B. 128, Hungmy,
3Nuclear Research Institute of HAS, 4001 Debrecen, P.O.B. 51, Hungmy

ng climatic, bedrock and soil conditions from the viewpoint of early agriculture these conditions seem to form a
Consideri
. with in the Carpathian Basin which detennined the chances of the northern distribution of Early Neolithic Koros-Starcevo

1' it
u e o Balkan origin. We called this line, which during the Early Neolithic limited the northem distribution of Balkan type
r r f
olithization in
the Carpathian Basin, Central European-Balkan Agroecological Barrier (CEB AEB).

KEYWORDS: HOLOCENE, ENVIRONMEN T, CLIMATE, NEOLI THIZATION, AGROECOLOGICAL BARRIER.

Introduction Basin. According to archaeological data the first faimers of

the Carpathian Basin operated agro-ecosystems strongly

Different palaeoecological data indicate that a strong global reminiscent of those developed in the Near East. The Early

climatic change occurred at the late glacial/postglacial Neolithic cultures of the Cai-pathian Basin aie characterised
iransition, between approximately 12,000-9,000 years BP. by dense occupation along the river and creek system (Kosse

Climate change at the late glacial/postglacial transition resulted 1979). These alluvial environments were attractive to early
in a dra matic change in the ecosystem because the rapid and farmers because crops were cultivated by intensive
strong change in climate resulted in some rapid changes in the horticulture on hydromo1-phic soil (Sherratt 1980). Sheep,
environmental processes, such as landscape evolution, soil goat and emmer were their economic staples but these faunal
formation, plant succession and faunal migration (Roberts and floral elements lived on the borderline of their natural

1989). Thus, during a short transitional period from glacial to
interglacial conditions a new environmental situation de
veloped, and a new geological epoch started that is called the
Holocene. This new environment transformed the habitats of
the human populations and their physical and biological
environment, thus the potentials of the human communities'
economy changed again. As a result of these changes some
cultural modification began, and Mesolithic followed by
Neolithic cultures developed and spread out in many areas of
the world. The archaeological data show that one of the most
important and earliest agricultural centres formed in the Near
East approximately 10,000 years ago and moved up to the
Balkans finally reaching Northern Europe approximately
between 5000-4000 BP (Ammerman & Cavalli-Sforza 1971;
7.ohary & Hopf 1988).
Reg ional effects of this global climate change can also be
detected in the different palaeoecological sites of the
Carpathian Basin (Willis et al. 1995, 1997; Siimegi 1996;
Kordos 1977). This region (including Hungary) is an import
ant intermediate zone between the Balkan Peninsula and the
estem, eastern and northern parts of Europe. Thus it plays an
unportant role
in understanding the interactions of migration,
ettlem ent process, culture spread and environmental changes
Ill Europe.
Archaeological evidences suggest that the first farming
50
01l1Inunities developed in the Carpathian Basin from ca.
0 cal BC (Hertelendi et al. 1996). The earliest agricultural
unities belong to the Koros (including Transylvanian
Oros) and Starcevo cultures, long recognised as a part of the
B al a n Ea
1 k rly Neolithic complex (Kutzian 1947; Kalicz 1980,
983, 1990; Kalicz et al. 1998; Raczky 1988, 1989; W hittle
19 6). These two groups developed parallelly in the south-
9 and quaitermalacological analyses, wood anatomy, and radio
easte rn,
eastern and southwestern parts of the Carpathian
distribution area so they could survive only with human
protection (Bokonyi 1974).
To the north of this zone two groups of the Linear Pottery
Culture (LPC) formed (Kalicz & Makkay 1977; Kalicz 1983;
Makkay 1982) from 5500 cal BC (Hertelendi et al. 1996). The
economy of LPC was based on cereals but animal husbandry
switched from sheep and goat to the reliance on cattle and pig
whose wild progenitors were available for local domestication
in Southeast Europe (Bokonyi 1974). The Neolithic agro
ecological system had changed, too, when the first and local
groups of the Linear Pottery Culture developed in the
Carpathian Basin. These communities started using the
1979; Sherratt 1981,
loessic soil-vegetation ecosystem (Kosse
1982). One of the first LPC developed in the western part of
the Carpathian Basin. This branch of the LPC subsequently
spread fast through the central, western and northern parts of
Europe (Ammerman & Cavalli-Sforza 1971).
But why did the Balkan type of neolitization process stop
in the central part of the Carpathian Basin? Why did animal
husbandry, land use and culture change in this region? Were
there any settled Mesolithic communities ready to accept
farming as a way of life or was there a barrier? Archaeological
and palaeoecological data suggest a number of possible
explanations. Our investigation aims to find some answers to
these questions.
Methods
We collected samples from 25 Late Pleistocene/Holocene
sediment sequences of different palaeoecological and geo
aichaeological sites for sedimentological, geochemical, pollen
cai'bon dating (Ke1tesz et al. 1994; Nyilas & Siimegi 1992;

Proceedi
ngs of the 31" Jmernational Symposium on Archaeometry, Jerem, E. & T. Biro, K. (eds.). Archaeopress -Archaeolingua, BAR - Cellf1: Eiu: Se1: 1.
 ition
: at the late glacial/postglacial trans
1uan. basm
nge and human ada ptation in the Cmpat .
Siimegi, P., Kertesz, R. & Hertele11di, E. . ental cha
Enwrom

S i.imegi 1996; Willis 1997; Willis et al. 1995, 1998). Chron parkland in the central part of
the Carpa '
ology was obtained from 118 radiocarbon age detenninations. Koml6i 1987; Willis 1997; Willi
h
Basin (
\ ..
/-:.,)'
s et al. J
,., \: !

9
7 l
The radiocarbon dates were calibrated using the CALIB 3.0 The climate and vegetation chan
: 199 ,
ge could '
program (Stuiver & Reimer 1993) and then conve1ted to cal BC
h ave c
ch ange m soi 1 format10n processes au
.. and th e fi
ge in
naJ sta .

to enable comparison with archaeological data. According to trans1t10n process was the transfoi
mation of p
oiJ
od zoJ s
these radiocarbon-dated palaeoecological records we re brown earth (Willis et al. 1997). The
molluscan
. record .
constructed the vegetation, faunal, soil and environmental early post glaci al also indicate an s tn
inter mi
changes at the late glacial/postglacial transition and the early ecologically different faunas. There x re Of

. are characte .
YI
. nstt cau
Holocene environment with the human impact. glacial, cold-re sistant species and
ear]y p
For the archaeological interpretation, a review was made of thermophilous species. These highly ostglacf
. mi xed co
mmuni ti
published archaeological sites covering the time period from which southe astern European and es
Bore o-AJp .
t n monu
t h e Mesolithic to the Middle Neolithic within the Carpathian species lived together, h ave no mode
m analog
Basin (Barta 1980; Dumitrescu & Vulpe
..
among regio
u
1988; Kalicz 1990; compos1t10n of mollusc faunas varied
ns and I
&
.
Kalicz Makkay 1977; 1996; Makkay 1982;
Kertesz was very Slilll 1 ar to the reg10nal mosai
c vegetatio
n Patterns
.

Matskevol 1991; Pavilk 1980; Trogmayer 1968). We compare (Siimegi 1996).

recent distributions of vegetation, fauna! associations, recent After the late glacial/postglacial transitio
n, at about
climatic and soil zones and the development of Holocene years BP the warm-loving postglacial vegeta
900o
tion c
1auna and
Holocene soil types had .stabilised. On the
other h d h
fluvial systems with palaeoenvironmental records and the
. an , t e
.

distribution of Mesolithic, Early and Middle Neolithic sites. We .

reg10na I c1imatlc, vegetat10nal, fauna! and perha
ps soi] tyPe
analyse the impact of environmental limiting factors to the differences, which can be r econstructed by
pollen <Willi 1----

Neolithic agro-ecology (climate, vegetation and soil type), and 1997; '."illis et al. 1995, 1997) and malac olo
gical a
(Siimeg1 1996; Krolopp & Si.imegi 1995), continu
model the interfaces between the environment, society and

e d on
economy during the Early Holocene (Siimegi & Ke1tesz 1988). different regions of the Carpathian Basin. These
postglaci : ;
regional environme ntal differences are very simila
,

r to the
ppe-forest climatic zone,
. Hungary. CF - Temperate cl.1mat'ic zone, BS= Ste . e,.rr.
. atic JJec t
Results recent deviations in climate (Fig. 1), vegetation (Fig.
.. tic years 2. West European clim
2) and
F.ig. 1 Koppen's climatic
.,
ranean cz1ma
region s zn
JFe
soil type (Fig. 3), which characterize the Carpat hian
Boreal climatic zone, 1.
Basin of sub med iter
DF
,

enc
today (Siimegi & Kertesz 1998; Kertesz & Siimegi l999).
The equ
. JJ' et'. 4. Submontan climatic effect.
y c l'imattc e,Fre
The radiocarbon dated molluscan (Willis 1997; Siimegi :
3. Submed1ter . ranean
1996; Krolopp & Si.imegi 1995) and pollen data (Willis et al.
=

Changes in palaeoecological r ecords attributed to

1995, 1997) indicate that about 12,000 BP years ago the anthropogenic factors developed in two phases during the .
.

climate became progressively warmer and wetter in the
Carpathian Basin. This increase in both precipitation and
temperature have enabled transition from forest steppe to
broadleaved coniferous forest and ma ximum expansion of
coniferous forests. Within the boreal forest there were also
pockets of deciduous trees. Composition of coniferous forests
predominantly was composed of Picea and Pi1111s in the
eastern, P inus, P icea and Larix in the northeastern and Pinus
in the c e ntral parts of the Carpathian Basin (Willis 1997). The
combination of the acid litter of coniferous trees, and the cool
Early Holocene. The pollen and charcoal records of several
Hungarian sites show correspondences between some small
peaks of hazel pollen and microcharcoal (Willis 1997; Willis
et al. 1995, 19 97, 1998), which suggests that p eople may
have brought a bout the vegetation change before 6500 cal
l
BC. However, there is no archaeological evidence for
Neolithic occupation of the Carpathian Basin before this time
....
(Hertelendi et al. 1996; Chapman 1994; Whittle 1996).
Probably, these palaeoecological and archaeological data
indirectly show that the h-f-g peoples of the Mesolithic , ...

late glacial climate could have ensured that a podzol soil
develope d in some places of this region (Willis et al. 1997)
where the bedrock was acid. At the same time malacological
records indicate that there could have been areas where the
vegetation cover showed a mosaic pattern, although the
dominance of open habitat preferring mollusc declined. The
climatic and vegetation change resulted in the extinction of
the cryophilous mollusc in the central part of the Carpathian
period used fire for the alteration of the vegetation in this
region about 7000 cal BC. These results are consistent with
both the new and old archaeological data (Gabori 1956; Barta
1980; Kertesz et al. 1994; Kertesz 1996) as far as these data
have indicate the development of Mesolithic activities within
the Carpathian Basin at that time. Some e xcavated
ed
Mezolithic sites and finds are located close t o the ana lys
palaeo-ecological sequences (e.g. t h e Cuimesti II lith ic
Meso
or th e
site can be found c. 2 km SW of Batorliget marsh
1

Basin (so-called Pannonicum). These species started drawing .

te
2Q
m edi a
back from low sea level altitudinal places of the Pannonicum Mesolithic type harpoon finds of Sarret are in the im 3 --

to higher sea level altitudinal regions of the Carpathians. vicinity of the Sarret core-point). Thus ther e are som '3
1
an
Composition of the Late Pleistocene mollusc faunas suggest palaeoecological evidences for Mesolithic burning 5rz:I

a S
vegetation modification in the Carpathian Basin at 7
.

that some palaeoecological barriers developed in the 6

rutle
Carpathian Basin. BC. These data suggest that the Mesolithic cou 7

li fe, an
adapted to the transition of Neolithic agricultur e
8-
After the development of taiga environment the late
glacial/postglacial transition occurred between approxi they were in the substitution phase (Zve!ebil & Ro wley ,
. '

in. p1 = Pannonia stepe-f01

est,
mately 10,000-9000 years BP. With the climatic warnung in Conwy 1986) at that time. elements in the Carpathian Bas
Fig. 2. The distribution of vegetatio an faun al :
.
The palaeoecological data (Willis 1997; Willis et al. 1
995d n zan e,fl ora l Pontic Pom atia nvu are
the early postglacial decrease in taiga forest and increase in l . Earl Holocene distribution of the
line of Tilia toment
ean typ oak fore st, osa (sil ver lim e) ,.
3
ran
t
deciduous woodland occmTed in the Carpathian Basin. 1997) indicate small increase in c ereals, open groun15 T2 Thermophilous, submediter bou nda ry
); 5. Distribution of the thermophilous
ern
2. Distribution and bounda1y of the Panoman
=

step-fo
orth .
. /us0Querc1
.

Composition of the woodland varied a mong regions with .

herbaceous pollen types and decline m C01y
;
alk n type oak forest
. tn utw f the Central European oak forest; 7. Cro
.
4. Distribution of the Quercet
akeJ to as ci t o
occurred !Il
um fra met i ;
ssmg zane between
6.
Tilia Quercus!Corylus woodland in the eastern
followed by pollen concentration. Washed in soil e .
s of th
D1s
kfi01-est.s,. 8 Bounda1y line of
Carpathian Basin, Corylus!Quercus woodland in the northern sequences of the southern, central and eastern p art submediterranean type oak fore st, beech and boreal forests.
. . e en C entr a l E u1 ope an typ e oa
and western Carpathian Basin and an open U/mus/Quercus Great Hunganan Plam and of Transdanub ia
' b etw submediterranean and
173
172
 Siimegi, P., Kertesz, R.
& Hertelendi, E.
in the Carpathian basin at the late glacial/postglacial transition
Enviromental change and human adaptation

,_,;''
.,
j \

.. ... .
.

\. L
.'J l
1

\::

.; .
:
1
10
a

11 oO
2

Ill
cE'.2
.. ; . .j
L
IV
"" d
.. -
. .
. --: . ......,...
'1 ,....
Fig. 3. Distrib
ution of soil types in the
1. Distribution of the Carpathian Basin.
soil types which develo
ped on loess bedrock; Fig. 4. Central European and Balkan A groecological Barrier and the distribution
on san 2. Distribution of the
dy bed rock; 3. Distrib soil type which develop .
ution of the soil type wh ed .
of Mesolithic sites, green corn do rs and. the first tmces of human impact on the vegetation.
ich developed on com
pact bedrock . .
(volcanic, metam01phic I. Strong human impacts (burning, soil erosion) between 6 -6500 l BC 11 Strong human impacts (burnmg, soi1 erosion )

or limestone rock). '

6000-6500 cal BC. Sim

ilar change prevailed
between 5000-5500 cal BC; . III. Central European and an A g :
colo ic l Barrier (CEB AEB); JV. I ltration zones, nfi:
Low Mountain Reg
ion and northern par
in the Hungarian
The climatological, palaeo
climatological and pala
.
a) Mesolithic localities, . .r;
b) Mesora.hi parts of the mJ'
. .r; .
.
, ltration zanes, c) Neolithic parts of the
. infiltration zanes,
t of the Great eo .
, ltmtion zanes without known Neolithic sites.
Hungaiian Plain betwe ecological records sug d) The supposed Neolithic part oif t he mJ'
en 5000-5500 cal BC gest that an important
. The dominance climatic and
of some open habitat environmental change
preferring and thermo -line or zone developed
philous, SE in the central Discussion is in this case ' came to the northern marginal area of Southeast
European distributio part of the Carpathian
n molluscs (e.g. Gra Basin. North of this bou
naria frumentum) ndary the European (Balkan) environment. Besi des the factors
increased and some climate is characterized .
cold-resistant Boreo by oceanic influence to
-Alpin distribution the west while Palaeoenvironmental and recent climatological d ata sugest mentioned above at this level of agricultur and product10n
relict molluscs (e.g. continental influence .
Discus ruderatus) dec predominates in the eas sup mpo .
lined in a parallel t, eri sed that the Carpathian Basin has been situated at a meet ln pomt of experiences soil and hydrological condit10ns had most
with the changes of by Subcarpathian influen
woodland compositio ce overall this area. To
and lake ontogeny. Th
ese strong changes ind
n, soil formation
southwest of this marke
d climatic and environmen
the south and .
different ecological and climato1oo. meal zones . smce the
probably m ch greater effect on early agriculture. T erefore l
period of human imp
act started around the
icate that a new line submediterranean
tal boundary
climatic influence prevails. This
Pleistocene up to present day. From this ecological/palaeo-
.
early agriculture and movements of early agncu t ra
. .

analysed lakes and . .
ec ological point of view it follows that a mosaic-like envrr n popu1atlons were highly determined by these soil condit10ns
marshes. These results climatic influence is ?
are consistent with arc reflected in the distribu
haeological data tion of Balkan ment and some area-separating palaeoecological bmuers (F 3). Macroclimate zones were strongly modi fied by
which indicate Neolit type Quercetum frainett
i. 1 and local environmental factors (such as relief
hic activity within the o association (Fig. 2), whi occupies .
Carpathian Basin ch developed in the Carpathian Basin during the Late Quaternary. regiona
at that time (Kalicz the eastern part of the
& Makkay 1977; Kalicz Great Hungarian Plain,
and the northern .
1982; Raczky 1988, 198 1990; Makkay boundary of Tilia tom The palaeoecological and archaeo1ogica 1 data suggest that the conditions, bedrock, soil type, groundwater 1eve1' etc.) from the
9). The earlier date for entosa (silver lime) distri . . . . .
the detected bution. The .
ancient geographical distri .
utlon f Plants' animals' soil-types
b

viewpomt of the distribution of early agriculture. That is why
impacts on the Carpa pollen (Willis et al.
thian sample sites cor
respond with the
1995) and land sna il (Siimegi 1996) .
dated archaeological records (e.g. Early and cultures with economy-types could have been modified and the northern boundary of the distribution of Ear1y Holocene
evidence of Ear ly Ne Holocene distribution) of the Pontic .
at 6000-6500 cal BC
(Hertelendi et al. 199
olithic settlements
Pomatias rivulare indicate
that this thermophilous vegetati n
limited by palaeoenvironmental factors.
.
submediterranean climatic and environmental i

ences
.
d
of the first Ne olithic
6). The later date developed on the border According to the palaeoecological and archaeologicl data that of Early Neolithic culture of Mediterranean ongm comcie
human impact which zone of the mountain and alluvial
developed in the the most important palaeoecological barrier formed m the onl artly with each other. The best examples o this
Hungarian Low Mo plains dming the Early
Great Hungarian Pla
untain Region and nor
in, shows that there
thern pmt of the
vegetation type shows
Holocene. Thus, the distribution of this
that the submediterranean clim atic
central pait of the Carpathian Basin. There sems to mo fing effect of regional soil and hyological conditi. ons
could have been .
relationship between this palaeoenvironmental .
human settlement can be obseived m the Danube-Tisza
contact between the influence not only occurre line ad t
and the environment
Middle Neolithic col
al transition-line at
onization process
parts of the Carpathian
d in the southern and southw estern
Basin but also in the east
settling process of the Early Neolithic peoples m t e terfluve area and in the Nyfrseg where sandy beo.ck and
that time. Radio ern part of the Carpathian Basin. To the south, the southwest and east of t s sandy skeletal soil proved to be unsuitable for pracusmg the
carbon, palaeoecolog Great Hungaiian Plain .
ical data and archae during the Early Holocene . This line
ological evidences environmental transition-line submediterranean climatic, . earliest agriculture. Therefore, the suong submediterranean
show that the Early marks the northern
central part of the Ca
neolithization proces
rpathian Basin. These
s stopped in the
fauna and flora elements
boundary of the distribu
tion of Balk
within the Carpathian Basin. Climauc
fol ral and faunal influences developed. On the other hand, we
. .
climatic influence existing in the Danube-Tisza teii1uve
.
==
the mosaic pattern
of the environmenta
data indicate that
factors (the amount of
waimth during the growing season,
lllust be aware of the fact that in addition to climatic factors remained useless because soil and bedro.ck condi in appe
neolithization proces l factors, the together with the num the food producing economy is also i'nfluenced by . the limiting factors forming an ecological bamer for Early
settlements were inte
s and the distribution
rrelated in space and
of Early Neolithic
distribution of rainfall
ber of days with sun
during the season) play
shine an d the c haracter of soil, bedrock, hydrography and hydrological
.
eolithic agriculture. This can be considered as an agr -

time. ed an im portant conditions a rule which seems to be effective especially when
.
..... .,;er. Considering climatic, bedrock and sml
ecological b.,,..
role in the formation
of this line.
;
the earlies food producing groups migrated to new areas, that conditions from the viewpoint of early agnculture . these
174
175
 . late glacial/postglacial transition
. the Carpathian basin at the
twn in
Siimegi, P., Kertesz, R. & Hertelendi, E.
viromenta l change and human a dapta
En

Silmegi, P. & Kertesz, R., 1998'.

Palaeoecolog cal carcter
Acknowledgeme the Karas and Linear
conditions seem to form a limit within the Carpathian Basin Sett lemen t ecology of , - an ecological trap m the
nts 1979 .
istics of the Carpathian Basm
which determined the chances of the n01them distribution of oSSe' J(., y cu1tures 1n
o0ttei
'
Hung ary British Archeolog1c
al
Neolithic, Jaszkunsag 44, 144-

157, (in unganan).
.

r
,

, c. data base and

the Early Neolithic culture of Balkan origin. We called this line, This was supported by OTKA
research Oxford. Stuiver, M. & R eimer, P. J.,
1993, Extende
which during the Early Neolithic period limited the nmthem F-23129), FKFP (No. 502 and 2006 (F-Ol8Q5g Reports, & umegi, P., 1995, Palaeoecological recon- ram,
S I4C age calibration prog
f{!OloPP
) and For CAL IB 3.0
expansion of Balkan type neolithiz a tion in the Carpathian Prehistonc Archaeology of the Jaszs
. .
Studjes
ag Foun d . on the
,
of the Late Pleis
tocene, Based on Loess
revised
at ion. str11 ctl
on Rad ioca rbon 35, 215-230.
Basin, Central European-Balkan Agroe cological Banier (CEB
. .
K 1acofauna
Geolournal 26, 213 -22
2.
. ptfragen des Neolitikums
er
Trogmayer, 0 ., 1968 , Die Hau
in Hungarv
1n3
J,
AEB: Siimegi & Kertesz 1998).

t10nes

References
, eum E v-
1947 , The Koros
Culture, D1ss erta
Mora Fere nc Muz
an, I., Ungarischen Siidtiefebene,
l{utzl ae II, 23.
pannonic ' t1e
I kanyve, 11-19. . . .
Conclusion Amm erman,A. J. & Cavalli-Sforza L L.,197 M New results in the rese
arch 01
in the Neol1t/11c, Cambnd
ge
' 1, e J., 1982, Whittle, A ., 1996, Europe
tAakkHay,nga.nan Neolithic Akademiai
asur i apes t.
in Europ e, ng the
rate of spread of early fanning . Kiado, Bud
. University Press, Cambridge.
Man 6, t Ukraine, Kiev. cm
'

CEB AEB, determining the northern distribution of the 647-688. 11 L. G ., 199 1, Mes olith ic in Wes
act of Early Agriculture upon
the
tJa tskev o1 , Willis, K. J., 1997, The Imp
&
,

K0ros-Stareevo culture groups with Balkan contacts in the Ba1ta,J., 1980, Das Paliiolithikum und M . 1
Rus a Hungarian Landscape, in Cha
pman J. Dol ukha nov, P.
esolithikum Molluc fauna f
Carpathian Basin, existed only in the earliest Neolithic. The Sumegi, P., 1992, The Euro pe
Nyd. as,
S/ovenskd Archeol6gica 28, 119-13 , Central and East ern
6. . and m (eds .), Landscapes in Flux
expansion of populations having Mediterranean economic Bokonyi, S., 1974, History of domestic , gy at the end of the Pleistocene (Wurm 3)
mammals in Ce I Hort ob a in Antiquit y, Oxb ow Boo ks, Oxford.
and cultural roots became less intensive in the marginal zone nt a ene, P roce edin g of 10th
Internat iona l Mala-
& Toth,A., 1995: The Late
the Holoc
and Eastern Europe, Akademiai Kiad Brau n, M.
o, Budapes egi, P.,
.
. t. Willis, K. J., Siim ,
.
of the area where climatic and cultural influences of Balkan Chapman, J., 1994, The ong . ms of
farming in sou h Congress, 48 1-4 86. . History of Batorliget, N.E
t East o ological .
der Slowake1, Quaternary Environmental
Europe, P re'I11sto1re Europe,enne 6, 133-1
. . ranu k m
origin flourished, that is, during their northward movement , 1980 , Alte re Line arke y, Palaeoec olog y, Pala eo
56. pavuk, J., Hungary, Palaeoclimatolog
within the Carpathian Basin, and even stopped when they Dumitrescu, V. & Vulpe, A ., 1988 ol6gica 28, 7- 90 . . .
' Dacia 1nazu Slovenska Arche , . es , 7.
de
te geograph y 118, 25-4

,

kronl gza1
reached CEB AEB. W hat did it mean from the viewpoint of . 8, A Tisza-videk ultural1s egi, P. & Toth, A., 199 7, Does
1 is, K. J ., Braun ' M. ' Siim
dromihete, Bucuresti.
Raczky, .
P., 198
-versa'].
W'll
those autochthonous Mesolithic communities which lived to Gabori,M.,
kapcsolata1 a B
a neolltzkum,
1956, Mesolitsche Funde a lkdnnal es az Egeikummal n chan ge or vice
von soil change cause vegetatio
g
, Szo dli et

the north of CEB AEB? Archaeol6giai Ertesftff 83, 177-182. Szolnok. Hungary, Ecology 78,
rezkor idffszaktiban, A temporal perspective from
,

.y a d
1. Human groups, possessing inn ov ations from the Early Hertele di, E., Kalicz, N., Raczky, P., Hor vath, logi cal F ramework of t h.e Earl
F., Vere s, E., Raez P., 1989, Chr
ono
740-750.
n, M., Bennett, K. D . & o
, , 10n, Vana
I. & Bartosiewicz' L ., 199 Tisz a Reg T'th,
Willis, K. J., Siimegi, P., Brau
Neolithic food producing economy had came close to Svmgor, E., Futo, ic in the
6, Re.. ddle Neolith
them, thus creating possibility for acculturation. evolution of the Neolithic in eastern Hungar 2, 233 -251. Hun gary : who,
A., 1998, Prehistoric land degradat
y based on Archaeologica Hu nga rica . ion in
. ory,
e. An Env ironmental Hist
Roberts, N. 1989, T
2. Because of the depletion of po ss ibili ties to practise c alibrated rad10carbon dates, Radiocarbon he Hol ocen 101-113.
37, 239-241 how and why ? Antiquity 72, .
Jara i Koml od i, M., 1987, Postglacial climate and
,

Balkan type agriculture in the area, Early Neolithic .

Vegetatio Blackwell Press, Oxford . . Zohary,D & H op f ' M. 1988, Dom esti cation of plants ll1 the Old

-

al '
History in Hungary, in Kordos, L. & Pecsi, and seasonality m early cere West
M. (eds.),
groups were unable to occupy the lands north of the er soil of cultivated plants m
Sherratt,A ., 1980 , Wat World: the origin and spread
barrier. Thus, Mesolithic communities gained time to ology 11, 3 13- 330 . Press, Oxfo rd.
'

Holocene environment in Hungwy, 37-47, Geogra cultivation, Wor ld Archae Valley, Calderon
accept technical innovations wit hou t being absorbed Institute, Budapest.
phic al
Sherratt, A., 1981, Plou gh and
.
pastoralism: aspects of the
Asia, Europe, and the Nile
Zvelebile, M. & Rowley-
Con wy, P., 1 :
86, Fora gers an
either culturally or economically or demographically Kalicz,N., 1980, Neuere Forschungen ilber die Entstehu secondary products revolutio
n, in Hodder, I., Hanunond, ._)
pe, in Zveleb1l, M: (ed , Hun
te1 s
ng farmers in Atla ntic Euro
erns of the Past, 261 -30
5,
N. & Isaac, G. (eds .), Patt
into communities of Balkan origin . CEB AEB seems to des Neolithikums in Ungarn, in Kozlowsky, J. K. & bridge Um vers 1ty Pres s,
. in Transition, 67- 93, Cam
Machnik, J. (eds.), Problemes de la neolithisation dans Cambndge.
play a fundamental role in the formation of the Neolithic Cambridge University Pres s, Cambridge.
of Neolithic and Copper
Sherratt,A ., 198 2 , The
culture with a completely new, different character, certaines de l'EU1vpe, 97-122. deve lopm ent
Hungarian Plai. n. part 1 : Th
e
adapting to local conditions, n01th of this banier. Kalicz, N., 1983, Die Koros-Starcevo-Kulturen und ihre Age settlement in the Great
l,
3. Those Mesolithic communities whic h lived to the south Beziehungen zur Linearbandkeramik, Nachrichten aus regional setting, Oxford Journ
al of Arch aeol ogy

of CEB AEB had absorbed both culturally and Niedersachsens Urgeschichte 52, 91-130. 287-3 16. .
the neolithization process of eoecolog1ca l R econ-
. p. 1996 , Comparative Pala .
.
demographically into Kalicz,N., 1990, Friihneolithische Siedlungsfunde aus S.umeg1,
at10n of NE Hungari
Mediterranean type, except those places where the Siidwestungarn, Akademiai K iado, Budapest. struction and Stratigraphical Valu
& Makkay, J.,1977, Die Linienbandkeramik in der Manuscript, Budapest (m
possibility for isolation was given for sometime (e.g. in Kalicz, N. Loess Region, PhD Thesis,
the Iron Gate area). Grossen Ungarischen Tiefebene, Akademiai Kiad6, Hungarian).
4. CEB AEB existed only in the Early Neolithic since Budapest.
during the period after the formation of the Linear Kalicz, N., M. V irag, Zs. & T. Biro K., 1998, The Northern
Pottery Complex the neolithization process to the north Periphery of the Early Neolithic Starcevo-Culture in
of CEB AEB produced cultural groups of not Balkan South-Western Hungary,A Case Study of an Excavation
type but of local autochthonous character. Their plant at Lake Balaton, Documenta Praehistorica 25,
and animal stock, production experiences were adapted 151-187.
to local conditions therefore from ecological point of Kertesz, R., 1996, The Mesolithic in the Great Hungarian
view this agroecological limit did not mean a banier for Plain: A survey of the evidence, in Talas, L. (ed.), At the
them. fringes of three worlds, 5-34. Szolnok, Damjan ich
5. Considering the importance of not only climatic, Museum Press.
bedrock and soil conditions in the Carpathian Basin Kertesz, R.,Siimegi,P., Kozak, M., Braun, M.,Felegyhazi,E.
during the process of neol ithization but also & Hertelendi, E., 1994, Archeological and Paleo
hydrographic conditions, it s eems that within the ecological study of an Early Holocene settlement in the
Carpathian Basin neolithization process took place along Jaszsag Area, Acta Geographica, Geologica et
the rivers, the so-called "green corridors". We consider Meteoro/ogica Debrecina 32, 5-49.
green corridors to the south of CEB AEB as Neolithic Kertesz, R. & Siimegi, P., 1999, Theories, critiques and a
infiltration zone, while those to t he north of this banier model: why did the expansion of the Koros-Starc evo
as Mesolithic infiltration zone. Archaeological data and culture stop in the centre of the Carpathian Basin ,
palaeoecological records suggest that the Neolithic Tisicum 11, 9-22. (in Hungarian).
acculturation process of the Carpathian Basin took place Kordos, L., 1977, Changes in the Holocene clim ate of
in these infiltration zones between approximately Hungary reflected by the "vole-thermometer" method.
6500-5500 cal BC. FO/drajzi Kazlemenyek 25, 222-228.

177
176
 5. Experimental Archaeology

ANCIEN T PINE TAR TECHNOLOGY: CORRELATIONS

BETWEEN M ANUFAC TURING ME THODS AND COMPOSI TION

sCK, c. w.,1 STOUT, E. C.,1 LEE, K.,1 TODTENHAUPT, D.2 & KURZWEIL, A.2

IAmber Research Laboratory, Department of Chemistry, Vassar College, Poughkeepsie, New York 12604, USA,
2Arbeitsgruppe Teerschwele, Museumsdoif Diippel, 14163 Berlin, Germany

Among the pre- and protohistoric methods of manufacturing pine tars in Central Europe are the Meile1; in which an earth
stack of wood is partly burned and partly pyrolyzed, and the double-pot method, in which wood chips in a perforated
covered
vessel are pyrolyzed by external heat while tar is collected in a second vessel below. Experimental tars made by both
ce ramie
been analyzed by NMR spectrometry and their individual constituents have been determined quantitatively by
e thod s have
c-MS in o rder to correlate the composition with the manufacturing method. Both techniques reveal differences in composition

that distinguish between the two manufacturing methods and that indicate that the double-pot method involves higher
es than the Meiler method. Allowing for depositional degradation of archaeological tars, the data can be applied to
temperatur
the ide ntific ation of prehistoric manufacturing methods.

KEYWORDS: ANCIENT PINE TARS, MANUFACT URING METHODS,

NUCLE AR MAGNETIC RESONANCE SPECTROMETRY, GAS CHROMATOGRAPHY, MASS SPECTOMETRY.

Introduction
The composition of archaeological tars and pitches reflects
the raw materials from which they were made and the
tech nology by which they were made, a relationship that may
be obscured by compositional changes suffered during their
long deposition in a terrestrial or marine environment
(Reunanen et al. 1990). We have shown earlier that tars made
from resinous wood and from bled resin can be readily
distinguished by the presence of resin acid methyl esters in
the former, and that the manufacturing temperature can be
estimated both from the degree of decarboxylation and from
the concentrations of individual resin acids and their
degradation products (Beck et al. 1998). We now report an
experimental study in which two pine wood tars, made by two
different methods, are compared by means of nuclear
magnetic resonance (NMR) spectrometry and by principal
component analysis using gas chromatography - mass
spectrometry (GC-MS).
Central European pine wood
tar technology
Early tars were made in prehistoric times by two distinct
met hods. In the older, pre-ceramic method, a pile of wood is
covered with eai.th and ignited. By controlling the access of air,
some of the wood can be made to bum and provide heat, while
the remainder is charred, producing both charcoal and tar. As
a means of
producing chai.-coal, this technology was essential
to metallurgy, but it was practiced long before the metal ages
for the manufacture of tar and pitch, which were needed for
ha fting, caulking and lubrication (Todtenhaupt & Kurzweil
991, 1993). Since the English term for this system is
charcoal pile' which wrongly suggests only one purpose, and
the wrong one at that, we will use
the German 'Meile1teer' for
tar m ade
by this method (Fig. 1). T he Meilerteer used in this
Work was made at the Museumsdorf Dilppel.
In the second method a ceramic pot is buried at the bottom
of a con ical pit, a second pot with a perforated bottom is
Placed on top of it, charged with wood chips, and covered
with a tight-fitting lid. A fire is lit in the space surrounding the
upper pot, so that the charge is heated externally and the tar
drips into the lower pot. T his small-scale production method
has been more fully described elsewhere (Kurzweil &
Todtenhaupt 1990, 1991). For the sake of consistency, we will
use the German term 'Doppeltopfteer' for tar made by this
double-pot method (Fig. 2). T he Doppeltopfteer used in this
study was made at the Museumsdorf Dtippel.
Analysis by 13C Nuclear Magnetic
Resonance spectrometry
We have shown elsewhere that quantitative information
about the degree of decarboxylation and aromatization of pine
wood tars can be obtained conveniently by a single CMR
spectrum, provided that a sufficiently large relaxation time
(20 seconds) between pulses is programmed (Beck et al.
1998). CMR data of the two tars, run on a Bruker Model
AC300 NMR spectrometer equipped with a Bruker Q and P
probe, are given in Table 1. Comparing the Meilerteer to the
Doppeltopfteer, there is no significant change in the degree of
decarboxylation, but a doubling of the resin esters at the
expense of the resin acids. In addition, the percentage of
unsaturated, i.e. olefinic and aromatic carbon atoms has
substantially increased. Both of these changes indicate a
higher operating temperature for the Doppeltopfteer.
Carbon Meiler Doppeltopf
COOH 2.14% 1.88%
COO Me 0.32% 0.63%
sp2(unsaturated) 31. 15 % 38.42 %
sp3(saturated) 65.49 % 57.21 %
Table 1. Carbon NMR data.

Proceedi
ngs of the 31" International Symposium 011 Archaeometry, le rem, E. & T. Biro, K. (eds.), Archaeopress -Archaeolingua, BAR - Cenfl: Eu1: Sei: I.
 Beck, C. W., Stout, E. C., Lee, K., Todte11/w11pt, D. & Kurzwei/, A.
Ancient pine tar technology: corellations between manufacturing methods and composition

a. Monote1penes (Fig. c. Diterpenoid hydrocarbons (Fig. 5)

principal component analysis 3) b. phenols (Fig. 4)
by GC-MS
. lguaiacol, are The diterpenoid hydrocarbons result from the thermal
Of the seven monoterpenes were found m o phenols, guaiacol and 4-methy
. . th e ei
M 1e nlY tw of 0.6%. The decarboxylation, aromatization, and loss of angular methyl
compositional data were obtained by gas five survive m the Doppeltopftee r most neer , O Meilerteer, at a total concent ration
Detailed . , at much 1 e t in al. groups of diterpene resin acids. All but one of them have been
ra phy - mass spetrometry (GC-MS). Samples of .
concentrat10ns. -pmene and terpinolene . 0wer pre ls a re decomposition products of lignin (Kratzl et

atog With exo
ch rom . . documented in archaeological pine tars (Evershed et al. 1985;
double bonds, disappear completely they ar . cychc a, 1991 b ), though guaiacol itself has
dissolved m diethyl ether and methylated with gu . faix et al. 1991

a w
th t rs
e re
e Isome
;ed to

;
19 'b n identified in the pyrolysate of pure cellulos
e Robinson et al. 1987; Reunanen et al. 1990; Beck & Borromeo
the theodynamically more stable a-pinene
az om e
th an
Mod
e.
el
The
5995
GCIMS
equipped
instrument used was a Hewlett
with a Model 9153C work respectively. The total monote rpene content
and li
decreases al
nene, so e e
torova
1997). They persist in archaeo logical tars: Lange 1990), in Etruscan wine flavored with pine resin (Hostetter et
pack"'
d . most found 4-methylguiacol and an unidentified ethyl
al. 1993), in deep-sea sediments (Simoneit 1977), in atmos
d a 1 5 m x 0.25 mm capillary column w ith a two-thirds from 7.1% to 2.6%. The appearance (P;3)
an of the o pheric aerosols (Simoneit & Mazurek 1982), and in amber
station terpene degradation product l-ethyl-4-meth
m no. (l acol in the tar of a Medieval shipwreck. The Doppel
al'Y phase of RSL-150 poly(dimethylsiloxane). Injection
station Y1eyelohexan (Botta et al. 1982; Mills et al. 1984/85; Czechowski et al.
re was 250C, mass analyzer 180C, source suggests the first step of the pyrolytic destr uc gu eer contains five guaiacols, at a total concentration of

temperatu tion of t e toP 1996). However, fichtelite, which requires reducing conditions
po rt monoterpenes that would be expected at higher
he
n1. This three-f old increase
is in complete accord with
l 72C. The initial oven temperature of 50C was
l 9 -10.
ratur e . t em peratures
tem pe .
.
Surpnsmg, however, 1s the presence of two terpin 1 uthenberg et al. (1996), who have shown that the for its formation, has so far been found only in fossil conifer
d at th e rate of 5C/minute to 250 C and then held ' ults of R
rampe . sm b .
sis produc ts increases with the wood (Bromeis 1841), in Tasmanian retinite (Douglas &
mentat10n was by electron impact at 70 eV. the Mei1e1teer and, at insigni ficantly lower conce nt ncentrations
of lignin pyroly
consta
nt. F rag
the Doppeltopfteer, because these te1tiary alcohols ar
rati ons ' in : rature. A s all amoun t (0.3%) of an add Grantham 1974), and in peat pyrolysates (Kumari 1990). All
icatio n of the components relied on the 6th edition of the . e so p rone operating tempe .
Identif m the Doppelto pfteer, tentatively these earlier studies have been useful in establishing the
l databas of McLafferty & Stauffer (1997), on to dehydration that they do not yield molecular 10ns . 'tlonal phe
nolic compound
pectr m therr
mass s .
mass spectra. Apart from thi s unexplained anomaly th as l,2-dimethoxy-4-(1-propenyl)-benzene, is not
structures of these hydrocarbons. Since there is no agreement
the lit erature 1t
d, a d on our own collection of mass e amounts :dentified
data in and structures of surviving monoterpenes clearly ind
on the order of elution of the two compounds, the distinction
wn in Fig. 4.

. Isom ers are distmgmshed by relative retention times. icate a sho

spect ra .
rmtat10ns pro hib . the presentation of the mass
It hi gher operatmg temperature in the Doppeltopf method.
S ace 1i
p
al evidence here; they may be accessed at the ARL Web
sp ect r
show the structures and percentages of the
Site. figs. 3-6
ically most use! components. Because the ion Meiler Doppeltopt
diag n ost
of com pounds of different structure vary widely, the
yields
te acc uracy of the percentages is low. However, since 2.1 % 0.5%
ab solu .
as well as the earlier temperature correlations
aii sam
ples u-pinene

a n the same. types of constituents and were run under

cont i
iden ti
ternPe
cal con
ratures
dit10ns, th ey reflect the relative operatin g
accurately.
0.7%

-pinene

0.4%

'
1-ethyl-4-methyl-cyclohexane

2.3% 0.7%

arene

6A. limonene
0.8% 0.3%

Fig. 1. "Grubenmeiler" method. 0.3%

Xi erpinolene II
II

Q, 04% 0.3%

4-terpineol

0.4%

Fig. 2. "Doppeltopf' method. Fig. 3. Monote1penes.

180
 hod s and composition
ween man ufa ctur ing met
nology: corellations bet
Ancient pine t ar tech
Beck' C W" St out' E C" Lee, K., Todtenhaupt, D. & Kurzweil, A.

ts
Acknowledgemen
between the epimerc .
i 18- and 19-norab1eta-8,l
Summary
l , l3-trienes is nothe pathway by which both palustrate an d ne ledge financial
. ?abieta te ar s gratefully acknow
based on Simoneit's (1977) bserval!on isomenzd to abietate (Takeda et al. 1968) e nces between The American author
that the ratio of the
re are distinct differe National Science
ch th e n,
' h data show that the by the United States
ions m/z 256 and m/z =
21 is .
lower for the 18-nor-isomer. gether with the abietate already present, : to.
show that supp01t of this work
be o f. e NMR spectra alone ogy) and of the
=

.

s th e s
R-96-00254, Anthropol
'
As shown in Fig. 5' the SIX Id ent1fied . o urce b y the two methods. Foundation (Grant SB
hydrocarbons and three of the substantially increased amounts of deh ma de ile1teer by a College. This
. droabie t tars uished fro m the Me oratory (ARL) by Vas sar
more that could be only c teg onc ally . Y at p fte er can be disting Amber Research Lab
(from 19.3 to 28.3 %). As we have sho wn earlier (B lto their
classified (one of them eek et e e n of resin acids to
may actually be an este1) together compnse . al p pp
o in cre ase in the conversio rep ort is ARL Pub lica
tion No. 137.
9.6% of the 1999), methyl abietate is the only resi'n aci d that su l d rat ion.
rvive s a iwo fo increase in unsatu
Doppeltopfteer . Only three of t he . t esters and by a nearly 25%
(mcluding the suspected hi gh temperatures. The appearance of the deg h
t yl of the chane that
s
ester) are found in the Me1']erte er, with a
rad ation more detailed pictre References
total concentral!on of

products 17-nordehydroabi etate and abiet ' a-8 11 data give a ile1teer.
r relative to the Me
13,15.
-MS
.
2.0%. The concentration of the uIl!mate degradation . . ze the Doppeltopftee
tetraenoate m the Doppeltopfteer is consonant with a . teri t and the

product of barac nature and fate

'

' higher monoterpenes are los inans, R. E., 1991, The

resins acids retene is thre e t'1mes Jar er m
' the Doppeltopfteer .
.
temperature, as is the complete disap Afiu s t two-thirds of the phenols Anderson, K. B. & W
operntmg ' peara nc e f o re stable isomers; the geosph ere . I. Evaluation of
than it is in the Meilerteer. This is . o
de r isomerized to mo of natural resins in
m complete accord with three oxidized abietate derivatives which would e her n arbons ctrometry for
fo a mai ; diterpenoid hydroc atography - ma ss spe
earlier studies that related the d egree of decarboxyl . be
se m ore than threefold pyrolysis - gas chrom
ation and readily dehydrated or may n ever have been n ned m . cre a ount, retene alone es, Anal. Chem.
the ul in number and in am l res ins and res init
the concentration of sp ec1' fc degrad .
: more plentif the ana lys is of nat ura
i atwn products to the completely sealed and hence anaerobic Do I o f s ste . beco me diterpenoid
m s in fatty acids and
threefold; change 63, 2901-2908.
operating temperature of 1ar manufacture (Be
i: sing
ck et aI . 1998). The conversions of the resin acids i jncr ea t; primary cient pine pitch:
. P 1mara ne ma y not be significan rromeo, C., 1990, An
It is worth noting that all the h . des are minimal and Bec k, C. W. & Bo
ydrocarbons found have the skeleton are Jess obvious. Pimarate, sandaracopimar ate , and aJde yb ation to istic shipwreck,
in addition to degrad ctives from a He llen
carbon skeleton of abietic ac1 d ' . . . aci d generally decrease: technological perspe
10sop1marate all decrease in the D oppeI topfteer' while resi n
suffer rin g cleavage
and 7, 51-58.
hydrocarbons, the y ers Sci. Arc hae ol.
. . MASCA Research Pap
1. and isopimara-8,15-dienoates actually mcrease, diterp eno id
ietic aci d, Analysis of
ara resin acid, dehydroab D. R. & Stout, E. C., 199 4,
d. Fatty acids .
nve rsio n to the most stable Th e Beck, C. W., Stewart,
md1catmg that they are i ntermediate step m a pathway co . Can n, A.
ses by almost 50% Late Roman Shi p, in Mc
se con centration increa Na val Sto res fro m the
whose fi nal products, at much higher temP ratures, are not who ws A Lat e
the two tars clearly sho Arc hae olo gy,
: of the composition of De ep Wa ter
.
Fatty acids have not be en recogniz d as constituents yet understood. comparison ature M. & Fre ed, J. (ed s.), Ro ute
of pine osed to a higher temper thage and an An cie nt Tra de
. . . ppeltopfteer wa s exp Ro ma n Shi p fro m Car
tars. Small amounts of pa1nul!c acid m
a pme-resm-based tar that the Do l of Rom an
No rth we st Sicily, Jou rna
e1teer. near Ske rki Bank off
from a Late Roman shi pwreck have b
een heId to be a than the Meil . 13, An n Arb or,
mentary Series No
contaminant (Beck et al. 1994) Ruthenberg et al.
(1996) have
Meiler Doppeltopf Archaeology, Supple
. '.
found that palmitic acid m bIrch bark tar decreases with Ml, 109-121.
0.4% Meiler Doppeltopf A., 1998, The
. E. C. & Jaime, P.
mcreasing temperature It is th erefore surpnsmg
Beck, C. W., Stout,

that both the
e Tar and Pitc h inferred from
Meilerteer and the Doppeltopfteer co
. 0.4% Pyrotechnology of Pin
ntam phy - Mass
methyl 9-(3-isopropyllphenyl)-2,6-dimethyl-
s1grnficant om ato gra
. by Gas Chr
amounts of the unsaturated linoIe1c and ol ' 6(Z)-nonenoate
Quantitative Analyses
eic ac1ds, and that r Ma gne tic Resonance
. . bon-13 Nuclea
the concentration of both acids mcreases slightly with etate Spectrometry and Car
methyl 17-nor-dehydroabi
Pio trow ski , W. (eds.),
ezinski, W. &
Spectrometry, in Brz
0.3 % 0.6%
increasing temperature.
al Sym pos ium on Wood
t Internation
Proceedings of the Firs
COOCl-1:1 y 1-4 , 199 3, National
in, Poland, Jul
e. Dite1pene aldehyde methyl 9-(isopropylphenyl)-2,6-dimethyl- Tar and Pitch, Biskup
181 -19 0.
m, Warsaw, pp.
6(E)-nonenate Archaelogical Museu
& Pur ohi t, V.,
. . methyl isopimarate
ut, E. C., Bingham, J., Lucas, J.
Resin acid aldehydes are nmary consl!tuents
P of conifer Beck, C. W., Sto ies, Ancient
log
.
. .
resins . The aldehyde of p1ma nc acid w
. .
with a slight, but probably not s1grn
.
as f oun d m both tars,
. .
ficant, mcrease with
0.9% 1.7%

ff 9.4% 40%
1999, Central Europ
Biomolecules 2, 281
ean pine tar
-293.
tec hno

io, M., 1982,

:""
. .
gel is, F., Nicoletti, R. & Tricar
mcreasmg temperature. Botta, M., De An s of amber,
alysis in the gen esi
methyl palustrate The role of acid cat
f Resin acids (Figs. 6a and 6b) P hytochemistry 21,
381-384.
n Liebigs 37,
1, Ub er den Fichtelit, Annale
1.0% Bro me is, C., 184
The identifci ation of 15 resm .
acids,
28.4%
304-306.
many of which are hanbinski, M. ,
oneit, B. R. T., Sac
closely related isomers o r even stereo
m ers, rests on their
methyl levopimarate Czechowski, F., Sim chemical
iec, S., 199 6, Phy sico
reIat1ve retention times as well as t .
heir m ass spectra. Both are
methyl dehydro-abietate Chojcan, J. & Wolow osits in
s fro m dep
.

. zation of am ber
based on the literature cited above . .
m the secl!on of
1.8% structural characteri
0.8% -83 4 .
. em. 11, 811
deterpenoid hydrocarbons o ublished & Poland, Appl. Geoch
work by Zinke! et al. gerprint gas
I, Gra nth am, P. J., 1 974, Fin
(1971) and by Anderson mans (1991), and on our own Do uglas, A. G. &
ive bitumens,
e nat

u-
methyl isopimara-8, 15-dien-18-oate
analysis of som
mass spectral files. chromatography in the organic
, anc es on
substances Adv
There are dramatic changes in the .
kinds and amounts of asphalts and related
. 10.5% 7.7% Paris, 261-276.
diterpene resin acids in the t tars. The total decreases from Geochemistry 1973,
ier, D., 199la,
I., Bremer, J. & Me
.

85.6% in the Meilerteer to 7 Faix, 0., Fortmann,
% m the Doppeltopfteer. That

products of wo od. Ga s chromato

Thermal degradation
methyl pimarate
decrease of 8.4% is rough!y eq al to the increase
of 7.6% in tric character
and mass spectrome
the decarboxylated dit erpeno 1d hydr . graphic separation
ocarbons discussed d pro duc ts, Holz Ro h
. 1.6% aride derive
ization of polysacch
1.9%
above. More detailed informal!on about
the effect of higher

9.
temperatures can be derived from the changes Werkstoff 49, 213-21
in individual D., 199lb,
Bremer, J. & Me ier,
resin acids. The ring cleav g pro ducts
' Faix, 0., For tma nn, I.,
, which increase both collection of
pro ducts of wood. A
: methyl sandaracopimarate
in number and amount in t Thermal degradation
opp ltopfteer, are known to be polysaccharide
) mass spectra of
de1ived from levopimarates y bas1c yrolysis electron-impact (El
(Takeda et al. 299-304.
lz Ro h-Werkstoff 49,
\ p 0.5%
1969). The intem1ediate role o f levop1m ' 0.3% 3 oxy-abietic acid 4.0% derived products, Ho
3, A Bronze

anc ac1d is supported
--- - -------------------------------

rt, D., 199

C. W. & Stewa
Hostetter, E., Beck,
deriva1ives
by the fact that the amount of thi '
s co pound actually doubles bba : Ch em ica l evidence
, Valle Tre
.
in the Doppeltopfteer This mcrease methyl pimara-8, 15-dien-18-oate 77.2% situla fro m Tomb 128
' m tum, must come at the Total 85.6% (Serie Ill) 59,
Spina, Stud. Etrusc.
'
expense of palustrate and n eoabietate of resinated wine at
' both 0f whi ch decrease
sub stantially. The pathway will be p lustrate . 211-225 (publ. 1994).
+ neoab1etate ->
Fig. 6b. Resin acids.
levopimarate -> seco- + b'1s-seco-ab1etates. There
is however Fig. 6a. Resin acids.
183

182
 Beck, c. II', Stout, E. C., Lee, K., Todtenhaupt, D. & Kurz.weil, A.

. p., 1990, Chemical analysis of filtrate and Ruthenberg, K., Stout, E. C.

& Beck C
W. 19
J{l1J1lafldensate fro m wet-carboniz ed peat by GCMS, /111. J. technology of birch bark tar
manuf'actu 96 EXPERIMENTAL CASTING OF COPPER
'rL

re pr ae
c0 l Geology 1 5 ,
,

th e 30th International Sym esen te

'

6 3-69. posium o
coo n d

at AND BRONZES IN SAND MOULDS
J{., Czepel, H. & Gratz!, J., 1965, Gaschromato Urana, IL. Archaeornet
. ry
.11atzl, 111 sche Studi. en zur Pyrolyse des Lignins, Holz Roh S1mone1t, B. R. T., 1977, Diterpenoi ,
raP . d com pou ECCLESTON, M. & OTTAWAY, B. S.

rv I.1p1'd s m deep-sea sediments

n ds
g rkstoff 23, 237-240. and the.1r
an d
O ther
A & odtenhaupt,
Wejl, D., 1990, Das Doppeltopf . 'fi canc e, Geochim. Cosmochi
s1grn geo che
m. A ct 4 lllica] Department of Archaeology and Prehistory,
J{vrz:rfahren -

.

em e rekonstruierte mittelalterl ich M et ode Simoneit, B. R. T. & Mazurek,
M. A., 1982 o
ga c m
463-47
6. University of S heffield, Northgate House, West Street, Sheffield SJ 4ET, UK.
. f"lolzte ergewmnung, Experimente/le Arclwolog1 e 1111 the troposhphere - II. Natural atter of
. . . backgrou
' nd
of bio' .
: ,seu ms doif Diippel, Oldenburg, Staatliches Museum lipid matter m aerosols over
. .
the rural Wi
estern u .
gelllc
"!' rkunde und Vorgeschichte in Oldenburg. S !ates, A tmosp h enc Envuvn lllted
Natu
fll ment 16, 2139
_ 2159 r[he a bsence of mo ulds in the archaeolo gical record of the earliest metal using periods in Euope has. led to the suggestion
vie1'
.1 A &Todtenhaupt, D ., 1991, Technologie der
Truced , H. 1 chulle , VY_ H. & Lawrence, .
. R. V., 19
6 tmOulds
made of sand were used. This paper describes some of the experimental work earned out m castmg copper and
,

.
J{Llrz )ztee rg ewmnung, Acta Praeh is t. A rclweol. 23, 63-9!. t enna 1Somenzat1on of abietic
acid J 0rg
8 The .
. Ch ern. 3 es using sand moulds with varying amounts of clay. The resultant coo/mg curves of the metal as well as of the mauld'mg
'

}low., 1983 , Die Untersuchung e ine s rnittelalterlichen 1683-16 84. '

3

i,ange, ) teers aus dem Fund der Bremer K ogge, B erliner

z Tak eda, H., Schuller, W. H., Lawr
ence R y &
,
= ials, the metallo graphic characteristics of the casts and t heir hardness are discussed. Further work is suggested.
I-l
; a
if/' ge
zur Archiiometrie 8, 289-298
.
D., 1969, Novel ring ope ning '

s of levopimari
Rosebr k

.
c acid sa

00 '
KEYWORDS: EXPERIMENTAL, CASTING, COPPER, BRONZE, SAND MOULDS.
eity, F. W. & Stauffer, D. B., 1997, The \Vi/ey!NBS J. 01g. Chem. 34, 1459-1460. lt s,

McL' i stiy ofMass Spectral Data, 6th edn. Wiley, New York . Todtenhaupt, D. & Kurz weil A.
1991 HoI ztee
cter Introduction China clay was added. It was important to ensure that the
. 1\egs., rm
'
,

White, R. & ?ough , L. J., 1984/85, The chemical Tnbolog1e, Acta Praehist. Archaeol.
. .

23, 47_53. moisture content of the sand/clay mixture was constant for
r.'11ll5 tion of Baltic amber, Chem. Geo/. 47, 15-3 9. Todtenhaupt, D. & Kurz weil, A 1993 .
JJ1po si Wood tar m tn. 'A brief survey of the archaeological literature reveals that each cast. Similarly, the density of the compacted sand had to
c b ology
.o va , I., 1997, Chemicalli y li nkin g past and present: Tribal. Schmierungstech. 40, 108-110.
'

st 10 the r e is a dearth of casting moulds amongst the archaeolo be uniform for each mould. This was achieved by testing the
Zink D . F., Za, L.' C. & Wesolows
'

pa o 11para uve stud'ies of chars and r esms, D oc toraI

. . ki, M. F., 197 gical material from the Chalcolithic and earliest Early compacted sand with a Ridsdale-Dietert ("B" Scale) Green
co . 1
issertauon, Ur uversi ty of Amsterdam. 1te1pene Resm Acids. A Compilation
ofln'rared, .., z
'J' Bron e Age from areas such as the Levant, the Aegean and Hardness Tester to maintain a reading of fifty in every mould.
'

p .
n N., Evershed, R. P., Hi ggs W J, NucIear MMagnet1c R esonance, Ultra
mass,
J ian, K. &
nsO ' ' . . em viol et Spectra
and Egypt. This was also found to be the case for most of
!{obi B [inton, G., 1987, Proof of a Pine Wood origin for Pitch Gas Chromatograpluc .
Retention Data (of
the Methyl Europe. In all these areas metallurgical activities are
01 Tud or (Mary Rose) and Et ruscan Shipwrecks: Esters), U.S. Dep artment of Agricult
ure, Forest Ser i
v ce, evidenced only by the finished metal artefacts themselves
ppli ation of Analy tical Organic Chemistry to Forest Products Laborator y, Madison,
c W I. and occasionally by some ores, slags and fragments of
logy, Analyst 112, 637-644.
j\rchaeo . crucibles. There are moulds of stone, clay and metal, but
n. M., Ekman, R. & Heino nen, M., 1990, Alterauon
they are mostly
u1at1e . . associated to material from subsequent
!{et of pine tar m a manne environm ent, Ho liforscl11111g 44,
peciods. This negative evidence in the earliest metal-using
211-218 . periods has led to the hypothesis that sand moulds preceded
other casting media during the formative metalworking
periods (Ottaway & Seibel 1998).
The aim of the present study was to conduct a small series
of casting experiments, using moulding material
available in prehistory, namely sand and clay, to observe the
cooling behaviour of metal and moulding material and to see
what effect, if any, increasing ratios of clay in sand had on the
final bronze product.
Experimental procedure
The experiments aimed to investigate the effects differing
compositions of sand have on the cooling rate
micr ostructure of copper and bronze. This was achieved by
varying the level of clay present in the sand, from the natural
12% by weight contained in sand to 20% and 30% of clay.
For ease of comparison the methodological approach
a dopted was based on that of Ottaway & Seibel (1998). The
pattern for the cast was made of pine and measured
l.5x4x10 cm. These dimensions were similar to those of the
fa
l nged axe found with the Austro-Italian 'Man in the Ice'
(Spindler 1993 ), who has been dated to the second half of the
fourth millennium cal BC, i.e. to the late Neolithic of that
region. Modem foundry two-piece moulding b oxes with
in ternal dimensions of 15.2xl5.2xl0 cm were used in our
experiment to contain the sand. These are the small moulding
boxes found by Ottaway and Seibel to be best suited for the
si ze of cast.
The natural "Mansfield" sand used for the moulds had a
grain size of 119 and contained a nominal 1 2% clay. To
in crease this percentage of clay, dried and crushed potters
These readings are empirical and bear no direct relationship to
any definite pressure per unit area, though they are valuable
for comparative purposes.
Temperature measurements were taken using a five channel
electronic thermometer. The thermocouples were placed at 2,
5, 10 and 20 mm from the metal/mould interface. Readings
from the three dimensional centre of the metal itself were
taken using a "Pyrotenax" thermocouple. The first tempera
ture recorded was, for safety reasons, taken at some time
between 10 and 20 seconds after the metal was poured.
All following temperatures were taken at 30 seconds intervals
easily for one hour. Each experiment was duplicated.
The metal, contained in a new plumbago crucible, was
melted in a modem gas furnace at temperatures reaching
1 300C. In all cases a 1500 g charge of metal was used and
for the bronzes the tin was added immediately prior to casting.
Altogether six casts were made: two 10% tin bronzes were
cast in sand with 20% clay, two 10% tin bronzes were cast in
sand with 30% clay and two pure copper objects were cast in
sand naturally containing 1 2% clay. To avoid contamination
and the pure copper was cast first.
Samples of the metal were cut from each cast to analy se
the metal by inductively coupled plasma spectroscopy (ICP)
and in order to study the effect different cooling rates had on
the microstructure of the cast metal. For the latter, all
samples were mounted, ground and polished and then etched
with alcoholic ferric chloride in preparation for metallo
graphic analysis. Vicker's micro-hardness tests were also
carried out.
General background to casting in sand
M ould
Moulds for casting consist of a particulm refractory
material, such as sand, that is bonded together to hold the
intended shape during pouring. The refractory material should
be thermally stable, chemically umeactive and be free of
volatiles that produce gas upon heating. The porosity of a

184
Proceedings of the 31" Jntemarional Symposium on Archaeomell)>, Jerem, . & T. Biro, K. (eds.), Archaeopress -Archaeo/ingua, BAR- Cenll: Eiu: Set: I.
 Eccleston, M. & Ottaway, B. S. Experimental casting of copper and bronzes in sand moulds

mould is impor tant as it controls its permeability. A mould have relatively poor thermal conductivit of copper at 1083C, while the 3. Metallography
y the te I w the melting point
stbeO
with good penneability allows gases produced during pouring distn"but10n, ' mperat 1y. The
and thus the expansion, is not u ure JU ifies. The curve then falls off steep
nifonn metal solid bronzes show large
to escape through the mould (Piwonka 1988). If a mould is ure with a complex phase The micrographs of the as-cast
p on the other hand, an alloy
too porous, metal may penetrate the sand and cause flashing. Heat transfer and transformation zones bronz es over a range of tempera tures and this 1s columnar grains and long dendritic structures, consistent with
di agra m. Solidify

On the other hand, if permeability is too low, the ability for ature. slowly cooled tin bronzes. Those cast in moulds containing
t d by the steady fall off in temper
the gas to escape is decreased. Heat is transfen-ed from the molten meta reflec e 1 ernce m th e cooli ng curves 20% clay have more eutectic phases than the bronzes cast in
l to the .
adJacen It w as
expected to se some d"ff . .
moulding material. O'Meara et al (1988) t differen t rat10s of sand moulds containing 30% clay. Microscopic examination of the
state that h th casts canied out m moulds with
Sand and clay moulds t e ofd e pure copper samples showed that the metal formed was a
amount of heat transfen-ed 1s a funct10 n of ever as can be seen in Fig. 1, the differences are
.
.

pou nng te pe an c lay. How '

ture, the volume of the metal and the amount m ra eutectic copper/copper-oxide structure. This was most pro
of time th e g gible.
Sand moulding is still used in present day metal production
. .
1s exposed to mcreased temperatures. The rate
sand ne li bably caused as a result of insufficient removal of oxygen
of heat tran
since it is one of the most versatile fon-ning processes which 1s contro 11e d by the following resistances sfer during casting and cooling.
ing material
. .
to the h eat
. flow 2. Cooling curves of mould
allows freedom of design yet produces high quality products. (c pbe11 l 99 l. 125, fig. 4.1).. by the liqmd itsel
f, b t
The most predoininant base is silica sand (Si02) which naturally y he 4. Hardness
solidified metal, by the metal-mould interface of heat transfer is conolled, ongst o er
Since the rate
by th e mould

contains clays. The clay acts as binding material, but its action . '
and by the sun-ounding. W hereas the first and g mel, the casg expenments .with
last prob ab thing s, by the solidify

is complex. On drying, clay shrinks considerably and this have neg li gi" ble effects, the other three can have
ly
observanons. The hardness tests for the as-cast samples gave values of
. cons1derab bronze only will be considered m the followmg three
counteracts the expansion of sand during heating. Increasing the mfluence on heat transfer. Working out the comb
le between 96 and l06 HV for the bronzes. For the pure copper
. ined e"" uects
clay content in sand produces a more stable mould. of all these vanables on the metal, is so complex g material in the dry zone sample the hardness values were 52 HV for the pure copper
. it is usually 'Fhe cooling curves of the mouldin
phase and 66 HV for the copper/copper oxide phase, an
L
For small castings a sand with finer pores is better, but the simulated by computer. Most of the published stud from the metal, show that the
. . ies are on at 2 and 5 mm distance
finer the pores the lower the permeability for decomposition metals and mouldmg matenals of little archa clay contents cool marginally more average of 58.9 HV. On extreme 50% reduction by cold
eological moulds with higher
gases. Also the finer the sand with its natural clay component, relevan Thstudy by Ratka et al. (i pre s), studyi from the metal (Fig. 2 ). working with a l kg hammer on a metal anvil, the hardness
? ng filling slowly at this distance
the more water is needed to bond it. Hence, more gas is and solid1ficat10n processes by numencal simulation vaporisati on front is values doubled and were between 181 and 200 HV for the
, is o ne of b. At 10 mm distance from the metal the
produced which has to escape through a less permeable mould the few exceptions. cooling curve: the temperatu res are bronzes and an average of 117 HV for the copper, but the
clearly reflected in the
(O'Meara et al. 1988). The complexity of finding the best A great deal of research has been conducted around l00C when the water in metal began to crack at the edges (Fig. 3).
on the arrested for 2-3 minutes
sand/clay/water Inixture is clear. evaporation of water in green sand moulds and since (Fig. 2). The moulds containin g 30%
some the mould evaporates
Clay is a denser moulding material than sand and has a with 5. Metal composition
of these results can be studied in our moulds they
are clay have a noticeably lower temperature than those
better heat flow and thus a better conductivity. Clay moulds, mentioned here. Campbell (1991: fig. 3.29) distinguishe
d 20% clay.
therefore, cool faster than those made of sand. 'l. the dry zone, where the temperature is high The bronzes were analysed by ICP. The tin contents of
four zones: c. At 20 mm distance from the metal the vapour transport
samples cast in 20% clay/sand moulds was 10.45%, that of
and all moisture has been evaporated from the binder; 2. the zone is encountered, where the temperature is essentially
Casting and the1mal expansion of mould material samples cast in 30% clay/sand moulds was 9.67%. All other
vapour transport zone, which is essentially at a unifonn uniform at just below 100C (Fig. 2). There is no
temperature of 100C ... in which steam is migrating; 3. the discernible difference between higher and lower clay elements were only present at, or below, trace elemental
When molten metal is poured into a green sand mould, i.e. condensation zone, where steam recondenses ... and 4. the levels.
contents of the moulds.
a mould of sand that has been tempered with water, gases and external zone, where temperature and water content are still
steam are generated by the decomposition of the binder (clay). unchanged.' Of all cooling curves of the moulding material, only those
Discussion of results
The sudden heat from the molten metal causes the water in
of pure copper casts at 2 mm from the molten metal (not
green sand to evaporate and much is decomposed to hydrogen Results shown here) reached the temperature range (425-600C), at Taken together, the cooling curves of 10% tin bronzes, cast
(Campbell 1991: 105). which silica undergoes major expansion. in sand moulds with varying clay composition, reflect a rather
If solid is heated uniformly, it expands uniformly. The
a 1. Cooling curves of metal
same can be said for a mould with an enclosed cavity
1991: fg
20%clay
(Campbell i . 3.6). In practice, however, because The cooling curve of copper (average of two castin g s, 450 &sand

mould material is often not uniform and because most moulds

at2rrm
Fig. 1) shows a clear arrest caused by latent heat at l080C,
-30%clay
1200.0 ..------- &sand
at2nvn

-W--20%clay
&sand
at5mm

__.,_30%clay
-Copper &sand

in at5mm

sand
-20%clay
_.,_.Bronze &sand
in'.20% at10mm
clay&
sand
-+--30%clay
&sand
--it-Bronze
at10mm
in30%
clay&
sand
-20%clay
&sand
at20mm

o .!:.....,.....,.-.--..-.-..--.-r-r--.-r-r---r-ir-r..,--r-.-.-.--.--r.-r--i -30%clay

\:)"'
0.0 -t=ir-r-.-....-.-,.--r-"T-r-T-,.-ir-r--r-.-...-r-T-,.--r-.,-.--.-.---r--.-...----___;
&sand
at20mm

Time (minutes)

Time (minutes)
for
Fig. 2. Cooling curves of moulding material at 2 mm, 5 mm, 10 nun and 20 mm distance from the metal/mould interface
Fig. 1. Cooling cw11es of copper in sand moulds and bronze in sand/clay moulds. bronze cast in moulds with 20 and 30% clay.

186 187
 Experimental casting of copper and bronzes in sand moulds
Ecc/esto11, M. & Ottaway, B. S.

study Acknowledgements
periods, outlined in an earlier pilot
Pure Copper Pure Copper 10% Tin Bronze 10 % Tin B . B
E A
Mansfield Sand
ronze
.ot!iCSt & eibel 1998).
Mansfield Sand S y for help in the
20% Clay & S and 30% Clay "" a wa Y nce for the The authors would like to thank Alan Harve
& Sand (ort su gg ested that this could be taken as evide the Department of
Cu Phase Cu/CuO Eutectic It wfas petiod s, which , after use, would foundry and Dr. John Whiteman, both of
ulds in these
0 sand mo Engineering Materials of the University
of Sheffield, for
e rate to ' dust in the wind ' .
As Cast 51.7 3.4 66.0 3.9 u a11Y disinteg due to Dr. David
106.4 7.9 95.910.3 cted to test if advice and support. Further thanks are
v mall series of expe1iments was condu tment of Archae
[HV2s] s
in sand mould s would affect the Dungworth, Teaching Fellow in the Depar
lHV2s] component s
fHV100] sing clay ology and Prehistory, for help with the practic
al work of this
norea
fHV100] lex behav iour
n t bronzes. The result s reflec t the comp
50% Cold Worked 112.04.3 121.6 7.1 1
199.813.5 180.92 2.7 u lt a sand/c lay mould ing mater ial project.
n cooling and of
rnet al upo
[HV2s] lHV2s] fHV100] fHV100] Po
n heating. It was obse rve . that bron ze cools m

gina lly
those Bibliography
in s and moulds contammg 30% clay than . m
slo wer needs to be earne d out to
more work
ning 20% clay and -Heinemann, Oxford.
3. Hardness values for copper and b.mnzes cast zn contai Campbell, J., 1991, Castings, Butte1w01th
.
Fig.
to elucid ate the reaso ns for this
these results and
sand and sand/clay moulds.
ed axes of the north
confirJll and metal, Kienlin, T. & Ottaway, B. S., 1998, Flang
ur. Compared to moulds of clay, stone ilities of use
complex ehaviour. The bronze cools marginally slower in the to rather brittle metal ' by the pre beh avio and of sand with alpine region: an assessment of the possib
sence of copp sand with natura lly occur ring clay
moulds wtth 30% clay than in those with 20% clay. At 2 and .
eutectic phases, respectively.
er oxides
or moulds of cooling wear analysis on metal artefacts, in Morda
nt, C., Pemot,
of clay are the slowe st
ficially increased levels
5 mm away from the metal' the moulds with 3001
'lo h ave a art i M. & Rychn er, V. (eds.), L'Atelier du bronzi
er en Europe
. . The results of the hardness tests seem to show
higher te perature, whereas at 10 mm from the metal the that the me
tal moulds. II. Colloque International 'Bronze '96',
Neuchatel et
m the as-cast state produced here is tic
harder an e leads to an increased presence of eutec
moulds with 20% clay have the higher temperature. 20 mm stan dard The slow cooling Dijon, 271-286.
hardness values published by Scott an increa se in the coppe r oxide
(1991 8 e s and to
This w as als phases in the bronz The properties

Northover, J. P. & Staniaszek, B. E. P., 1983,

away from the metal no difference in the temperature of the found to be true in an experimental
j o seem
stu d anged axes, in the coppe r casts. Although the resultant metals
phas e & Warren, S. E.
moulds can be detected. were as-cast pure copper gave hardn fl
nce mater ial, its brittle natur e of leaded bronze alloys, in Aspinall, A.
ess val es betwee r refere
It is po sible that the variability observed is due to
50 and to be harder than simila on Archaeo-
. 70 HY which on 20% reduction gave storic smith s and may have (eds.), Proceedings of the 22nd Symposium
90-110 HV (Kienl to prehi
differences m he ratio of water to sand/clay, inhomogeneous in & would be disadvantageous
Ottaway 1998). In the case of the pur metry, 262-72.
e copper samp1e . sand moulds were replaced in the
of this been one of the reasons why J., Smith, R. L. &
metal-mould mterface and/or poor control over ambient present study, and that of Kienlin and clay and metal moulds. More O'Meara, P., Wile, L. E., Archibald, J.
Ottaway, the di ere
nce succeeding periods by stone, , in Stefanescu,
temperatures rather than to the differences in sand to clay but t the publis hed values is about 20% Piwonka, T. S., 1988, Bonded sand molds
aspect, first of all by studying
. Upon cold working
the work needs to be done on this 15, Casting,
further work needs to be done to affirm these findings. difference to published values disappear toric metal artefacts. D. M. (ed.), Metals Handbook. 9th ed. Vol.
ed and the va1u es lay the microstructures of more prehis
When comparing the cooling curves presented here to mthe ranges as suggested
by Scott (1991: 82). work, the results lead to more Metals Park, Ohio, 222-25.
As usual with experimenta l
Dust in the Wind:
those of Northover & Staniaszek (1983), it is very clear that
more experi ence in replicating Ottaway, B. S. & Seibel, S., 1998,
questions than answers. As s, in Frere
bronzes and copper cast in sand/clay moulds cool consider Conclusion and further work the numerous variables experimental casting of bronze in sand mould
casting is gained, tighter contro l over
des cuirres,
aby slower than those cast in clay, metal or stone moulds
intere sting to carry out Saotot, M.-C. (ed.), Paleometallurgie
can be introduced. It would be
(Fig. 4). In conclusion, a brief survey of the archa . Instrumentum 5, 59-63.
s, such as chaff, cereal or
eological record of experiments using organic binder molding material, in
The metallographic analysis suggests that in both pure Greece ' the Near East and Eg t of these organi c binde rs could Piwonka, T. S., 1998, Aggregate
. YP cofi rmed the dearth of fibre with sand moulds. Some 9th ed. Vol.
copper and bronzes the extremely slow cooling seems to lead moulds in the earliest metal produ could act Stefanescu, D. M. (ed.), Metals Handbook,
: on combu stion, they
cmg Chalcolithic and have several beneficial effects
also leave large voids behind 15, Casting, Metals Park, Ohio, 208-11.
as a deoxidant, they would press), Numerical
1200.0
and at the same Ratka, M., Sahm, P. R. & Bunk, W., (in
which affect the permeability of the moulds,
m

for bronze, in
al and preven t disasters simulation of historical casting processes
time they could act as a bindin g materi
smiths , being clearly very International Symposium held in Innsbruck.
-Copper
when the moulds crack. Prehis toric
smann, Munich.
the numer ous pure coppe r and Spindler, K., 1993, Der Mann im Eis, Bertel
experienced in casting, as
In
structure of ancient
show, would Scott, D., 1991, Metallography and Micro
sand
bronze artefacts in the archae ologic al record
and historic metals, The Ghetty Conse
rvation Institute,
mould
could be
have welcomed, and used, any additional benefit that
........-sronze
Los Angeles.
in20% gained from moulding material.
clay&
800.0
sand
iii'
:I
'iii
4i -W-Bronze

in 30%
CIJ
...
clay&
:I
600.0 sand
'IV
...
CIJ
Q. -+-Clay
E
CIJ
I-
400.0

-&-Metal

0.0 +-;;-...,-r---
- -
:--....-
-: -- -.---- ' --
-
2.0 4.0 6.0 8.0 10.0 12.0 14.0 16.0
Time (minutes)

Fig. 4. Comparison of cooling curves wit/1 Mm.thover & .

Stamaszek (I 983).

188 189
 THE IMPORTANCE OF THE FIRING ATMOSPHERE
JN THE PRODUCTION OF COARSE CERAMICS WITH CALCITE
AND CHAMOTTE INCLUSIONS1

FABBRI, B.,1 GUALTIERI, S.,1 & SANTORO, S.2

1 CNR, Research Institute for Ceramics Technology, Via Granarolo 64, 48018 Faenza, Italy,

zArchaeological Department, University of Bologna, Piazza S. Giovanni in Monte 2, 40124 Bologna, Italy

The firing of coarse ceramics, which constitute about 70% of the ceramic finds in Roman archaeological excavations in
1s to have een mainly realied in pit or pile-kiln. In the present study, some experiients hav been carried
North ern Italy, see1 . .
111, in w hich a series of specunens were fired m a pit-kiln. The specimens were composed of a body with mcluswns of ground

a /oit e or cham otte. The
characteristics
aim
of
was
the
to verify
different
the behaviour
mixtures. To
of the
evaluate
material
the role of
during
the
firing
firing
as well
atmosphere,
as
the
the microstntctural
samples were also
and
fired
mech ani cal
in an electrical laboratmy kiln, with an oxidizing atmosphere. The firing atmosphere does not influence the characteristics of

samples containing inclusions of chamotte, while different results are obtained with calcite inclusions. In particulm; pit-firing
allows temperatures to rise as high as 800C without promoting calcite decomposition and subsequent decohesion of the
artefacts as in oxidising environment.

KEYWORDS: CERAMICS, COARSE-WARE, CALCITE AND CHAMOTTE INCLUSIONS,

FIRING ATMOSPHERE, PIT-FIRING.

Definition of the archaeological problem At present it is impossible to calculate the percentage of

What are coarse ceramics
It is first of all necessary to specify what is meant in Italy
by coarse ceramics, both chronologically and functionally.
This term is used to designate a type of artefact whose
ceramic body contains inclusions visible to the naked eye,
with no external coatings (other than clayey), used for
functions connected with everyday domestic activities
(preparing food, cooking, storage of foodstuffs and liquids,
and possibly transport; to a far lesser extent also as tableware,
relative to the Roman and Medieval periods). In the pre
protohistorical context this designation is equivalent to
"ceramica d'impasto" traditionally used to indicate artefacts
which have the same technical characteristics and functions.
The corresponding English terms (coarse-ware, cooking
ware, rough-ware) are rather imprecise, placing the emphasis
at times on functional aspects, at others on the appearance of
the ceramic body. The same can be said for French terms
(ceramique culinaire, ceramique grossiere). German intro
duces an additional distinction relating to the ambit of
production and consumption (groBen Hauskeramik). There
are also many subclasses defined on the basis of the nature of
inclusions (e.g. grapphitonkeramik) or specific production
con texts (e.g. Auerberg ware).
The firing conditions
One characteristic common to most coarse ceramics,
protohistorical as well as Roman and high-medieval, is the
Often uneven grey-black colouration, attributable to filing in a
pr evalently reducing atmosphere. The proposed firing methods
efer to either "pile" or "pit" type kilns. Very few have been
Id e n tified archaeologically, whereas ethnoarchaeology has
Provided many interpretative suggestions.
coarse ceramics which appear to have been fired in an oxidising
atmosphere (judging by the more or less reddish colouring):
ceramics ofthis type, of the high Roman period (AD 1st-2nd c.),
do exist in Northern Italy, but seem to account for a lower
percentage than those fired in a reducing atmosphere. In the
Lyon area of France too, the ceramique culinaire of the high
Roman period was fired in a reducing atmosphere. For now, the
rationale for this appears to have been a matter of aesthetic
taste, rather than the characteristics of the clay employed.
Studies conducted on pre-Roman, Roman and high
medieval coarse ceramics in Northern Italy, with calcitic or
silicate or chamotte inclusions, have shown that at least the
calcitic as well as the chamotte inclusions, had been added
intentionally. W hat relationship exists between these in
clusions and the choice of firing in a reducing atmosphere, in
terms of obtaining an effectively functional product with a
minimum of resources, ease of procming raw materials,
economy of processing equipment, reduced quantity of waste,
and reduced fuel consumption?
Definition of an archaeometric project
Preliminary considerations
There is also a problem connected with the implementation
of this type of firing: previous research work has provided an
extremely useful general classification of firing methods, but
ethnographic observation reveals that there are countless
methods for carrying out firing in a reducing atmosphere, with
sometimes considerable differences in fuel consumption and
the characteristics of the finished product.
For archaeological ceramics, it would therefore be useful to
identify quantitative parameters which indicate the degree of
reduction in the firing of a ceramic artefact, albeit with the
limitations imposed by the dishomogeneity of many products.

I .
This research project was carried out under the auspices and with the financial support of the "Cultural Heritage" Finalized Project of the CNR, Italy.

Proceedings of the 31" /11ternatio11al Symposium on Archaeometry, Jerem, E. & T. Biro, K. (eds.). Archaeopress-Archaeolingua, BAR- Cenfl: Ew: So: I.
 otte inclusions
e ceramics with calcite and cham
sphere in the production of coars
Fabbri, B., Gualtieri, S. & Santoro, S. The importance offiring atmo

whic h would result in

Based on
the above prenuse . To avoid excessively fast cooling
inif ate d s, a research project was the true significance of the inclusions in the man Materials and methods d at the edges of the pit,
cracking, the fired pieces were place

With the b. . ufacture

vanous O jecti ve of ascertammg the behaviour of end use of the artefacts. and de.
types 0f first on the inside and then on the outsi

coarse ceranuc bodies canied out at three

Processmg . during the various The comprehensive project plan is shown in F'rg. 1 e preparation kiln, three firing s were
s a mpl In the electric
.

phases S . fi . It In
vol
.
came d o ome pit- mng experiments were also
the preparation of clay bodies containing chamotte ve s 750 and 850C) with a

ut in w hi . . . 1 ' Carb onate from test pieces of that different maximum temperatures (650,
sh ape an h a senes of test pieces of predetennined and s1.Iicate sand mclus1ons, as well as of C ay . e inclusions were prepared 20 hours was established,
d siz e, ma COntaining charnott slow cycle.A total firing time of
. . . . all the bod es, fired n a pit.
cha m Otte . de from nux tures contammg calcite or . 110ns for the purposes of comparison and ide
me no Jll mate1il use as the base for about 8 hours, a maximum
mcl u . ntifymg sa e . calatrons of with a rising-temperature phase of
. sr ons, were fire . the s1ons were obtained from mter , and a falling-temperature
behav our d The arm was to observe the positive and negative effects of adding the temper. 'fhe calcite mclu temperature phase lasting 1 hour
1
characteri
of the m
stics of
te
?
.
als
.
dunng firing, as well as the The chamotte was prepared by grinding the bod . sp atic c
alcite in the limestone
.
formations of the Romagna-
phase lasting about 11 hours.
the rrushed products. 1 Y Withou t
. penrunes.
C learly' this temper, fired under different conditions a so m
ord er to arches A to a maximum
was n0 t stnctly .
ascertain the effect, if any' of this techno1ogr. cal v rials were then ground down
archaeolo speaking a n "experimental All the mate Raw material and product chara
cteri sation methods

gy" stu dy, . ana b le then by hand in

. m the sense of a practical experiment . 2 mm, first in a jaw crusher and
which im
itates or .
It shall also be observed how the firing temperature
of the grain size of
. .
was to
replicates ancient artefacts: the objective n mortar. in terms of chemical and
better
c hamotte, which r s more or less different from that
of the a p orc e lai usually The base body was characterised
u nd erstand production
body whic h contains it influences the recognisab1.li ty erial used as a base was a body using XRF and XRD
materials processes. The raw
of the 11he clayey mat a non mineralogical composition by
used w ere . It is
therefore procured from industrial production of cooking tableware ents were carried out on the
sources
and salvag
chamotte itself under the microscope. eJI\ployed for the pasc io techniques.Grain size measurem
of clay (Alto
e w ood preces 0f varymg size were used as mixture of two different types sieves with mesh sizes
fuel The The various types of inclusions will be adde d to the carbonatic different types of inclusions, using
.

d ata be hase

and not
mg sought was m fact of a general
character bo dY m different amounts (up to 30%) and gram . . & Bolena) in
a ratio of approximately 9: 1.
ranging from 2000 mm to 63 mm.

bound SIZe 0 ratio

to a specific, localise . . . temper were dry-mixed in a 70:3 gth measurements were

pro ductio
n context
d and circumscribed di stn b ut10ns, with a maximum dimension of 2 fh e base body and Linear shrinkage and bending stren
wed by
search fo
r raw m
' which would have entailed the study and
aten. als as srnular
. .

.
The bodies will be fired by two different m h0 ds..m an in two stages: an
initial manual stage was follo
in a jar2 for approximately ten minu tes. carried out on all unfired and fired
samples. For the unfired
Antr. as possible to those used in electnc kil n (oxr'di smg atmosphere) and in a pit (senu- JI\echanical mixing used for preparation was
quit y. body, the quantity of water
.

quantity
. Above all, ined were then mixed with the

. .
the type of fuel rs an extremely The bodies thus obta rials the mineralogical

im p o a reducmg atmosphere). As regards firing in the electnc kil

n nt variabl . t plast icity measured, whereas for fired mate
m the thermal cycle, due to its effect on the . n,
) necessary to achieve sufficien
paramete
rs of t the temperatures will be in the range of 650-85ooc, refl ectmg of water (about 20% s composition and water absorption
were identified.
rme (rapidit the extrusion process. Test piece
te mperat Y 0f lightmg, duration) and the temperature va1ues obtained from previous studie s on for the formation of bars by The percentage of adde d wate r is calculated with reference
he s
ure (eff .
vene s and economy), and on the nature of

.
ancient artefacts (Casadio et al. 1991 ). of suitable size (12x
2xl cm) were prepared for runn ing the
to the dry weight of the body: HP%
= 100 (Pu-Ps)/Ps, where
oli d a nd
m which t
:/
vo a
here still
es due (coals and smoke): this is a field
In this way a ttal of 40-50 products will finally b e planned character isatio n tests. The extruded bars were
en
first
loss Pu is the weight in the plastic state
and Ps is the dry weight in
. erature, to avoid a sudd
as regards mar
s much work to be done, especially btarned. The expenmental bodies will b e characterised both dried for 48 hours at room temp
firi ng in redu ? h migh t a kiln at 100C.
cmg atmospheres. of moisture and the poss
ible shrinkage cracks whic was obtained by X-ray
m the unfired and fired condition.After preparing test pieces
acts. Sub The mineralogical composition
. rity of the artef
of suitable shape, the dry bending strength and shrinkage compromise the physical integ eigerflex instrument, in the
Descript'o diffractometry using a Rigaku-G
i n of the comp . . . .
sequently, drying was comp leted at 100C for 24 hours.
rehensive project c haractenstrcs will be determined. powdered samples.
scanning interval 4-64 28, using
urements, a lever-type

The expen. The fired test pieces will be characterised both from th For the mechanica l stren gth meas
mental p1 n.
technolo consists of a series of tests for the mechanical-physical standpoint (shrinkage, bending stren Firing methods ator was used , applying a linearly
gical char Netzsch Resistance Indic
contarru ng actensafIon f vanous
experimental bodies and thermal shock measurements) and from the microstmctural the test piece broke. The
increasing bending load until

.
coarse m . e was carried out
clus10 ns, with the objective of ascertaining 1 and poros1metric analyses.
standpoint through minera1og1ca Firing in a semi-reducing atmospher is given by: R= 3PD/2LS2,
m in diameter and about bending strength (R) in kg/cm2

inside a practically circular pit (1-1.5

'

D = distance between the

where: P = breaking load in kg;
BASE-BODY NON CARBONATIC CLAY
nd. A small fire
half a meter deep) dug in sandy-clayey grou L = width of the test piece in
I was lit at the centre of the pit, using smal
The artefacts were arranged around the fire (preh
l-sized firewood.
eating stage),
supports of the test piece in cm;
cm; S = thickness of the test piece
in cm.At least five test
uct, and the average and
source until pieces were broken for each prod
and then gradually moved closer to the heat lated.
,_ pieces in the standard deviation values were calcu
WITHOUT-
finally the positions were inverted, with test d test pieces were
LIMESTONE CHAMOTTE VARIOUS TYPES OF
rude
CALCITIC
Using a gauge, the newl y-ext
ring).During
middle of the pit, surrounded by the fire (pre-fi intervals of exactly 9 cm
ADDITIONS
marked with reference notches at
INCLUSIONS
s were
the preheating and pre-firing stages, the piece
INCLUSIONS INCLUSIONS SILICATE INCLUSIONS
al variations of the test
e to the (10), in order to obse rve the dimension
continually turned so as to expose their entire surfac . The percent total linear
(VU+ CA) (VU +CH) (VU+ SA)
(VU) pieces after drying and firing
(VU+ LI) heat as uniformly as possible. is given by: RL = 100
---- - ded to the shrinkage (RL) after drying and firing
After about one hour, the fire was gradually exten l measurement and L is the
with (L0-L)/L0, where L0 is the initia
centre of the pit and the test pieces were covered
larger final measurement.
fir ewood. The fire was then stoked using larger and through water absorption,
The open porosity was evaluated
sized pieces of wood, until flames as high as one meter were
CHARACTERISATION OF DRY BODIES
r absorbed by the test piece
which is the percentage of wate
obtained.This point marked the start of the true firing stage: water for two hours. It is
a when immersed in boiling distilled
on the basis of previous experiments, we can suppose that
(shrinka e, bendin ) s when they are dry (Ps) and
ned. From determined by weighing the piece
maximum temperature of at least 800C was obtai s)/Ps.
this point onward the flames were allowed to die out until a after the test (Pu): AA= 100 (Pu-P

covering of embers remained.The duration of this phase was

Results and discussion

FIRING
SEMIREDUCING ATMOSPHERE (PIT-FIRING) not m ore than an hour.We next proceeded to perform the final
operations on the pit, spreading alternating layers of earth and
osition of the clay used
Chemical and mineralogical comp
OXIDISING ATMOSPHERE (650C - 750C - 850oC) Wet straw on top of the embers to help maintain the heat
as base body is reported in Table
1. It turns out to be an iron
beneath the covering for a long time.The wet straw, burning
carbonate minerals.
rich illitic-kaolinitic clay without

_I I
slowly, creates small channels that communicate with the

I I
distr ibuti on curve s obtained for the two
outside, permitting release of the smoke during the final stage The grain size
tly different.For calcite the

- l-E-S_J
types of inclusions are only sligh
0
=R=E=DB 1D
of combustion and the start of the cooling phase of the
C C
HA;: ;; R AC T;,
E ;,
R l
SA TI=
ON:-=
O F FI
approximately, whereas the
-b-_!_ .
mean diameter (<p50) is 450 mm
( shr i nk age, endmg
c eram ic material.This phase generally lasts about 48 hours,
otte.
value of <p50 is 540 mm for cham
strength crystalline p has es, porosimetry, thermal shock resistance)
,
after w hich the "vault" is opened and the pieces are taken out.

,
:- - - tory mixer.
as a rotary powder container for small labora
Jar: cylindrical porcelain container used
Fig. 1. D escription of the comprehensive project.

193
192
 Fabbri, B., Gualtieri, S. & Santoro, S. calcite and chamotte inclusions
The importance offiring atmosphere in the production of coarse ceramics with

Min eralogical Composition values less than 14%, while

cham0 11e c FELDSPAR ILLITE CALCITE CaO inclusions and bearing factory stamps indicating they were
Chemical Composition o n tai
QUARTZ
++++++ part of a wide-ranging commercial circuit, suggests the
lll.ng hOdj
+++++
around 17% . This difference is due

% Oxide % Phase Mineral Quantity to the fac tr +

Oxide t that c
grains are porous while calcite grai
ns not ! n hain. +++++ + + ++ existence and continued activity over time of workshops
0.24 Quartz +++++ fact the e ++
CaO
Si02 69.93 diff erence between the two types of is r' p +++++ + specialised in series productions of predetermined quality.
bodies ve y . rce"' .. tr
+
++++ tr The workshop s employed this technology that was essentially

+
0.25 K-feldspar the percentage of calcite and cham otte
+++++
17.31 Na20 ilar
Ah0J in the bo . 811n to
art ,. dies.
tr
K10 1.97 Plagioclase + The bending strength of the pit-fir
ed alternative to firing in an oxidising atmosphere, with an
Ti02 0.66 . . e1acts w hi
( wit h calcite. mclusions) or at least co as equally high level of productive complexity.
++ mparable g her ineralogy of bodies with calcite inclusions.
Fe20J 5.01 s 0.02 Illite
1us1on
me . that of any of those
s) with (chamotte Table 3. M
fired m the e
+
.. lectc .
0.05 P20s 0.08 Kaolinite In these last cond111ons, the bending strength gical requirements and function References
MnO f the b o kiln, f financial-technolo
terJllS 0
0.74 P.F. 5.75 Chlorite trace
highest with firing at 850oc, going from
4 50 k dies Was
g/c m2 (f+ .
ali of
the finished product.
MgO
finng at 6 5O and 750C) to approxima

chamotte and calcite containing bodies.

tely 65 kg/cm 2
.
"'<er
for both
"
e strong
" productive structures, quipped with fixed and Casadio, R., Fabbri, B. & Maldera, R., 1991, Ancient fire
resistant pottery from Emilia Romagna (Italy), in
.
So , I't is ev .
echnologically
complex production plant, were of course
ident that JJlO t
Table 1. Composition of base body. the best mechamcal characteristics are
calcite containing bodies. Apparently an
reached b y .
pit-firin .
abe\ o pr
oduc e c eramics fired in a reducing atmosphere in their Pernicka, E. & Wagner, A.(eds.), P roc. 27th Symposium
on Archaeometry, Heidelberg(Germany), 2-6/4/1990 ,
g also to meet the tradi' uonlist tstes of
. anal
m-1 IS kiJn s (perhaps
One i mmediately observable effect of the firing atmosphere
obtamed when calcite contai ning bodies . to be 237-246.
. . are fiired
m OXIdan1
.
cu stomers)
by altering the ng procedur but it remams
,
the pieces. During firing in an electric kiln, condillons at 850C. But the correspond Mazzocchin, S. & Agostini, C., 1997, Cerarnica grezza bollata
was the colour of ent fired ma .
tenal IS aJuated to what
exten t this was econo mIC.
a t mosphere, all the test pieces took not stab1e and the artefacts will . soon degrade da Padova: ipotesi interpretative per l'indagine archeo
ev How ever, these same strong productiv e structures
nda ntly oxidising cou d

in an abu .
sam e unifo rm red-orange colour, which was slightly The mineralogical compositions of the body ably utilise pit kilns. For example, the finds m metrica, Atti l a Giornata di Archeometria della Ceramica
on the with chamott also more profit
temperature. were practically the same before and after e "II contributo delle analisi archeometriche allo studio
er at the 850C ian and Northern Italy (Mazz occhin &
light . . .
firin g, except fo
r both central Tyrrhen
With pit fuing, on the other hand, there was an alternation th e destruct10n of kaolimte and c hlorite as a of Roma earthenwar e jars(2n
BC- A? delle ceramiche grezze e comuni", Bologna, 28/2/1997, a
result of finn . g. Ag ostini 1997)
of oxidising and reducing conditions, depending on the firing The composition of the calcite body on the other atmosph ere, contammg calcite cura di S. Santoro Bianchi e B. Fabbri, 136-142.
. . ' han d 'Varied Isl c.) fired in a reducmg
stage and the position of each artefact in the pit with respect to greatly dependmg on the nng c n itions(Table

? 3). In this
the fire and the wind. These heterogeneous conditions case, there were substantial vanallons in the
quan tity f
produced pieces that were themselves not uniform, as well as calcit, which decreased sharply between 650C
and disappeared completely at 850C. At this tempe
and 7500 1
each other. Colours ranged from pink
being different from rature we
to shad es of grey, and to black caused by carbon particles observed the presence of calcium oxide, traces of
hues . which ere
.
site d on the surface or infiltrated to a depth of 1-2 mm. In also ,.iound m pit-fired artefacts. However, pit firing
tended to
depo
in cros s-sec tion m o s t pieces exhibit a grey-black surface preserve much of the calcite.
fact ,
sur roun ding a centre that is generally lighter in colour. The presence of calcium oxide is likely the cause
layer of the
Tabl e 2 sho ws the results o f the physical-mechanical lack of cohesion of the specimens fired at 850C, because
it
tends to rehydrate and then to yield calcium carbonate, so
characterisation tests; for each of the pit fired bodies. Test
p romoting a bloating of the particles. The same phenomenon
pieces were selected so as to represent the entire range o f
above. should occur after firing at 750C, but no calcium oxide can
colours described
Ther e does not appear to be a substantial difference between be observed by XRD because it is not in a crystalline fonn.
obtained for the same body at different
total sh rinkage values
firing tem per ature s in the electric kiln, nor between the values Conclusions
ed for pit and electric-kiln firing. On the contrary, there
obtain
me difference between calcite-containing and chamotte We can conclude that, for the ancient potter, firing in a
is so
reducing atmosphere was the best method in terms of
containing bodies: the shrinkage is lower when chamotte
5.3% on average). managing the firing process and functionality of the
inclusions are present(4.7% against finished
As regards water absorption, it was impossible to measure product.
containing calcite inclusions and fired in an If the clay used had an abundant calcitic component, or if
the sample bars
This was due to the total calcite inclusions were added for other reasons(reduction of
electric kiln at 750C and 850C.
'disintegration' of these test pieces when immersed in boiling deformation during drying, reduction of sensitivity to thennal
slowly(over a few months), when exposed to shocks) firing in a reducing atmosphere provided greater
water and , more
air. This means that, if a calcite-containing body is available, assurance of success because, unlike firing in an oxidising

oxid ant firing is dangerous when temperatures are not well atmosphere, it did not impose any special temperature control
too much. requirements. If the inclusion added was chamot te, the best
controlled and increase
There were significant differences in water absorption for results in terms of functionality of the finished produ ct we re
bodies: calcite-contained bodies display obtained with firing in a reducing atmosphere, or with firing
the two types of
in an oxidising atmosphere at 850C(a considerably high

Parameter Pit-firing Oxidant firing temperature, more difficult to control and more costly to
Body
650 c 150c s50c attain). Overall, firing in a reducing atmosphere theref re
Shrinkage (%) 5.3 5.4 5.2 5.3 offered a better guarantee of good results, presumably with
(
vu+cA Water absorption %) 13.7 13.7 (*) (*) considerable energy savings in the case of firing artefac ts
' 79
Bending strength (kg/cm ) 51 48 67 containing inclusions.
4.9 4.5 r
From the archaeological point of view, it follows that fo
Shrinkage(%) 4.7 4.5
vu+cH Water absorption(%) 17.6 16.4 17.6 17.3
y th ose
' the "weaker" productive structures, that is to sa .
Bending strength (kg/cm ) 59 41 43 65
(*)N ot evaluable.
organised for production at the lowest possible co st, for the
lC
own consumption or for local sale having a limited econoJJl
the mo st
Table 2. Total Shrinkage, Porosity (water absorption) value, filing in a reducing atmosphere was always
i. n
and Bending Strength. advantageous choice, offering better performan ce both

194 195
 BIOHISTORY F ARM AT SZARVASGEDE (HUN G ARY):
A C ASE FOR BIODIVERSITY CONSERVATION

GYULAI, F.

Institute for Agrobotany, 2766 Tdpi6szele, Hungary

to pollen analysis, archaeobotany ( concemed with the evaluation of seed and fruit remains) concentrates chiefly
In c ontrast
that were deposited as a result of human activity. Plant cultivation in the Carpathian Basin started 8000 years ago.
on fin ds
r in tention is to reconstruct in detail, this cultural heritage. Our aim is to establish a bio-history reserve where we can collect
(Ju
and produce, in a pure biological manne1; the cereals, fruits and grapes species of the Hungarian Medieval periods in the
Carpathian Basin, saving them from extinction. These species are the result of many centuries of adaptation to the specific
climate of the Carpathian Basin. The production of these ancient species together with the supply of additional information on
them would mean the sun1ival of this cultural heritage. One way to know more about the value of ancient cereal is chemical
an alysis. The analysis of cereal and food remains poses a great challenge. This work requires simultaneous familiarity with
bot an y and chemistry. Nevertheless, results have contributed significant information on the food consumption and subsistence
culture of prehistoric people. We intend to reconstruct this ancient plant cultivation using the latest scientific data. In our
Biohistory Farm of Szarvasgede (Hungary) beyond saving and cultivating cereals that are threatened with extinction we would
also c onduct experimental archaeology. This is a multidisciplinary research, the synthesis of cultural anthropology, archaeo
and ethnobotany. These all together would help preserve tradition se111e the environment and education.

KEYWORDS: HUNG ARY, ARCHAEOBOTANY, FOOD REM AINS, EXPERIMENTAL ARCHAEOLOGY,

BIODIVERSITY, W HE AT SPECIES, FRUIT SPECIES.

Description of the project
Our aim is to establish a biohistory farm where we collect
and produce old cereals and fruit species saving them from
extinction. These species are the result of many centuries of
adaptation to the specific climate of the Carpathian Basin.
Our project started in 1995. We plan to establish a 2 hectares
model habitat on Szarvasgede (N6grad County) 70 km from
Budapest (Fig. 1). The "Biohistory Farm" is bordered by the
Aranyos creek. The lot is located in the village. The climate is
favorable; the distribution of annual precipitation is good. The
land is rich in nutrients. This is a virgin territory. The

Fig. I. The Research area in Szarvasgede.

Proceedin
gs of the 31" lntemational Symposium on Archaeometry, lerem, E. & T Biro, K. (eds.), Archaeopress -Archaeolingua, BAR - Centi: Ew: Sa 1.
 Gyulai, F. Biohistory farm 011 Szarvasgede (Hungmy): a case for biodiversity conservation

countryside is free from industrial activity. It is an archaeotype knowledge, economic strategies, subsistence olo gical excavations and living plants from the model
. pa tterns
and arch ea
of symbiosis between man and nature where the natural and environmental changes.
habit t.
a
cultural landscape (agriculture, settlement) composes a holistic In the Carpathian-basin plant domestication beg m
A ong
cereals we wish to produce chaffed wheat ( einkorn,
. . a n ca 800Q
unit. This would be a model garden and exhibition. The results years ago, fnn t growmg ca. y ears ago (F
2000 ig. ). Jll!ller, spelt) as most impmtant. We collected the grains from
of our research could be used in the training of professionals mtent10n 1s to reconstruet, m

detai1, thi s cult ural Our 2 rational archaeological farms and from genebanks

. henta
ge w,
e
eadY opep1ivate
and in education. suppose, based on archaeological and botanical studi individuals in Hungary and from abroad. We
and fr
om

. es, that
a t
Similar to projects designed to save ancient domesticated the time of the Iandtaking Hungana ns, they had arri d c e in the Biohistory Faim since five yeais the oldest
Ved to the
u
. o
animals we shall care for and maintain ancient plants (region Carpathian-basin . carrying wit'h th em the knowle
he t: the
a einkorn on half of hectare and we make experiment
. dge o f cere
al'
specific cereals and frnit) threatened with extinction. We grape and fnnt . cu1
11vat1on. Documents fro
m the e 10 prepa
re it for food (Fig. 3).
. ,, . . arly
intend to establish this habitat in harmony with agriculture Medieval Arpa? penod arely mention fruit g rowing. Einkom (Triticum monococcum), the bread wheat of
and the environment. We wish to join the project, entitled Jn the medieval penod the hungarian wheat an d ancie nt
cultures, could be the choice of present day reform
. fru'u
"Environment and ecologically friendly animal husbandry products were famous and m demand on the mark diets (he alth food diets) due to its high raw protein content
ets of
and agriculture for private and state owned farms on nature Europe. The new flavour and good character of these "re . and rich microelement constitution. Its favourable qualities,
gion-
preserves and their protective areas" under the aegis of the specific" products made them beneficial for hum hardyness, weedsurpassing ability, great resistance against
. an
Nature Preservation Office of the Ministry of Environment consumption. T e archaeolog1cal recrd however conta
pests make einkorn a prime candidate
for chemical free
ins
and Land Development (Tardy 1994). Our project connects d o mesticated fnnt seeds and plant remains. The floral remain cu ltivation.
s
with the Biodiversity Protection program. of medieval sites help us t learn about the species ot the We wish to produce in a pure biological manner frnits
Our main tool is archaeobotany. In contrast to pollen p eiiod. The une arthed botamcal matter is the exact mirror of (pples, pears, peaches, apricots, plums, cherries, sour
analysis, archaeobotany (concerned with the evaluation of seed past production and plant knowledge. The archaeological data cherries, walnuts) and grapes. They are all famous ancient
and fiuit remains) concentrates chiefly on finds that were can be used to cross-reference the existing historical and region-specific species that are pushed onto the periphery in
deposited as a result of human activity. This discipline deals iconograph y sources. Archaeobotanical interpretation is a the Carpathian region for different reasons. Our team with the
with the identification of plant remains and associated major element in the study of historical ecology. The study of h lp of the University of Horticulture and Food Industry,
e
artefacts, historical sources (iconography and written data) and plant remains can help us understand local subsistence Budapest, and the Pannon Agricultural University, Keszthely
those areas of the social sciences that concerns agriculture. Its p atterns, plant use, past environments and their utiliz ation. collec ted the old frnits and grapes species from rare refugee,
focus is the relationship between man and environment and The ancient cereals, fruit and grape species collected on the from their own native growing sites in the Carpathian-basin
human economic activities in the past. model lots provide the means for identification of other where they could still be found. We planted near by 200 piece
The major area of archaeobotany is the study of plant medieval plant remains. With the help of the Prism-Imageplus of trees and 100 piece of grapes in 1997 /1998 on Biohistory
domestication, cultivation and the development of agriculture. software and computer system we can conduct morphological Harm, Szarvasgede (Fig. 4).
Ecofact analysis can shed light on past human biological comparisons between plant remains (seeds and crops) from In our Biohistory Farm of Szarvasgede beyond saving and Fig. 3. The einkornfield at the Biohistory Farm.
cultivating cereals that are threatened with extinction we
NeoUthic Roman Period Ugratlon Uddl< Ages
Copper Age Bronze Age Iron Ag<
would also conduct experimental archaeology research. In Bocz (1988) analized the macro- and microelement
middle late Barbaricum Period
early middle late Pannonia early la
u u u u u u u u 0 Q Q Q this case we built in 1997 an early medieval ( Arpad Age) composition of ancient and of 18th century steppe plough
= = = = = = .. " "' <
8 8 8
.. pithouse founded on the motorway excavation: excavated by wheat crops. He compared the results with data gained from
"' " "' 8
...
"

'" " " '

Zoltan Beneze (Budapest Historical Museum), designed by recent plough-wheat analysis. He notes that with the advance of
illibor Sabjan (Enthnographic Museum, Szentendre) and improvements the nitrogen/phosphorns, nitrogen/potassium,
Miklos Takacs (Archaeological Institute of the Hungarian and nitrogen/magnesium ratio decreased in the grain while the
Academy of Sciences) (Fig. 5). nitrogen/calcium, nitrogen/manganese, nitrogen/zink and
nitrogen/copper ratio increased.
Nutritional value of
to------ --------------- The food remains from Hungary
the ancient cereals

Kiirber-Grohne (1989) pe1formed comparative growing We intend to reconstruct this ancient plant cultivation and
experiments with einkorn, emmer wheat, spelt, durnm wheat, food consumption using the latest scientific data. Through
plough wheat, double row bare barley, rye and oats in chemical analysis we will learn more about the value of
Stuttgart/Hohenheim and in Schwabis Alb. Their results on ancient cereals. The analysis of cereal and food remains poses
crop inner content values (ppth. weight, raw protein, a great challenge. This work requires simultaneous familiarity
Carbohydrates, raw fat, ash, raw fibre and dry matter) are with botany and chemistry.
Useful for quality comparisons. According to their test results An increasing number of archaeological excavations have
the average raw protein content of ancient chaffed cereals been accompanied by scientific analyses during the past few
(einkom, emmer wheat, spelt) is 50% higher than that of decades. As a result, prehistoric food remains have also been
ploug h-wheat. The raw protein content of plough-wheat is recovered. Remains of carbonized bread were found
- -
about the same as in barley, rye and oats. This is especially following the water-sieving of samples gathered on the floor
chara cteristic level of burnt Ottomany (Middle Bronze Age) culture houses
-
with einkorn and emmer wheat where one fifth
---- 20%) of dry matter in the crop is raw protein. Fatty content at the tell settlement of Turkeve-Terehalom (led by J. Tarnoki
18 about
---- - 30% higher in chaffed wheat. The highest is in oats. in 1990). The porosity of charred pieces, that is the size and
l'he c arbohydrate content is the highest in baie barley and rye. shape of holes, shows the typical strncture of leavened bread
It is important to note that raw protein and carbohydrate (Gyulai unpublished data).
content During study of the inside of another sherd from the
in the crop depends on the nitrogen content of the soil
(nitrogen Copper Age site of Zalaszentbalazs-Sz616 hegyi mez6 in
fertilizers increase it), on the climate (warm, dry
We a ther increase the value) and on the morphology of the crop Hungary (led by E. Banffy in 1992) using a stereo
few, common
(the raw
protein content in flat seeds is higher than that in microscope, a small brownish-blackish spot of typical burnt
roun d
Fig. 2. Characteristic finds of plants from Hungmy. seeds) (Brouwer 1972). food remains was discovered (Gyulai 1995). The shape, color

198 199
Gyulai, F. Biohist01y Jann on Szarvasgede (Hungmy): a case for biodiversity conservation

i
;;

::f 1
i :
Fig. 5. Early medieval pithouse reconstruction in Szarvasgede.

and thickness of this spot, on the other hand, is very similar to as a result of burning, their elongated shape may still be
analogous remains found at lake dwellings in Switzerland and recognized. Seed germs fell out of these seeds which may be
Southern Germany and to what was identified as simple flour indicative of cleaning since germs are often lost during the
soup (Wahren 1985). This may be an example of "seasoning" course of threshing and cleaning. Carbonized lumps of
of ceramic dishes to be used for cooking by sealing pores of ground meal were also found probably made from millet
these vessels with this sticky kind of fine flour soup. because they included clumps of two to ten millet seeds
Following this stage, the dish would not be washed in order to cemented together. It may be reasonably assumed that these
make sure that the substance cemented into the pores made it finds were deposited in the pit within a short period of time,
waterproof (Fig. 6). if not simultaneously. It is also possible that they were already
During the course of excavations at Keszthely-Fenekpuszta burnt during the cooking process or subsequently, together
in 1980 a 60 cm thick, ashy layer was found when a pit dated with other artifacts (Gyulai 1996).
to the Celtic Period was excavated (led by I. Erdelyi in 1980). When the residue was sorted under a stereo light
The archaeozoologist Istvan Takacs (Agricultural Museum, microscope, numerous animal remains were found as well.
Budapest) collected significant amounts of fish remains here Within this assemblage, the archaeozoologist I. Takacs
as well as some 1.5 liter's of black, ashy sediment. L. identified a number of bones from fish and small birds, which
Bartosiewicz archaeozoologist (Eotvos L6rand University, showed signs of roasting.
Budapest) carried out the identification of animal bones.
Ma croscopic as well as microscopic analyses took place in the
Archaeological Institute of the Hungarian Academy of
Sciences in addition to analytical studies (macro- and trace
ele ment, amino- and fatty acid analyses) at the Central
Laboratory of the Faculty of Animal Science at the University
of Agricu
ltural Sciences in Kaposvar (by J. Csap6). These
rnet hods all lead to the conclusion that the grayish-black ashy
layer, rich in
fish bones, were the remains of a "fish supper"
(Gyulai unpublished data).
Carbonized food remains recovered from a Tumulus (late
Bro nze
Age) culture refuse pit at the site of Balatonmagyar6d
idvegpu
szta (led by L. Horvath in 1987) are worthy of
discussio
n as well. A significant portion of archaeobotanical
finds o rigi
nated from legumes. All of these seeds represent
Vege tab
les popular during the Bronze Age including peas
(Pisum
sativum), ervil (Vicia ervilia) and chickling vetch
(lathyrus
sativus). Husked seeds from true millet (Panicum
Il1
l1a
[" c
e um)
are carbonized. Although these pieces puffed up Fig. 6. P rehistoric food remains on ceramic sherd.

200 201
 Gyulai, F.

RS
p&OCESSING FISH WITH OBSIDIAN TOOLS: THE MICRO-WEA
The material obtained for study also contained a significant
References
number of carbonized remains ongmating from a
homogeneous but spongy material. They seem to be Bocz, E., 1 998, Buza:
osi fajtaval-telj'es . IOVINO, M. R.1
fragments of a piece of larger volume. None of the fractured . nun ose ge t ru,._
N

wit. h o 1d vanetas-complete
quality) U 1 ,, n
surfaces displayed holes, bubbles or cracks: the small, round agyar
gazdasag 53, 14. '
Me14 Viale Tunisi, 8, 96100 Siracusa, Italy, e-mail: miarosa@tin.it
pores were evenly distributed. These fine holes cannot be the Brouwer, W., 1972, Handbuc
h des speziel/enP
'jlan zenb
result of fermentation caused by Lactobacillus lactis. They ( ",
vve1zen, Roggen, Ge ste, Hafe aue s /,

r r Mais) B Ii
are rather indicative of the baking of an evenly kneaded, fine ayuiat, F., ' . er n

dough. The even porosity is also suggestive of baking at a

1995, The plant and food rem
Age settlement at Zalaszentbala
ains from t
hee p

J)unng1
. the Mesolithic and Neolithic
periods, fishing was important. In an archaeological context, it is difficult to understand

e exploited this natural food resource. In

several sites near the sea fish bones are not always fiound. The absence o1
pe eoP.
zs-Szoloh O pe

high temperature in a hot and evenly heated oven. egyi. mez0 r

Szo.1'"'1.e, B . M (ed ), Archaeology hoW pH soil nature. Functional analysis can attempt to find lost data.
and Sett/ emen ' .in s could depend on behaviour or it could depend on

,.
r mat
. .
These data, in addition to the instrumental analyses (the m the Ha/10t Basin, South
-West Hung ary
An t H istory ftsh Ju nctwnal. studies have addressed the micro-wear jirom processing fish with obsidian tools. In two well preserved
tae us 22
identification of Phytolits, macro and microelements, amino 145- 1 57 . '
, fsW . h.
1e o ltt ic
-Neolithic fishing sites (Vzzo's Cave, Trapani, Sicily and Franchthi's Cave, Argolide, Greece) we have conducted
and fatty acids) all indicated that remains of Bronze Age : "' ' s . Sparus aurata, Dtp1odus sargus, D entex dentex,

Gyulai, 1 996, Balatonmagyar6d-H

fdvegpuszta
Perimen tal scaling and butchering of many fishes: Thunnus, Ephinephelus,

kesQb nz
strawberry shortcake were found. The dough was made of IJJerent k"in d oif
fonnatwn from tI1e d'f'F.
:

kon telepiiles ntivenyleletei es

wheat flour reaching modem industrial quality as well as
millet flour mixed with lard.
Conclusions
These reambulated ancient domesticated plants on
Biohistory Farm Szarvasgede can be understood as living part
of an ancient landscape. Their rebirth not only revitalizes
ethnobotanical knowledge of their cultivation and use but it
also generates hope for truce between man and nature. The
essence of ecotuiism is to experience the original human
condition and Szarvasgede is the place to do it. This
undertaking requires multidisciplinary research, the synthesis
of cultural anthropology, archaeo- and ethno botany. These all
together would help preserve tradition, serve the environment
and enhance education.
elelmiszermar ex . halus and Scorpaena scrofa. This case study attempts to observe the nucro wear
adv :
(The plant - and foodremains from the
Late BronzeA
Ylll Mnefrom
the different quantity of worked fish. From this expe iment we conclude that on obsidian implements it
will be
.
ge
ftSoSSI'ble always does scalzng
settlements Balatonmagyar6d-Hfdv
egpuszta) t0 recognise, clearly, the activity of butchering fish. Scaling fish reserves more problems. Not
, ID V:-
audo t' P .
"d ify th e k'md.
L. (ed.), Chmno/ogische Fragen der Vdlke
produc e aw ell-developed trace. Nevertheless when it happens we could have a good reference collectwn to 1 ent1
nvanderung .
s
and the quantity pro
zeit, Zalai Muzeum 6, 169-195. of cessed fish.
Korbr-Grohn e, U., 1989, Niihrstoffinhalte
und andere St tr
m K omem .. von Emmer, E"mkom und Oue KEYWORDS: MICRO-WEAR ANALYSIS, OBSIDIAN, FISH REMAINS.
. . weiteren
Getre1'dearten, ernutte1t m kontrollierten Feldv
ersuchen
Archaobotanik, Dissertationes Botanicae 133 , 4 -SO . Introduction The whole fish is cut into thick slices. The posterior patt is
1 .
Tardy, J., 1994, Te1111eszetvedelem 1994 (Envi cut in another way: it is cut laterally to produce fillet. In this
ronments.
protection 1994), Ktimyezetvedelmi es Teriilet way all the fish meat is suitable.
fejlesztesi A:n extensive investigation with experimental obsidian tools
was undertaken since 1995 in an attempt
Miniszterium Tenneszetvedelmi Hivatal (Natu to understand if Almost all fish posses a cover of scales over the outer
re Pre
servat io n Office of the Ministry of Environment functional analysts might detect differences in micro wear surface of their bodies. There are a lot of good reasons for
and
Land Development), Budapest, 182 p. people scale fish: to make soup, to eat rau, to dry or smoke or
traces from the different kind and from different quantity of
Wlihren, M., 1985, Die Entwicklungsstationen vom Korn worked fish. This paper shows the experimental data. to salt to preserve.
zum
Brot im 5. und 4. Jahrtausend, Getreide, Meht und Brot The scales can be subdivided in four major types upon the
In our experiments scaling and butchering, we considered
39, Bochum, 373-379. differences of their shapes, features and topography.
the fishing sites of Uzzo's Cave (Trapani, Sicily) and
Franchthi's Cave (Argolide, Greece). The fish scales studied here were the ctenoid type (Fig. 1).
We scaled Ephinephelus guaza (grouper), Dentex dentex The ctenoid type is chaiacterised by the presence of ctenii
(dentex), Spmus aurata (gilthead), Diplodus sargus (white or small pointed projections, like teeth, along the posterior
bream), Mugil cephalus (grey mullet) and Scorpaena scrofa
(scorpion fish). All these fishes, after scaling, we also FOCUS POSTERIOR
butchered. Butchering consisted primarily of cutting the head,
FIELD
the tail and cleaning the entrails.
At Uzzo's Cave neuro-cranium and tail's vertebrae of
Ephinephelus sp. are scarcely represented. This anomaly
could be related to some butchering treatment made before to
intro duce the fishes in the outside talus (Cassoli &
lfaglia cozzo 1995). The use wear analysis on a sample of
obs idian tools from the Neolithic levels (trenches W, F and M)
of Uzzo's Cave (Iovino 1996, 100-101) confirms this
hypo thesis. Use wear analysis attests that the Neolithic
inhabitants used these tools also to scale fishes.
We decided to butcher Thunnus thynnis2 (tunny) because of
its abundance in the Neolithic levels of Franchthi's Cave
(Pay ne 1975).
As all Scombridae fishes, Thunnus must be eaten as soon as
possible after the capture. After decomposition its meat
become poisonous (Lythgoe J. & G. 1973).

The w ay to process thunnus is the following:

- First, the head is cut.

- Second, the fish is cut with a lengthwise, into slices. RADII (ANTERIOR FIELD)
Fishermen told us a lengthwise cut is necessary to cut the
first part in smaller pieces, to eliminate the blood inside Fig. I. Ctenoid scale features and terminology
the meat. (after Casteel I 976: 44 ).

1
Consulting Engineers and Archaeologists-ARCHAEOME TRY R ESEARCH L ABORATORY- VIA G. MINGAZZINI, 7 - 00161 ROMA-ITALY.

1
This fish has very small scales in almost all body, only close to the corsaletto has bigger scales. Also these scales are ctenoid, but with very small ctenii.

202 - Ce11t1: Eia: Sei: 1.

of the 31" Jntemational Symposium on ArclweometT)'. Jerem, E. & T. Biro, K. (eds.), Archaeopress -Archaeolingua, BAR
Proceedings
 tools: the micro-wears
Processing fish with obsidian
Iovino, M. R.

:
margin of the scale (Casteel 1976). Even if all our scales are The cutting of fish generally produ ces a cle
ar
ctenoid they show differences in their shape and in the ctenii's alteration with noticable features. The edge is o ce
ften g tly
shape. Dentex dent ex shows a good development of cteni i, rounded, but more rounded edges were also o
bserv ed
like a comb, while the other scales have very small ctneii, Sometimes one can observe on the edge a slightly

s 0
0th
almost imperceptible (Fig. 2). polish never invasive. The striations are mostly
ough.
Another difference w e underline here: Dip/odus sargus, bottomed and sleeks, but also intermittent str iation
. could
Sparus aurata and Sc01phae11a scmfa have less resistant occur. They show a parallel and diagonal orientatio
n. S!ight
scales. Ephinephelus, Mugi/ cephalus and Dentex dentex h ave bands of attrition are visible near the edge but mostly o
f them
more resistant scales. are away from the edge (Fig. 3).
The cutting of Thunnus produces a different wear pat
te
?
c:J
MUGIL CEPHALUS The edge is rounded, a dull smo th (little corrugated)
DENTEX DENTEX pol l
occurs. The transformed surface is covered with a lot of
short
parallel intermittent and rough-bottomed striatio ns. Sleeks
are
scarcely attested. Some narrow bands of attrition are vis

a
ible
EPHINEPHELUS
SPARUS AURATA
away the edge, but in some cases patches of attrition are als
o
visible on the rounded edge. The wear is very invasi
ve
(1000 mm), and it looks like a band along the edge (Fig. 4).

DIPLODUS SARGUS SCORPAENA SCROFA
Scaling of fish is more difficult to detect. It is almost
. on
cati 20x 4x.
impossible to observe any diagnostic surface modification l o b s1'd'tan tool . Magnifi
s fish with an experimenta
Fig. 4. Cutting Thunnu
Fig. 2. Schematic representation of the difef rent typo logy scaling only a few fish or scaling fish which are not fresh .
of the scale's shape of the fishes object Scaling fish does not always develop a diagnostic micro wear
of our experimental activity. pattern. The used edges, usually, shift from slight to rounded.
The scaling of some fishes like Spaurus aurata and
Data Scorphaena scrofa did not give any peculiar wear. The tools
show only few short, narrow, deep and shallow rough
We attempted to observe the eventual divers characters in bottomed striations. The same pattern was observed scaling
the micro-wear traces formation result from scaling and 3 kg of Diplodus sargus.
butchering the above fishes. Slight edge rounding, few sleeks and rough bottomed
We employed different quantity of fish, beginning with few striations, narrow and wide, mostly deep, with perpendicular
hectograms up to six kilos. orientation were found on the experimental tool used to
The experimental tools were mostly flakes with a right edge scaling tree big Ephinephelus fishes. Some band of attrition
produced with Lipari raw material. we can observe (Fig. 5).
Twenty different edges were used to scale fishes for a total The scaling of Mugil cephalus gives a slight edge rounding,
account of 5 hours and 35 minutes. The minimum single use with few grouped sleeks and some little rough bottomed. The
time was about 4 minutes. The maximum was about 41 striations are mostly shallow and deep. Little luminescent
minutes. To cut fishes w e used eight edges for a total time of attrition we can detect on the used edge.
1 hour. The minimum single use time was about 4 minutes The scaling of Dentex dentex shows a rounded edge, some
The maximum 20 minutes. smooth dull polish, sleeks, rough bottomed and stepped, long
On experimental obsidian tools the processing of fish is and short striations. Severe attrition could be present on the
. gnification JOx 4x.
mostly visible. edge (Fig. 6). Ephinephelus fishes. Ma
. e resulting from scaling
F1g. 5. Micro-wear trac

.
gnification JOx 4x.
. D entex dentex fishes. Ma
e resulting from sea /'mg
Fig. 3. Cutting Dentex dentex .fish with an e).per im ent al obsidian tool. Magnification 20x 4x. Fig. 6. Micro-wear trac

205
204
 Iovino, M. R.
Only after scaling more than 5 kg of different kind of fishes
(Spaurus aurata, Diplodus sargus and Dentex dentex) was it
possible to observe a particular developed micro wear (Fig. 7).
F ig. 7. Micro-wear resulting from scaling 5 kg of fishes
(Spaurus aurata, Dentex dentex, Diplodus sargus).
Magnification 1Ox 4x.
Interpretation
W hat does this case study show?
There are peculiar micro wear formations on obsidian tools
that could help us to determine if people in the past processed
fishes. We can easily distinguish between cutting generic fish
and cutting Thunnus fish. We need better understa nd why
there is this difference in the wear formation. It may depend
on the difference between the meat and the bones structure of
thunnus compared to the other fishes.
Both Semenov (1964: 10 7) and Moss (1983: 104, 105)
considered striation like diagnostic features to determine
working fish with flint tools. T his obser vation is also valid for
obsidian tools ( Hurcombe 1992: 44; Iovino 1996: 9 1). Our
experimental activity shows that, scaling fish causes
observable rounding of the edges and striation. In most cases
these microwears do not show the particular species of
worked fish. We can observe a good pattern scaling dentex.
8. Residue of a scale of Dentex dentex observed on the suiface of an experimental obsidian tool. Mag ifi w
F ig.
206
fff WARP-W E IGHTED LOOM IN THE CARPATHI AN B S IN (HUNG ARY)
E
Workin g this fish, probably from its scale chara
cters .
'With EXP ERIMEN T IN THE ARCHA EOLOG I CAL PARK, SZ AZHALOMBATTA
high ctenu, we have a good development of stria
.
tion in th ...
n ucro wear. e
By chance, some of the tools used to scale Dentex
HORVATH, T.1 & MARTON, E.2*
de
and Ephinephelus show a clear residue of scale (Fig. .
8) 1/nstitute of Archaeology, Eotvos Lorand University, Miizeum krt 4b, Budapest 1088, Hungmy,
r
future goal in th is field will be to observe the diff
erenc
1053, Hungal)>, e-mail: martone@koi.hu
between the residue scales to distinguish the different
kinds: 2corresponding auth01; Cultural Heritage Directorate, Magyar u. 40, Budapest
fish processed.
Acknowledgements Th e main topics of this paper are: A - the excavation evidence of weaving in authentic archaeological material in
f{ung ary, B -
the constntction evidence of a loom based on these archaeological data, the weaving experiment.
The author wishes to express thanks to Sig. Valentino de
KEYWORDS: WARP-WEIGHTED-LOOM, "IN SITU" FINDS, CONSTRUCTION-RECONSTRUCTION.
Sanctis and to Dr. Ing. Bruno Maturi for their help for scaling
and butcherin g fishes.
The excavation evidences
References
They can be divided into two groups: one of them includes
Cassoli, P. F. & Tagliacozzo, A., 1995, Lo sfruttamento delle the textile remains and the textile imprints on several objects,
risorse marine tra ii Mesolitico ed ii Neolitico alla Grotta the other the 'in situ' found loom weights problem.
dell' Uzzo (TP), Atti del I Congresso degli Archeozaologi
Textile remains
ltaliani (Rovigo 5-7marza1993), Padusa, 157-170.
Casteel, W., 1976, Fish remains in Archaeology and
An idea prevails about prehistoric textile in the Hungarian
Paleoenvironmental Studies, Academic Press, N. Y.
Hurcombe, L., 1992, Use wear analysis and obsidian: theory, archaeology: the soil here is absolutely incompetent for
e xp eriments and results, Sheffield Archaeologieal conserving the textile, because it is too dry. The one-time
restoration practice also suppmted that idea, because all the
Monographs 4, Sheffield.
metal objects were cleaned up by chemical methods. The
Iovino, M. R., 1996, La funzione dell'ossidiana: un approccio
result is the well-known green or yellow bronze object without
s p er imentale al problema, Origini XX, 7 1- 108.
Lythgoe, J . & G. 1973, II libro completo dei pesci dei mar i
any organic matter stored on the shelves of our museums.
Today we know only a few, unpublished, textile remains from
europei, Mursia, Milano.
the Neolithic and Copper Age periods and they are known
Moss, E., 1983, The functional analysis of flint implements,
l
British Archaeological Report, Intemationa Series
177, from personal remarks of the archaeologists (Table 1).1
F ig. /. Site Nagyrev-Zsid6halom,
Oxford.
from Textile imprints figural representation of a caipet on the loom.
Payne, S., 1975, Fauna! change at Franchthi Cave
Archa eo
20,000 BC to 3000 C, in Clason, A. T. (ed.),
erdam ,
Zoological studies, North-Holland, Amst
Oxfor dI Incised and painted decoration on pottery imitate textile
patterns. Pots with a painted textile pattern had been
American Elsevier, New York, 120-131.
Semenov, S. A., 1964, Prehistoric Technology,
Cory, Adams decorated by a stripe of fabric dipped into paint. They are
and Mackay, London. known from Neolithic and Eneolithic sites.2 We can say the
same about the Bronze Age pottery. 3
We have one curiosity as well from the middle Bronze Age:
some symbolic figural representations of a carpet or a loom
(Figs. 1, 2 and 3).4
Weaving material can be demonstrated by all of these
sources in the Iron Age as well (7th-4th century BC). Textile
imprints can be seen on the following published iron objects:
the certosa fib ula from a cremation grave of a 1-5 year old girl
(Szentl6rinc), the iron ring from a tumulus grave Kismez6.5
Textile imprints can be found on a pot from the fortified
settle ment of Szazhalombatta and on a ring shaped loom
We ight from stray finds of Velem-Szent Vid.6 We should also
mention the well-known figural representation of the weaving F ig. 2. Site unknown, Szalnok, Damjanich Museum,
process on the um from Sopron Burgstall.7 figural representation of a carpet on the loom.
I
2 H orvath & Marton (1998), ann. 6. 8.
Asz 6d: Kalicz (1985, 1998); T. Biro (1992: figs. 18.2, 21, 22). See in Horvath & Mruton (1998: 258, figs. 4-6), Asz6d, Se: in Kalicz (1998: 80, abb 25-6;
3 82, abb 27-9; 122, abb 50; 123, abb 51). Textile or basket imprint: Zalaszentbalazs-Sz616hegyimez6, Early Copper Age, in Banffy (1995: 20, abb 6-3).
Ember (1952), see also in Horvath & Marton (1998: 260, figs. 9-10).
,
Kalicz-Schreiber (1984), see also in Horvath & Marton (1998: 259, fig. 7).
m (1968: 169, t. XXXVIII, 1-2), Vadasz (1997: 29, abb 2-10).
, Jere
,
Szazhalombana, unpublished, unrestorated material Str. Unit 23/1994 from E. Marton's excavation. Velem St. Yid: Hrivnak & Polka (1998) dissertation of
1 Berzse nyi D. Highschool, Szombathely, Dept. of History (1998) (in manuscript, with pemlission of the authors).
. JOX 4x.
n cat n
Gallus (1934).
Proceed
ings of the 31" Jntemational Symposium on Archaeometly, Jerem, E. & T. Bir6, K. (eds.), Archaeopress -Archaeolingua. BAR - Centi: Eiu: Sei: 1.
 HoJ111ith, T. & Marton, E.
The warp-weighted loom in the Carpathian Basin (Hungmy) - Experiment in the Archaeological Park, Szdzhalombatta

AGE SITE CULTURE FIND No. SHAPE of the weight LOOM and
SITE CULTURE FIND No. SHAPE of the weight
L OOM and i\GE WEAVING
Neolith Tiszajen6
Kiiriis weights ? pyramid WEAVING
Bajc-Retz trawl remains ?
Neolith Gyomaendr6d
Kiiriis textile imprint warp-wei
g pe r Gy6r-Szabadretdomb
5 hted cop pot with basket basket weave
szen tbalazs Late Lengyel
(line) ;;,rp _weighted er Zala
copp weave imprint
basket weave s drrecti
on
of twisti Tizaujfalu- Baden piece of a fiber
(Salix sp.) ng copp er
Neolith Devavanya (line?) grave "s" direction of
Protovinc a weights tabby vmhegy
5 ring, 'tomato' -shaped twisting
Neolith Devavanya- wa rp-weig
Szakfilhat? two rolls of weights hte d
Rehelyi-Gat H6dmez6vasarhely- Perjamos? small bone tablet stray find
Tisza? between two post holes 21 Eaf lY
conic with 6 holes tablet weaving?
in a house warp weig
hte d ze Szaklilhat
Bron 3x3 ems
Neolith Magyaratact
Emly Linear Pottery pot with matting carpets 2
Hatvan pots with textile imprints ?
warp weigh T6szeg-
imprint ted Bronze
"z" directi on Laposhalom
of twisting Szigetszentmik16s Nagyrev, Vatya pots with textile imprints ?
Bronze warp-weighted
Neolith Szeghalom-
Szakfilhat? supposed loom ? ?
twill
Bronze P
lrnzdvar
.. ..
, Vatya weights ?
Kovacsdomb cilcske-Vorosgyrr Nagyrev,Vatya weights 3 pyramid warp-weighted
Tiszai? Bronze B
Neolith Tcirekpuszta-Kavicsbanya Szazhalombatta Nagyrev, Vatya weights 18 pyramid, sphere warp-weighted
Linear Pottery pots with textile imprints 2 Bronze
Neolith Mesztegny6 ? unafiildvar Nagyrev, Vatya weights ? pyramid warp-weighted
Linear Pottery pot with textile imprint 1 Bronze D
Neolith Pari-Altacker naujvaros- Nagyrev pot with loom- a supposed
Transdanubian textile imprint on the 15 Bronze Du
warp weight d Kosziderpadlas representation loom with carpet
Linear Pottery base of pot e 2 a supposed
Nagyrev pots with loom-
"z" direction of Bronze Nagyrev-Zsid6halom
twisting representation loom with carpet
Neolith Bazsi Vatya I II. weights ? conical warp weighted
Late Transdanubian textile imprint on the tabby, twill Bronze Alpar-
warp weighted Vardomb Koszider
Linear Pottery base of pot
Neolith Battonya- Vatya weights ? pyramid warp-weighted
Early weights from a h ouse,
tabby Bronze Kakucs-Balladomb
? Gava weights 2 ring stray finds
Parazstanya Szakfilhat warp weighted Late Baks-
seclion V.
Neolith Battonya- Bron ze Temet6part
Szakfilhat-Tisza piece of a thread, ?
Parazstanya ? Janoshaza- Urnfield textile debris from ? ?
house No. 6. Late
Neolith H6dmez6vasarhely Bronze Orszaguti du16 grave No. 1983/2
Tisza weights with textile
warp-weighted Nemetbanya Urnfield weights, 3 ring, pyramid warp-weighted,
debris Late
Neolith H6dmez6vasarhely- small bone tablet 7 tablet weaving?
Tisza textile debris from a Bronze-
Gorzsa ? Early with holes, 9x4 ems 1
girl's grave
Neolith Szegvar-Tuzkiives Tisza Iron
weights
Neolith Ocsiid-Kovashalom warp-weighted LB-EI Kese116hegy-Ziiriighegy Urnfield weights ? ring, pyramid warp-weighted
Tisza weights star, trapezoid warp-weighted Szazhalombatta- Late Urnfield, weights, a supposed 9 ring, pyramid, warp-weighted,
Neolith Gyomaendr6d-Endr6d Tisza Late
textile imprint on a
warp weighted Bronze- Sanchegy Hallstatt C-D loom, sphere width: 200 cm
grinding stone
"z" direction of 0 Early pot with basket weave
(vegetable fiber-line?)
twisting lron imprint
Neolith H6dmez6vasarhely- tabby LB-EI G6r-Kapolnahalom Urnfield, Hallstatt pits with weights ring, decorated warp-weighted
Tisza matting imprint 4
Kiikenydomb "z" direction No.E-F/5 "c" pit 8 pyramid
(Typha latifo/ia)
matting weave - No.I-6 "c" pit l
Neolith Battonya- twill 9
Tisza pain1ed textile imprint 3
Giidriisiik "z" direction of LB-EI Velem-Szent Vid Urnfield, Hallstatt weights 5 ring, pyramid, warp-weighted
on pot
twisting 6 sphere, donut
(yellow)
tabby lron Vaszar Hallstatt C textile debris o n iron ? tabby
Neolith Se ring of a bridle
Early Lengyel bowls with textile 2
tabby Iron Kompolt Pre-Scythian debris of cord from a 8 "s" direction
imprints
Neolith Asz6d- Hallstatt B3 well ? of twinning
Lengyel weight and grinding
Papi fiildek pyramid warp-weighted (bast fiber)
stone with textile
tabby Iron Saghegy - Hallstatt C textile debris on iron tabby
imprints 1
Neolith Asz6d- Kismez6 ring of a bridle
Lengyel painted textile imprint 2
Papi fiildek ?inkle weaving or Iron Fehervarcsurg6 Hallstatt C-D weights 2 half-ring warp weighted
on a vase
twill Iron Sopron-Burgstall (Varhegy) Hallstatt C-D weights, ? pyramid, ..? warp-weighted
(yellow)
um with loom
Neolith Asz6d- representation
Lengyel rolls of weights 32
Papi fiildek truncated pyramid warp weighte d Iron Sopron-Krautacker La Tene A "the weaving house" ? weights warp weighted
Neolith Kajlirpec- Iron Szentl6rinc La TeneA fibula with textile debris tabby
Lengyel matting imprint on a
Pokolfadomb matting weave Iron Szentes- Scythian textile debris from the ?tabby
base of pot
Neolith Zeng6varkony Vekerzug grave No. 53.
Lengyel matting imprint on a 2 matting weave - Iron <:;sanytelek- Scythian textile debris from the ?tabby
base of pot
?twill Ujhalast6 grave No 16. 44. grave
(Typha latifolia) Iron ?tabby
Neolith Bicske Sandorfalva- Scythian textile debris from the
Sopot-B icske weights?
Eperjes grave No. 1 38.
objects with 2 10 star ?lucet or threa d Iron Tiszavas vliri La Tene C a ring shaped weight on ring ?warp weighted
or more arms
Neolith Nemesvlimos-Balaca winders the woman's basin from
Sop ot-Bicske weight with animal
conical - zoomorphic, warp-weighte d No. 3 1 . inhumation grave
head
thread win ders? Iron
Velem-Szent Vid La Tene D? weights ? donut warp-weighted
star shaped objects 3 star 2
with 4, 6, 8 arms Iron
Neolith ecsehely- Bodroghalom La Tene C-D textile debris on an iron 1 ?tabby
Sopot textile imprint on a
Ujmajor tabby knife
base of pot
"s" directio n of No. 1977/10 grave
(hair or kemp?) Iron
twisting Kosd La Tene C-D textile debris from the 5 ?tabby
graves No. 46. 54.

conti1111i11g Table l. Catalogue of finds related to textile artefact.

208
209
 The warp-weighted loom in the Carpathian Basin (Hungary) - Experiment in the Archaeological Park, Szdzhalombatta
Ho111dth, T. & Marton, E.

Fig. 3. Site Szigetszentmikl6s, figural representation of a loom.

'In situ'found loom weights and their problem
The idea - All the archaeologist can suppose, as Barbers
says: 'The most direct proof that a set of weights belonged to
a loom comes when the loom happened to be set up for use at
the time it was destroyed, so that the weights are found lying
in distinctive rows, having dropped a few inches to the ground
when the warp threads from which they had hanged were
destroyed by fire or decay. Such was the case at Troy... :
between two post-holes and the wall lay three or four rows of
clay loom weights just had fallen (Blegen 1963: 72)'.
The main question of our experiment was: how is it
possible?
'In situ' evidences
After collecting and analysing many published or non
published archaeological evidences of the so called 'looms'
in Hungary, we realised that from the earliest Neolithic data
(Tiszajen6-Szarazerpart, 14C date: 7000-6000 BC)9 until the
Iron Age 'weaving pit' (G6r-Kapolnadomb 14C data:
269040 BP, 892-872 BC and 288040 BP, 1138-992 BC)
(Fig. 4)10 we find the same authentic circumstances in the
excavations: a lot of weights in rows and two timber holes.
There are differences in forms of the weights and in the
estimated distance between two post holes. The number of
weights could be indifferent. In the published prehistoric
material of the Carpathian Basin we could not find wooden
remains or other organic matter, as an excavation evidence,
that may be brought into connection with the construction of
a weaving loom. The only evidence is the existence of the
weights and the supposed existence of two vertical beams of
a loom. During the technical examinations, in order to
8 Barber (1990).
9 Selmeczy (1969).
'0 14C data: lion (1996: 184, ann 34). The material of the weaving
reconstruct the ancient weaving technology, we had to buil
d
up a ve1tical loom, making clay loom weights and to construct
a warp with weights.
The weaving experiment
- a constructed vertical,
warp weighted loom11
1. The loom construction
We used several data based on the literature, ethnographic
analogies, figural representations and other archaeological
reconstructions.12
2. Loom weights
The colleagues of Matrica Museum made copies of the clay
weights found in the middle Bronze Age tell-site (Excavation
of I. P oroszlai). They made two types of weights, (pyramid
and sphere shaped), cca 50 pieces. It weights about 100
gr/piece.
3. About the material of the threads
We used linen threads for the warp and woolen threads for
the weft. Our choice was not based on the botanical or
zoological investigation of the tell-site, because the bon e
material has not been analysed yet, the botanical materia l is
only partly analysed.13 We followed the weavers' pra cti cal
experiences, but we do hope, we will find the authentic
answer in the botanical and zoological investigations in th e
near future.
pit I-6 section C will be published by E. Marton with Gabor lion's kind pemussion.
,
Fig. 4. In situ found loomweights of G6r-Kapolnadomb.
4. Rapport
) technic
We wove with plain weave (and basket weave
(Fig. 5). .
the above
This is the most favourite technology m
imprin ts for a long period . The appea rance
mentioned textile
logy is an impor tant issue here. We are sure
of the twill-techno
Basin will
that the archaeological material of the Carpahian
have a surprise in store.
Conclusions
r to
The main task of our experiment was to give an answe
Barber's idea:
tme,
The warps with weights were standing for a long
m a
during the weaving procedure in a pit, in a house or
sanctuary. Weaving could last for some weeks or for ome
ts
months. If the textile was ready, the warp and the weigh
became useless and they were cut down. They have hange d no
more. They were used as real weights, collected in a pit or left
at the same place, under the loom. This is why we doubt tht
the position of the fallen weights could help us m
reconstructing the loom. If you make the warp, you will see
that knotting the weights is simple, and it is not a hard work.
On the excavations the problem comes from the missing parts
of the loom structure: the heddles, the shed bars, the measure
of shed opening. There are no excavation evidences for these
and we have not found any of them in our material. There is
only rare chance that we could register the 'ideal' situation in
an excavation, that is, when the house caught fire and the
Fig. 5. Tabby imprint of Szentlffrinc.
people had to leave their house quickly, leaving a halfmade
carpet or the hanging warp on the loom.
for Istvan Ecsedy, Andras Figler, Ferenc Horvath, Gabor Ilon,

Sza bo Erzsebet Jerem, Linda B. Jorgensen, Nandor Kalicz, Janos

11 Participants of the expeliment: Gabriella Pammer restorer (Matrica Museum, Szazhalombatta), J6zsef Pammer, carpenter (Szazhalombatta) Erzsebet Acknowledgements
weaver (Szazhalombatta), Erzsebet Marton archaeologist (Hungarian National Museum). We consulted with Gyork Matefy, textil restorer (Hungan
an Laszlo, Eva F. P etres, Judit Regenye, Gabor Rezi-Kat6, that
National Museum). we were able to build our database and catalogue published
12 Hoffmann (1964), Jorgensen (1991), Matefy et al. (1993). We would like to say thank for our colleagues, who
above.
13 Gyulai (1996: 6). informed us about their unpublished mate1ial. Warm thanks
1
211
210
 Horvath, T. & Marton, E.

nce s* . 1 er, R., 1984, Sz1m

Refere
Kalicz-Schre'b
. bolikus abni EXPERIMENTS WITH A BOW AND ARROW
bonzkon ede zolaso
nyeken, ArchErt l l l, k ko
' R ., 1995 '* BIVllZ
3-28
.
Kalicz-Schreiber
. PAVLISH, L. A.
que a Tiszavasvan. szentnuklo,s hattir
.
kon urna
aban, Rackevei Muz.
e celti temeto
VJ){. , XXL 1.

rop ol Szi e1
g .
"

ee
,
6, * pottenes and obje
n
Archaeomet1y Laboratmy, Isotrace, University of Toronto, 60 St George st., M5S 1A 7 Toronto, Canada
* U n e 1. Fuz 2
K ., 1999 ' Marton E 199
,
Almassy, 8 7 2 . ,...
;:

7 1 9 9
'

cts mad

199 - der Lengyel-kultur in

'
JAM XXIX-XL, . J<lan g Velem -Szent Y

clay i

. beI. den Aus id, Acta Musei Papen sis 6, n

, 2 0. 249
. hHimg 3
U
Banffy, E., 1995, Marton, E., 1999,*
Velem-Szent Yid 1973 -Ar 3
h
.
, Co mA1 s, Pnnceton.
Trans dan ubi en
r ic t tile
eX paik s in Hungary
, in Btilldi Emlekkonyv Il
c aeol o
gicaJ
eriment s using reconstructed projectile points on modern shafts and employing a modern bow to create a "best of all
Barber, E. J. W., 1
/11st
u
991, Pre
rn, 19 9 '*
forschungen und Tell-
T/ alog.
Savaria, 409-424.
' o n, G
. (ed.
),
Wo
fs,, co nditio n are discussed. The experiments entail the use of a ballistics pendulum and hi h sp ed photography to
& Vaday,A., 1998 ,* Ein
. nga
Bronzezelf 1n , at Matuz, E., Szabo, J. J. .
T heiss
ascedrt
u n d , Pra s a.in the initial velocity of the arrow. In addition, distance tests, accuracy tests and a huntmg smiulation test were
ona u cke auf den Toszeger
Siedlungen an D
J
hi. scher
H
Brunnen in Kompolt
1 abdrii
e T ex u
Ac r h . E. N agy, K., Kralo
u
, CommArchH11ng 45 4
- 6, 3
con u
cted . The amount of force required to break a projectile point is measured and implications for hunting are discussed.
van szky, M., Matefy, Gy & Jar6
2, Di ng. 195 212 ,
Ember, M., 195 . Acta
z e1t, M
r Bronz e : .
gEVWORDS: EXPERIMENTAL ARCHAEOLOGY, ANCIENT TECHNOLOGY, BOW AND ARROW, ATLATL DART,
s de Te t '. ltechnikak, Hun garia .
., 1993,
Gefassen au n National Museum.
. rten Urnen vom Soproner Nov, Gy., 1979* ,
'

139-142. . ve1 z 1e Vorgesch ichtliche und m

Etdfesten m
BALLISTIC PENDULUM, V ELOCITY TEST, ACCURACY TEST, DISTANCE TEST.
Cuha-Tal im Bakonywald
i g u r al itte lalterli.ch
Die F
.. . .
Gallus, S. 1934, st . .
g 13, Bar)' 1t about the Botanic
e
u dap e
Zoro
Kesell
B urgsta11, Re p o
n
Experiment
A rch H u ghegy, VMMK 14, 75-123. Oftegy
. . ,

T he bow
Gyu1a1,
eJi nu n Szazhalombatta, in
F., 1996 ' Pr 'te of Oravetz, H., 1997,* Late
a ]993-1 96, Poroszlai, I.
Te J l- s I . . Ki:iri:is (Protovinca) settle
mbatt
of the 9 me t and
Investigation bunal at Devavany a-Barcei kisha
a lo
a.
lom, CommArc
Four expe1iments (Ballistics, Distance, Accuracy and The bow used was a standard twenty-five pound draw
ombatt
. s- a z h hnung,
Excavation s at 5-25.
l hal Patek, E., 199 3, * We stu l am Hunt Sim ulation) were carried out using projectile points fibreglass one with a multi-strand linen drawstring, loaned for
2 6, S z az hted loom, Studies in the l g ill der Halls tattzeit' VCH A

(ed.) ' l - 6 ,, wmp-weig
, TM im plement, Norway. Humaruora. Quellen und Forsch. Zur
manufactured to an archaeological standard (Epipalaeolithic the study by the University of Toronto Scarborough College

logy 01
., 1 96 4 c ie n t .

Hoffman n, M .ra n a n . priihist. Und p projectile p oint type: Nachorine; cav e site in Anti-Lebanon Sports and Recreation Depaitment. The arrows were purchased
H.uo Te ch n o prehistonc Spinning and vinzi ro. . .
t ryand . *, . alrom. Arch. 7, Weinheim. .
& J.,
18 mountains). Manufacture of projectile pomts was accom from Hercules Sporting Goods, Toronto, Canada. They were
on, E.,
Horva'th, T. e c arp <
B asm (Hungary), in
..
M art an
ung a1 II. Kolto, L. &
i Reg
s fr om th
at h eny e, 1996 ,* Fundorte der Sopot-Kultur
,,
y auf dem plished by first truncating flint blades provided by the standard 74 cm, 20.0 gms (average weight), three feather
Weaving Object
. se a1 .c h e s i n H. Balatonhochland, Com111ArchH1111g, 23-41.
archa eolog y laboratory of Scarborough College (courtesy of fletched, metal pointed arrows with plastic nocking tips and a
l Re
R. B. Schroeder), and then forming the edges and notches
Archaeometnca 49-26
9. Rezi-Kat6, G. 1999,* Kaj<irpec-Pokolfadom
b, poster in centre of balance at their midpoint (approx. 37.5 cm from base).
Bartosiew icz , L . (eds.), T/le T y p o l ogy ?f spin le and
Lengyel'99, Veszprem 11-13, October, abstract
M., 99
8
"'' , p., & Polka,
, book. with a 0.32 cm diameter copper punch. The manufactured
. D1ssertat10n of
ent Vid,
.r
Selmeczy, L., 1969, Das Wohnhaus der Ki:iri:is
s OJ . em - Sz
Hnvni:U\. Gruppe von points were given numbers, and those numbers were placed The hafting
Vel Dep .
t. of History
athely,
weaving weig ht s zo m b Tiszajen6, MFME 196912, 7-23.
seve ral areas of the projectile points so that they could be
school, T.
.
Early Axe
on
D. H i g h Biro, K., 1992, Data Oil the Technolo y of
Berzseny1 g identified in the case of breakage. The ten specimens were The attachment of the manufactured points to the arrow
rip t). l! h a ndwerk der U men-
ta Production (Adatok a korai baltakeszftes techno/O d
vor1 aufiger
(in manusc
as, Ungam). "
Me
. gi
jahoz), Acta Muse i Papensis.
zum each measured for a number of potentially significant shafts required that the metal hunting points and the wood
11on, G . 1996 , , (K onut at V
Be1t..rage .
Gor , E & L'ippert, A.
attributes: length, width above notch, thickness at the base, within them (total weight 1.5 gms) be removed. The shaft end
ttku1t 11 '
felderkultur -
r Jerem . The late neolithic in the Tisza region, 1987, * catalog,
thickness at the midpoint, thickness at point, truncation was then shaved from 9 mm diameter to approximately 7 mm
.e o sthalls ta s
.
.
ngu a : B
Bericht, in Di t Szolnok-Budapest.
ud a p e . .
s V.
. angle, truncation length, point angle, left and right notch diameter for a length from the edge varying from 1 cm to
tbro n z
(Hrsg .), A rch ae o!i ez e it h c he Huge lgra ber in Vadasz, E., 1997, Das Hilgelgrab von Kismezo bei dem
'. l ,
dista nce, diameter, depth and, finally, weight. As a rough 3.5 cm. This was done to test for potential shaft shattering.
c aArcl1Hill g
2 ' * Spa
Jankovich, K.,
3 -81
,, .
1 99 g, Zalai Miizeum 8, 27-39.
t
Sagber
V. Szabo, G., 1996,* Forschungsprobleme der Csorva-Gr uppe
me asure of comparability for the projectile points, the A split was made in the shaft with an Exacto knife and a notch
gend, A meter y
o f Szentlonnc, Acta
der Bakony-Ge e ce standard's weight, and the mean and standard deviation of was then cut to incorporate the stone point. Shallow grooves
n Ag
T he Ir o
Jere m, E ., 1 968 ' und der Gava-kultur aufgrund einiger Fundverbande aus
komitat Csongr ad , MFME StudArch ll, 17-18.
. the manufactured points, were calculated and compared. were then carved around the circumference of the shafts in
8. a n Textiles u ntil AD
The standard weighed 0.76 gms; the mean (X) of the manu
S , 1 96 r o p e dem
Arc h . HA / Eu
V. G., 1997, * Sie Sahen die Tore von llioll. F1mde aus
Norfl alignment with the notches in the stone points. The points were
L. B. , 1991, Szabo,
forgensen, , factured points was 0. 78 gms with a standard deviation of then bound into place along the notches with Strikemaster
enmark
1000, Aa , D A szod.
rh uis o n , der Bronzez eit von mittleren T heiss gebiet, Gyulai Katal6

'd
lu A sl_o
J
mm diameter,
Kuns1
o.18 gms. The mean weight for complete projectile points
n
braided nylon casting line (0.5 25 lb (11.3 kg)
ffkon'fia
' K b emalte Keramik aus
.
985 u d gus ok
.. r Jiche
K alicz, N., 3.
Afcha e olin g ua Ser. Min.
from the Nachorine archaeological sample from which the test) purchased from the Canadian Tire Corporation. The points
K alicz, N., 1 9 98
, Figu
ng s
um Westu
. arn . standard was taken is 0.62 gms with a standard deviation of were then dipped to the binding on the notches in Esso Imperial
.
dem Neolithik o.25 gms. Parowax to hold them in place. Following this procedure the
The points were made from a dark brown Lebanese chert entire shaved shaft area is tightly bound with the nylon line. The
With the exception of No. 6 (Fossil Hill Che1t, Ontario, total binding was then placed in the hot wax for 5 minutes to
Canad a), so uniformity in results might be more likely permit any trapped air in the hafting area to be replaced by wax.
durin g experimentation. The experiments were designed to Then, after removal and cooling, the hafted points and their
determine what the performance characteristics of bindings were dipped in the hot wax quickly and cooled for a
re co nstructed
projectile points might be, and from these half dozen times, which permitted a elem layer of wax to be
character
istics, what the probable modes of hunting might built up on the entire hafting area. The wax was then trimmed
h ave been
:scertain the bow and arrow or atlatl configuration may have
within a highland cave setting. It is not possible to away from the point area. Clear wax was chosen because any
stresses in the hafting aiea would frost the wax and be readily
een tha t
propelled points in antiquity. The vagaries of observable. With a bow and the prepaied arrows the four
arch aeo
logical time will have destroyed most of the clues to experiments above were carried out.
reco nstr
ucting this aspect of ancient behaviour. But, for the
Test 1: Initial velocity estimates
Purposes of
this study, this lack of information is not deemed
he vital. The experiment is that of a 'best-of-all-worlds' or
Ideal typ
e" bow and arrow shaft, one that reproduces an
Idealized
. The most important quality of the bow-anow-stone point
shooting situation ('best-of-all-worlds' from the system that can be ascertained expe1imentally is the initial
illod ern
tech nologist's point of view), so that the stone point
:
rfo rrnance characteristics may be more easily isolated and
velocity that the bow can impart to the arrow shaft and its point

ogue.
ble I catal I entifie
when drawn. Thus, each numbered aiTow was maiked at 30 cm,

s h ed finds to 1'a
References of pubh.
d. 45 cm, 6 0 cm and 66 cm from the nocking tip notch. These
*

ings of the 31" /11tematio11al Symposium 011 Archaeomet1). Jerem. E. & T. Biro, K. (eds.). Archaeopress -Archaeolingua. BAR - Ce1111: Ew: Se1: 1.
212 Proceed
 Pavlish, L. A.
Experiments with a bow and arrow

ages of 7 lbs (3.2 kg), Draw ( c m)

draws were equivalent to bow draw pound Velocity Velocity r the atlatl throws; but accuracy at these distances, except would expect the dispersion pattern on a series of shots to be
28.8 lbs (13.1 kg)1 ots o
16.06 lbs (7.3 kg), 26.2 lbs (11.9 kg) and ballistics hig h s p
ee d the general direction, seemed out of the question except larger than that which would be expected today with
draw lengths were endulum
The initial velocities for each of these hoto a
h ifl sibly in ideal conditions with a great deal of practice. standardized equipment.
high speed, stop 30 9 m/s -18 m/s 13 .5 mis Po
calculated using a ballistics pendulum and - 18.4 mis Af l the stone points survived the forces of impact to which
45
Test 4: Huntin g simulation test
18.5 mis - 25.3 m/s 27.8 mis
action photography (Table 1). 60 - 29.8 mis theY were subjected (approximately 0.5 Newtons or kg per
second for each 27.5 mis - 35.3 m/s 32 8 mis
In summary, the velocities in metres per - 35 9 's
66 2_.:;;
, nc:.... J/.:....s -_4,; /s : .621m1.s 429 "u
3:..:::. 8

18.50 mis - 25 .25 .;;,30.:. ;:, m

:..: ....: Jlletre).
dra w ranged from 9mls - 18 mis (30 cm),
____

While the first three experiments were designed to establish

__

mis
_

Test 3: The accuracy test

cm) and 0.0 mis -
mis (45 cm), 27.50 mis - 35 .3 mis (60

general performance parameters of the projectile points, the

Table 1. Velocity data cal c u lat
ed
stone pomt arrows.
42 .0 mis (66 cm) for the standard and fourth attempts to ascertain what point performance is in a
from several arrows of differing we i gh s u s
t
are noted above, it
While the extreme values of velocities
g llhe purpose of the accuracy test was to determine the simulated hunting situation. To accomplish this end a section
a ballistics pendulum and high sp eed ph
oto g , n h
lum test will yield

d that the ballistics pendu

must be pointe out
The velocity varies as the inverse square 0r
'. relative accuracy obtainable with arrows having stone tips in
of beef rib was purchased at a butcher shop in Kensington

th e weight.
slightly lower velocity values than those
calculated from the ap _Y n with a standard metal-tipped arrow. The experi Market in downtown Toronto, Canada. The cut of meat
com p a riso
photography. ment co nsisted of shooting arrows from a kneeling position at weighed 9 lbs 14 oz (4 .5 kg) and was composed of layers of
from v + dg where v (velocity) the sque meat, fat and bone. The average thickness was 8 cm.
ro ot of th prescrib ed distances (2 , 4 , 6, 8 and 10 metres) into a
Test 2: Distance exp eriment
=

distance (d) x gravity (9.8 nJ/s) compared to arr e

<U
o w ve1 c . .

target with a 7-cm diameter bull's eye centred The length was 29 cm, tapering to 17 cm, and the width
0 lties styrofo am
in the field of approximately 3 0 m/sec) T .
his ve i o ci
ty is I m etre above the floor. The experiment was conducted in two averaged 21 cm with a maximum width of 24 cm.
e the distance
The purpose of this experiment was to determin equivalent to a draw on the experimental bow

. . of b e tw ee 45 parts. Part One consisted of shooting, with a 60-cm draw, a The experiment was conducted by hanging the piece of
to a standard n
ling system would impart and 60 cm which would create impact forces
that a modem propel quite adeq stan dard an-ow from the five positions and then shooting the meat backed with newspaper on the styrofoam accuracy test
compare these results 1
ior killi ng aru ma s, 1'f a degree of accurac y cou
uate
arrow and a stone tipped an-ow; and, to "

ld be attaine sto ne tip an-ows as a group without individual discrimination. target and shooting a standard arrow and stone point tipped
. 1
an atlatl.
. d.

attained with This s1mp e expenment suggests th at the b alaii

fu Part Two the standard and an-ows were shot individually to
with the distance that could be ce o n light an-ows at prescribed bow draws into it. An important caveat
was determ ined that the balance of the atlatl darts of 2 0 gms compared to much heavie
At the outset, it r darts (e g look for independent patterning. to consider in this experiment is the absence of a skin and hair
ng from metal to . .,
arrows was not seriou sly altere d by changi 60 gms) need not be forward of centre; and that they over the meat itself. This ideal situation could not be attained
fhe measure of accuracy was computed by measuring the
1
are capa ble
of pre-det er mining what oher o f ve oc1ues and distances approximate 1y equival

stone tips, but there was no way

ent to much distance and direction of the shoot from the outer edge of the because it is against the law to sell the meat of large animals
complications might be detrim ental to fliht (e.g., weight larger darts. Thus, the small rep roduced points 7-cm bull's eye region. Each shot was recorded and the station with the fur and skin intact3
used in th
symmetry). It was hoped that the flih
uality o the arrows experiment could very well have been used in
an atlatl
at w hich it was made noted. The sum of the deviation from the Basically, the points penetrate well when only dealing with
t into the feas1b 1lity of ancient hunters throwing system if light shafts were used (e. g . , a 77.5
would give some insigh cm long bull's eye is then plotted against shooting station to graph meat, fat or gristle. The standard arrow just sticks into the meat
having made distance shots. . .
,
dart weighing 63.28 gms with a centre of balaiice 25
cm from ically depict the accuracy being attained. The Mean (X) and about 2 cm when shot at a 30-cm draw. However, it regularly
nced-1n playmg
The experiment was carried out at the fe .
the front shot (Archaic Eastern North American
dart SD of the summed values are calculated and are a measure of penetrated the 8 cm of meat at draws of 45 cm, 60 cm and
College Cn'Cie). The configuration) with the same atlatl as the one used
fields of the University of Toronto (King's in the the general accuracy and patterning respectively. They are not 66 cm when no bone was hit. The stone points that strnck the
red using a 2 00-ft poly-cl ad rope chain . experiment attai ned distances of230 ft (69.70 m) and elocities
distances were measu v determined from a centroid, however, and thus should only be bone were broken. While it would be unwise to suggest that tip
and experi menta l arr ows with one of 26 mlsec which is only slightly greater th aii that attained by
The standard arrow, taken as a rough measure of accuracy. Also, the equations breaks would result consistently from low poundage shots into
converted for atlatl were shot at angles of 35 degrees and 45 a sha ft 1/3 its weight)2. The stability of the arrows in flight was calculated by lea st squares fit (Fig. la and lb) are only a
the groun d and at bow draws of 60 cm good, witlI no noticeable signs of instability in either the bow
degrees with respect to rough measure of accuracy because no contingency for
of these shots are listed in Table 2. 140
and 66 cm. The results The Distance Test1 consistent off-bull's eye patterning (i.e., precision) is in
l a t susce
A s one would expect, the standa rd arrow is ple (Test 2) coi:porated into the experimental design. 120
m its sens1Uvtty
to air resistances, and this is expressed clearly The results in Part One indicated that the standard is 100
to both shooting angle and draw. At the outset it must be n?ted
. 35 45 45 consistently more accurate than the stone-tipped arrows. Standard
goal and not
.
the sens1uv1ty

80 y=J.25-36.6
that distance range was the prima ry 60 cm draw 60 cm draw 60cmdraw llhe results in Part Two were less clear cut with stone points
.
to variations in angle and draw. The sample
of shots is adequate ill !ll m. 1-U
y=l6.6-48
Arrow ft ft ft m/sec varying individually in accuracy in comparison to the 60
for the former objecti ve, but not for the latter. (2-3) 285 (86.36) 331 (100.30) 329 (99.70) 30.59 standard. Arrow ( 4-9) was far worse than the standard, and
l length of 61
40
The oak' hardwood atlatl used had an overal 302 (91.52) 307 (99.03) 319 (96.67) 30.31
(4-5)
arrow (5-8) was found to vary from less accurate to more
length of 57 .5 cm. Its total weight was standard 291 (88.18) 316 (95.76) 363 ( 110.00) 30.99 accurate among shooting stations. 20
cm with a working
of balan ce 27 cm from
.
its base. The Atlatl Dart
163 .43 gms and its centr e The primary goal of the experiment was to establish in 0
ed 19.385 gms (3-5) 189 (57.27) 191 (57.88) 190 (57.58) 23.75
'dart' with the nocking point remov ed weight so me quantitative manner the rate at which accuracy drops off
0 2 4 6 8 10 12
e of 37.5 cm from the base. The shots as a function of distance to the target. This goal was attained.
with a centre of balanc Other Exriments Distance Velocity
ft (5'..6 i_n), or
were highly consistent, averaging 190 - from Howard 1974:108:
The accuracy that a hunter using stone points, even on
bow shot distan ces. Their trajectory very true shafts, would attain drops off very quickly, far 140 Distance as a Function of Accuracy
approximately 2 /3 of the
EQUATIONS Are Linear
Brow n ( 1940:213) 74.06 meters 26.94 meters
was very low with respec t to that of the b w shot ai:rows, 56.69 meters 23.57 meters more quickly than the killing power of the arrow. Thus, a 120
T Standard
Peets ( 1960:109)
techniques.
y=l I .5x-55
which may have implic ations for hunting Howard (1974:104) 52.13 meters 22.60 meters hunter dealing with a herd of readily available game might
noted for
100
A
d are equiva lent to those easily kill within a 30-metre range with some degree of
The distances attaine - from experiments by 1-11

unweighted atlatls by Peets (1960: 108-11 0 ) and Howard Pavlish and Thomas 74.06 meters 26.94 meters co nsisten
cy and within 100 metres with random luck. In low
80 y=8.5x-22
and are less than those notd by game density situations, or in areas where the game would 4-9
Y=l5.75x-32.3
(Howard 1974: 102- 104 ) 60
ed by Pavlish & shots into the light breeze
58
and observ

)
Brown (194 0 (Howard loc. cit. ) 1 he spread out over a wide ten-itory, the most useful stone
40
r (197 5). The velocit y attained by JlOint arrow shot would be one made at close range, where Y=l.5x+32
t.
Thomas (1974 ) and Butle
the dart was approximately 24 metres per
second (calculated Table 2. The distance test for anvw and atlatl dar acc uracy
could be combined with killing power. This is 20
readily
apparent when one realizes that with this method of 0
the stn ng at the a ppropn ate Place
to the
was anamed by placing the bow in a fixed post. t.10n and drawmg hunting

The measurement of the poundage pull of the bow there would probably be no need for standardization

1
of ar
0 2 4 6 8 10
required distances with a calibrated scale s pring. al eolithic ro w shafts beyond general parameters in a manner
carried out with a replica of a 20,000 year old mammoth tusk boomeran g recovered from an Upper
Recently, distance and velocity experiments were p
a unda
ge analo
gous to the stone points. Resultant from this, one Fi g . 1 a and 1 b. Accuracy results.
site in Poland (SOO gm). The results of this experimen
t suggest that the range and velocity of a boome rang are comparable with those of a bow with
21.4 gs maY !n
replica travelled up to 66 meters and reached a verage veloc1ues
of 1ess th an 25 pounds, and an atlatl The boomerang
of meters/second. Boome .
th e y e 1ess d' '
a gle will lessen the probability of g an1e observauon and flight; and, 2) l'he acquisition of road-kills from the Mi istry of Resources pemlitted carefully preplanned experiments which evaluated the performance qualities of these
. . . ed 111
confer two advantages on the user: I.) the lo w approach n
1sadvantag
(Bahn 1995. 562).

a s a d in c t w ill travel furthes t wh en thrown directly mto a wmd kind s of

stone points with fur and skin intact. These results are presented elsewhere for two white-tailed deer (Pavlish & Savage 2001).
windy conditions than either bow arrows or atlatl sh ft ; n , fa ,

214 215
 Pavlish, L. A.
Experiments with a bow and arrow

as ob served with a 30-cm

this w shot. Conclusion
ple o f s m atiix of possible alternative hunting modes.
Thus, Howard, C. D., 1974, The atlatl: function and pe1fonnance.
e exam 1, 60 c m and 66 cm suiking bone
bone,
Shots at
o n
draws 0 'fhe rec ove
f 4S cn
ry of t he p omt
s from the bones It is unrealistic to expect ' cut a nd ,
on
:
. he tot al range of possibilitie re

ains, some sense of the American Antiquity 39, 102-104.
Pavlish, L.A. & Savage, H., 200 I , Bone and stone breakage
ak a g e 'fhe b re ak:age of the . dne d res I \\'bl . merit of particular combmau ons of factors can be
c ed b r e . )l u r s
o . pomts was not experiment that must, by its v u ts o
fr m an
ithout losing sight of the fact that all are poss1'ble.
Pro du ery from bow-driven arrowpoints in to two white tailed deer
per s on rf . as nught have been . n ature re . d
. fou r a ce' expected. One assumptions about ancient huntin g t e c h n ' b e basect 11erive , w
requir ed t e oJ on carcasses, in this volume.
at a bove t he bone surface og
ne-me .10 ediatel Y .
y. Neve
at the rtheles
at the b o using an 'idealized materials' approach
References Pavlish, L.A. & Thomas, S., 1974, Field notes: experiments

01 s'
b reak 101 . bec arne mde pendent of the haft. One
. to
. the pro
point did stone point delivery systems is not With biem f
oi nt . o on accuracy and distance of the atlatl, Carried out at
here the P bone th at
was no t nea r the . . o ut
This approach d1d he1 p to elmun ate som
meat surface " Its ad an
Plane w
ok e n
s ide th e hafts and

e of the
v tages
source f aJul, N_
P. G., 1995, Flight into Pre-history, ature 37 , 562. Bronte Creek Provincial Park.
. point br 1
n in the point, while that may have been B Peets, 0. H., 1960, Expetiments in the use ofAtlatl Weights,
broke
variation p res e n t if a reco so
J., 1940 ' Proiectile
.
othet n strucf J points, American Ant1qwty 5,
nt s w ere pronu
ded substantially into srown ,
.
pot o the mea t been attemp ted usmg some ethnograp Ion had
Two . bone, a \s . hic mod
el In addi . 20 9-213.
American Antiquity 26, 108-110.
be d d ed in . this approach to expenmentatio n did hon, J., 1606-1625 [1907], Narratives of Virginia, Tyler, L.

Sm ith,
sutIer, W. B., 1975 ' The
ac compli. . atlatl: the physics of function and
im e (Table 3). re a t a d vantage m hun ting with hafted
.
e, w hi c h was to sh Its . G. (ed.), Scriber's, New York.
objecuv atte mp to
be a. g
abov t isola te
ht e , b rea k and . som pedonnanc e, Plains Anthropol ogist 20, 105-110.
Th ete
mig bon leav e a large portion performance cha actenst1 r . c of the replic e of
htt a c ti. ssue. Suc Native American Bows, Bagley, M.(ed.),
the
ated s tone .
ouId Jiam ilton, T., 1972,
.
. t ha t w le h a breakage pattern the stone-tippe
pomts .
T
po in t s u s . velocities of d a . he
he rn cri pple an arum
now
G.
s for vano us Schumway Publishers.
into t . bow dra York Penna,
ing al. Bow strength and .
slightly
ru d to be less w
quicklY
were found th s
prot ' ut c ompar
a n b
. able to th
c ei t ainl Y pr o bably do not dictate this kind of with a modem stan . ose
wouId obtained dar '
. a \one generaiiza .
d meta1 -ti
"' vel oc1t Y s ueh .
uon s are premature
pped a
rrow.
Maximum distances were found to b e a .
arro"' t tedlY
size, . . p pro x mately t
d 1p le but the se observations do 1
br e ak a ge. A he s an same. Accuracy vaned with ston e tipped a r he

o n s1 d eIs t hi c can
h serv e . rows, but on
ec as testable model th e
when n whole tended to drop off with g r eater rapidi
w
u ns
. id ques o \e , u n Iess a pomt-breakage ty th an t

val p patt istance f om the target. Exp e ri he

r atse an l ern stan d ard d r menta l te
o r ex
d co ns1 derect desirable, one would . sts l ' 2 an
heses . f fo r an
d
h y p ot 3 ceitainly md'1cate that th e stone points wo Id
n t r o l le d
to the exte nt . u h ave had a
be co ac tha t bone would be killing rang e fa r greater than their accuracy rang
could . 1 a c cu r Y on. The empl
conno
. . e. Such an
0perau
.
t o oyment of medium ation 1s totally consistent with historic 4
have tt. ng observ
n . . reco
the hu J ts would not promote this. In additio
. al rds The
in e d the fact th
e d n ' sim ulation expenmen t es ta
a vot d bow s
) o
.1 . . hunting
. .
b lis h
r ange f a projectt e pomt With a central ridge to
at the
l ong bre a on m1pactmg bone.
a nd . no . poin ts k
'"" d e s 1 g s t h a t s u e h p om
gest
ts may have had a The results of the experiments d iscuss e d here 1
th e v e 1
.
t h sug cas e, this type of Epi palaeoli
. a so begm to
. e as e st reng n a n Y thic blish g ene ral patterns which
ncr . u se. I
pen nit a re constructi'on
esta woul d
e .
for i
.
1 be over- des1gned for a throw-away

.
p otential 1 to of a strategi c behav1our usmg such anow points In pn. .
' ld se e n nc1p1e,
ou

the expenments should provid e some insi ght into

.

point w
.

. the
ak age en counte red m the experiment technological subsystem, the understanding of whic h
mo deI .al bre< ' .
f patterns nugh t be associated with
may
ene1

The g eo a pe rmit inf eences to ?e made about othe r subsystem

h at a rangJ - pomt system simp . s.
st f ly because of the This matter is made dec1dedl easie r when the archaeological
sug gest iverY-
)at
. .
lar del ab\es
that couId act independently or
record can, in conatmn with evironme ntal data, ge nerate
pait1cu , in

be r of vari to produce the brea .

a n u m e a n o ther, kage . The a r ange of poss1b1lit1es for consideratio n. In generalizable
gre t . "tth on .
cuon w archaeoIog 1cal . site of Nachorine
c onJUn the terms, this approach can be used to construc t the ma trix of
. ts from 0 f
p o i n ran ge b re aka g e w as taking place.
broken gene
raI .. possibilities for hunting modes which may apply to a wide
. ndic ate th at a . hed the veloc1t1es of the arrows the delivery range of po ssible environments. The experimental i nformation
1 ab\!s
involved m bre akage can be estimated.
I:la ving est e s derived is based on stone oints replicate d to many of the
he f o" re . "
ne u p to iorces of approximately
st em used , t s to fications of archaeological ones recovered fr m various
sy \ st ts
speci o
rrow o 1 ) while two other points broke with forces areas of the world. The experimental information has the
on e a ..1ewtons7 k
/n i to 0 6 kg/m respectively.
0 22 kg/m (i 0 g theoretical potential of superimposing a range of pro babilities

m atelY

f a p proJU
o
Ih:!ill'. Results

[Jii. 30 penetrates several cm into meat, and when hitting bone bounced ou t of the meat.
r
Stan da d 45 penetrates into the mea t t hrough entire thickness most of the ti me when not hitting
Stan dard bone
60-66 penetrates meat comp letel , and penetrates the bone 2-4 cm
a y
St and rd 30 penetrates point depth into meat
6
4 45 point breaks in bone
ti
11
30 just sticks in the bone and sna ps point
I
5 30-45-60 penetrates meat to varying degrees
3
2 66 breaks in bone
ti
11 30-45 penetrates meat
5
3 60 breaks at base in bone
5
3 66
7 breaks at base

Table 3. un n g simulation test; summm)' of representative shots.

H ti

. ii s Naillltives of\rllgi ia (1606-1625) noted t hat : "... Forty yards will they shoot level, or very neare the mark, and 120 is t heir best at
n
sniith 10 1 e tO the local Indian
s.
' JoIio " in refer en>
randoOl

216 217
 THE HEATING ISSUE IN ANCIENT TECHNOLOGIES

PAVLISH, L. A.

Archaeometry Laboratory, Isotrace, University of Toronto, 60 St George st., M5S IA7 Toronto, Canada

whether or not prehistoric peoples employed heat treatment of chert and flint as an integral part of their lithic
'[he issue of
roductio n technology is a matter that has long been debated. A heating model is presented along with underlying
/Iopso phical principles upon which the model is constructed.
1
T he methodology is developed and discussed. T he overall
P 1 ctusion reached through this work is that the heating issue will always have to be addressed on a case-by-case basis, and
:
aoncep tual
tools employed to make the decisions will be phenomenological in their make-up.

J(EYWORDS: P URP OSEFUL HEATING: TOTALLY HEATED MATERIALS (BAKED OR BURNT); PARTIALLY

HEATED MATERIALS (ROAS TED), PARTIAL HEATING, THERMOLUMINESCENCE ( TL), P Y ROTECHNOLOGY,

TECHNOLOGICALLY-ORIEN TED TEMP ERATURE MANIPULATION.

General perspective on heating formed into a sharp point. In other words, knowledge of both
degrees (partial-to-total) of heating and intensities (roasted
'The application of heat to raw materials to make them more to-bumt) of heating as well as knowledge of organic and
useful probably began with the first control of fire by humans. inorganic mate1ial properties was available to the ancient

Advances in the understanding of py rotechnology eventually manufacturer. In the case of stone, experimentation indicates
led to the firing of ceramics, the smelting of metal and the that some of the same principles of heating apply as those
potential for large-scale material production and consumption. which would apply to wood or bone. In all media, there would
What is the evidence from pre-ceramic periods for the necessarily have been many more options and choices
expl0ration and development of a heating technology asso available to the ancient technologist than merely heating
ciated with the manufacture of stone tools? For the most part, indiscriminately; and, undoubtedly, this situation would result
the study of pre-ceramic, heat-altered materials has been in a broad range of intentional heating patterns at times
primarily ad hoc, with the limited objective of determining only overlapping with the range of inadvertently heated examples.
whether or not a particular specimen has been altered by heat in The fundamental question arising from this theoretical
antiquity. Review of a wider, and largely incoherent body of observation is:
literature on the subject suggests that much more could be How can purposeful heating and potential for variability in
learned about the prehistoric use of heat to alter materials used that heating be detected in the archaeological record?
for making tools. Consequently, an instrumental approach to
this subject, coupled with experimental observations on Recovering evidence
reproduced, archaeological-like specimens, may point the way
toward a better and more systematic understanding of some of In order to recover successfully evidence of partial heating
the prehistoric artisan's uses of heat. from the archaeological record, one must first establish that
In some cases, evidence of heat alteration can be detected; evidence of this kind is archaeologically recoverable. A lack
and, under certain conditions, it can be shown that such of knowledge of the differentiation of degrees of heating has
alteration probably was intentional. Analyses (e.g., TL) can existed because researchers have rarely looked for it
show also that the study of prehistoric heating technology is a sy stematically. Until recently, the problem of distinguishing
far more extensive and complex undertaking than had accidental or incidental heating of any kind from purposeful
previou sly been supposed. In addition to providing an heat treatment2 was given little consideration (Klein 1973;
app reciation of the potential role of temperature in ancient Rick & Chappell 1983; Morrow 1981). This matter of
manufacturing sequences, these experiments establish that purposeful vs non-purposeful heating can be rectified by
certain prehistoric technologists not only used temperature employing thermoluminescence ( TL) as the determinant of
ht, at times, used it with great skill. For example, when one heat treatment. Materials heated in antiquity will have
Wished to make a wooden spear point, it was possible to decidedly different TL outputs in the form of light than will
Partially bum the end of the wooden shaft, softening the their unheated, geologically-similar counterparts. In addition
material, making it easy to remove the outer section. Then the to determining the potentially differentiable TL outputs, it is
remai ning unburnt core material (Adam 1951; Movius 1949, necessary to analyze a large sample size (N>100) and, if
!950),1 possibly partially heated, and perhaps hardened - possible, confine the sample to a specific stage in a lithic
depending
on the species of wood chosen - could easily be reduction sequence. The rationale for the large sample size is

I
'I'he
8-foot long yew wood spear found in association with Elephus antiquus and Levallois flakes at Lehringen, Germany appears to have been fire-hardened
and used in the demise of the naturally-bog-trapped elephant (perhaps fire-driven). The site is dated between 80,000 and 125,000 years ago (Adam 19 51;
Movius 1949,
i 1950).
'Purposeful
heating' of stone is a term used here to suggest that there was direct, conscious human intervention through the application of heat to stone or
Ot her m
aterial for the purpose of facilitating some objective, be it technological with respect to manufacture, cultural oraesthetic. 'Non-purposeful' heating
by human agency may be 'accidental' (e.g., retouch flakes in a fire), or 'incidental'
(point heated during hafting with a mastic like bitumen (cf., Boeda et al.,
l996,
336-338).

Proceedi
ngs of the 31" Jntematio11al Symposium 011 Archaeomet1)'. Jerem, E. & T. Biro, K. (eds.), Archaeopress -Archaeolingua, BAR - Centi: Ew: Ser. 1.
 Pavlish, L. A. The heating issue in ancient technologies

simply that any analytical result on d"1v1"dual specime

. . an m n is core can be heated to facilitate effi ul can again be divided Non-purposeful heating
versus Non-Purposef which
ch no1 og1ca 1 mtent10n
at best ambiguous with respec t to t e . . . cient det
The a chme s ful
mner . n t, bu and partial and total. These
analyses of a large number of individ 1 mass would not be heated. In such t th ental and incidental,
a s mp1 s remov s the a s1t u at' a id
possibility of accidental heating ha pv g P aye a role m the
flakes would have a substantially
lo wer TL on, the i e

1 ignal tha n
s
b ad e.
.
IO
reu
\ al heating divisio
ns are
.
discus sed below
expenm
.
.
.
entat1o n, and
Accidental or incidental total heating (burnt or baked), or
partial heating (roasted) of archaeological material without
1
core. Pa11ial heating would be a logica of observ ations f rom
materials' disposition. Isolating a
a n1cu ar stage m_ l exp an
at
the th the support the direct conscious application of manufacturing directives
. .
.
a lithic kinds of resu lts. w in mind that the categor ies are part of a
e ana 1ytica 1 potential
ion for these various
' '

technological sequence improv es t h .

can be defined as 'non-purposeful heating'. The heating of
establishing the intention of h ea ting .
for Thus, through TL analysis, the
data gen
erated,
pn:um (from unheated to totally destroy ed), the in
materials by non-human agencies may be classified in a
At present, TL appears to be on e
. . of the most effective
.
compa red with a heating classification sy
.
to support the hypothesis th at p urposefu
stem, sh
ould be
When
::O ns of heati
g and their implica
:
tions in archaeo logical
similar manner.
methods of determmmg the pres enc e
or a bsence of heat" mg.3
l heali. n g,
determi
able tdiinaten als can be viewed as follows
. from systematic evaluation of large sam
1
ned
The problem is not whether an indi . ple sets
from kn
VI dua art1fact has been . Accidental heating
heated, but rather, whether or n .
technolog1cal sequences, can be identifi .
ed m th
own Non-heated materials

ot mten t1ona l or non - e arch
. . . ologic al record. The objective of this ki ae.
mtentlonal heatmg was par t of a nd of rese
. a rch .is Accidental heating can be best exemplified by the heating
c ass1fy materials as to their degree
. pyro technology For 1
of heat. to items are those archaeological materials that
mg' and

example, 1f a large sample of bifa 1 unh eated
. . cia retouch flakes are . . agency. in a hearth of waste flakes or cores from the manufacture of
exammed for their TL output and compa .
establish whe ther or not that heatmg is pu
rposef ul.
to
e had
no application of heat by human or natural
stone tools. Uncontrolled heating of this kind is often
source material, the potentia lly
red with geological
contrastmg .
TL energy Classification of heated ma
: s e ategor
y includes all material s within the archaeol ogical
due to uncritically documen ted in the literature, and can take the
recovered from the geological m a tena 1 been expose d to any kind of heat
terials cont
ext that have not .
. and t he archaeological
temperature mampu 1atlon or naturaI form of heat crazing, cubical spalling and potlid fractures, all

clearly show wheth induced

matenal will
.
e r 0r not the arch
aeological human- of which indicate temperatures high enough to render chert
Accepting that the detennination of he . , forest fires, grass fires ).
flakes come from matenal that wa s . atmg .m benomena (e.g.
fihe ted Thus, it may be the friable and thus unsuitable for proper flaking (Anderson
P It is noteworthy that, the general classificatory

arc haeological record can be establishe d as scheme
possible to conclude from these . a recovera
. n d mgs whether or not p henomenon usm .
g TL mstru mental analy
ble
as well when applied to 1979; Purdy 197 5). The accidental heating resulting from
purposeful heatmg of a set of arc h ae 1 . 1 ses and out li
ed above works equally
0 og1ca che11 mate11"als .
penmentation (Rowlett et al. 1974; Melcher & z
ex. n one various degrees of cooling . natural fires (lightning or volcanics), lightning striking an
materi als that have underg
outcrop, or low temperature exposure (< 100C) [e.g., thermal
was bemg practised.

immerman
1977), one can develop a theory for classifying th while they were very
The analytical method, thermolu nu
.
e h eating of Evidence that materials were worked
nescence (TL)' reqmre d materia ls into several general categories (Fig l) T from the archaeol ogical record springs, desert sun] would fall under this category. These
to separate heated from unheated ma ena . 1 . . h e general cold is difficult to obtain
t necessita
theoret1cal categones fo r the classification of mat 1 natural heating events are unpredictable within an

. . tes a provide the

'
had to
ena s are
ment
. beeause the natural environ
. .

e cteveloped
class1ficat10n system for heating b
1 This the obvious archaeological context. The phenomenon could be created by
.
Heated versus Non-heated followed by the sub categ standing

c ass1fi1cat1on system must addre s s the issue - ones of temp erature control, and, notwith

s associated with an infinite variety of situations (e.g., a hearth dug into older
. only work within
both the physical state of the materia 1 difficulties, an ancient technologist could
(e.g., no heat; some Classification of h eating practices question may become deposit with lithics), but proper analyses would rarely
heat; total heat) and its disposition tho se p hysical constraints. This
. . (e.g., unheated; non- nding of the effects provide a suite of uniformly heated materials that could be
purposeful heatmg, purposef ul heatin somewhat easier to address as our understa
g) The TL method can Physical state of the material s, thus enabling mistaken for a technology. An item might be heated for no
then be appIied to a large sample of

of the natural cold range on material s increase

.
lithic matenals from a other reason than that it just happened to be where there was
1e stage or f rom several stages discrimination between cold and warm state alterations.
smg 0f one Iithic reduct10n . NON-HEATED
D
a heat source.
sequence, and the results can b e ev . The arguments based on various purposeful uses of heat in
al uated with respect to a (Frozen)<- Unheated-> R oasted-> Baked-> Burnt-> Decreoitatjog
. .
. .
Heatmg Practice Class1ficat10n System
I
HEATED the archaeological record, and the proposed simple
.
. s classificatory scheme for the heating phenomenon in the
Incidental heating
With the non-heating vs purposefu . eful: [Human or Natural]
p
l heatmg issue defined Non Purpos
accide11tal or i11cide11tal
. archaeological context, may help clarify the role of heat
and the poss1"b'li 1 ty of a solution avaiJabl
. e, one can address the 0 Incidental heating occurs when a cultural material is
. -- -- - --------------- -------------------------- > treatment in prehistoric lithic technologies. This classification
s
problem of partial heatmg of stone.4 . < - - ----- - - ------ -------- -
While expenments
-------> <----------------------------------> scheme is shown hierarchically in Fig. 2. subjected to heat only by its utilization in some other activity.
support the general observation that t 1 . <- ------ - -- --------------
. . 0ta heatmg of a stone I
Purposeful: [Human] For example, the coloured and often presumed purposefully
np
weakens 1t and makes 1t easier
to w ork mto
total
T heated tips of projectile points that Judge (1973) reports in his
partial
, a c
Y
a tool (Pur d
197 5 , 1982 ) rese arch also indicates th . I

at he tmg creates a <------- -- - ----------------- ---- ><----------------------------------> Rio Grande study probably were not purposefully heated.
material that is less capable of w ithst 0
andi' ng wear and tear' Judge suggests that heating impaits improved flaking for the
(Pavlish & Savage 2001; Pavlish N
198 5 1987). Stone, No Heat manufacture of projectile points. Experiments indicate that
',
eat

A
however, that is 'partially heated' (the t
. erm roasted' will be such an activity might have been counter-productive, because
used mterchangeably below) would in som .
. . e cases provide the Fig. 1. Schematically o utlines a theoretical classification of heating would increase the possibility of point fracture (Pavlish
ancient stone worker with advantages .
The heated extenor for

' heating that may be present in a prehistoric technology of 1985, 1987). The heating of those projectile tips was probably
example, of a blank or prefonn could .
m ore eas11y be removed incidental to some other activity. That activity may have been
. ' bone, wood or stone. While the model addresses the issues of
and the unheated matenal that rem aine
d wouId have all the
partial or total freezing, they will not be discussed below. A N"-A the cooking of food with the projectile point being part of the
of the natural stone, providi ng
qualities .
. , maximum durability
The total spectrum of heating from Unheated to heat skewer, or perhaps the application of a heated poison to the tip
This advantage afforded by roasting' w
ouId be substanti. al m . Natural
(this latter possibility can also be purposeful if the hunter's
artial Total Human
destroyed (Decrepitation) would have been available.

A<cidi. Dci""''
.
the manufacture and use of b1 faces In a .
. dd' 1t10n ' usm g TL on Undoubtedly, an y of these material dispositions may have intent is to leave the point tip in the animal) (Judge 1973).
large samples m the archaeological re .
. cord provides a means
a fforded advantages in a particular situation. Non Accidental or incidental heating may be a factor in pre
of recogruzmg the roastmg of stone Su
ch resu1ts can provide st manufacture (e.g., mining), or post-manufacture (e.g., midden
Purposeful Heating ma y have been accidental (e.g., fore

an alternative model for explaining som

L
.

fire or hearth) situations, or may be totally unrelated to a

,.0
. e of the curious (e.g., cookin g) and may display degree s of
accounts of stone heatmg that pervade .
fire) or incidental
the North Amencan heating (partial--> total). Pwposeful heating may take the technology (e.g., soil material burnt because of chance
ethnographic literature (Hester 19?2) U
. nfortunately' partial
form of partial (Roasted: removal of altered su1face leav
ing ortlI Torn Tool'""'' Total proximity to a fire).5 When a number of accidentally or
heatmg can only be detected from .
TL expenments on the core unaltered); 01; total (Baked: totally heated, Burn :
t incidentally heated materials are analyzed in a systematic
archaeological materials fo r wh i .
1
a
ch the manu factunng totally heated with swface damage, or Decrepitated: total
l y
Fig. 2. shows the classification system manner, non-purposefully heated materials will not show
teehno ogy is known. A m acro-blade
core an d blade-flake
heated with damage in the Jann of cubic spallin g, po
tlid consistent pattern in their spatial distribution. For example, in

for heated materials hierarchically and clearly separates

technology would be a good exam ple T
h e outer surface of the

fractures, cracks, dehydration etcetera). the behavioral (disposition ) component of heating an activity area used for tool production, the presence of a

from the material's physical state. scatter of waste flakes on the old land surface would be
3 Electron Spin Resonance (ESR) is noth er an 1 a
a y i. cal method that

! shows promise, but aspects of the signal prod uction are still imperfectly understood (Rink.
personal conununication). l the intensity of the fire jumps from place to
Fore st fire damage, while intense at the surface in confined places, is often inconsistent because the fire and
o e 1 analogous w . th
This process of 'partially h eating' stone is lo
s Y technique
ing Desert conditions may heat all surface materials as well
i the role of fire and heat in the yew wood spear point hardening and sharpen p lace; and, rarely does the fire influence mate1ials below the surface because of ground insulation.

of manufacture.
as those buried at small depth. These temperatures would rarely exceed 50C.

220 221
 Pavlish, L. A. The heating issue in ancient technologies

ed when the
expected. If a contemporary firepit was located in the centre g of the spear point might partial or total heating would have been employ
Totally heated materials heated (burned), the heatin
been dere worked in its natural fonn.
that the lithic material could not be easily
of that activity area, then those flakes present in the pit dming
bi!S consi d to be incidental if one assumes heating was a
From our modem-day perspec tive,
u e, and those redistributed across the old land surface by ed to particular woods
Totally heated materials are those w
hich have b be dening properties of heat when appli enhanced an
either human or natural agency subsequent to heating, might ee n bak n. If one considers that technological factor that would have greatly
to some optimal temperature with some ed bilf ot known to the ancient aitisa

technologI to and use of raw

have both the visual (e.g., spalling, etc.) and non-visual (e.g., c a1 PUrpo n -hardening properties were ancient lithic technologist's accessi bility

low-TL) charcte1istics of heating. In this situation, heating

m ffilnd. Formerly, ideas about heat-tre

. atment
. ' and e x-
se ;a:e heat-engendered wood
heating to be purposeful. mate1ial. This factor would have been of decide d advant age to
penments earned out to establish its p then we would interpret the

. oss1ble adv :own, a free-ra nging (raw mate1i al,

would not be identified as a product of a lithic technology. .
were predicated on the assumption that ntage s, area (bark, etc) to form the any group, especially those with
ating of the outer wood . ,
the mate fh e he . curation-limited), hunter-gather er econom y, becaus e heating
If archaeologists were to examine a single flake from this totally heated (Crabtree & Butler 1964) U n al Was ar point would be purposeful m both
situations . By
n doubtedl experim entatio n (Crabtr ee &
. y, the r e s to improve as demonstrated in modem

old land surface, they may or may not find that it was heated. were s1tuat10ns m antiquity where any heating of a stone tool blank or core
.

' dva logy, the

disa al of materials,
. ntage th ut Butler 1964), facilitated greater ease of remov
It would be unwise to assume that the remaining surface ffil ght be accrned from the heating and . at g qualities alluded to above, witho
weakerung surficial flakin s in the compl etion of a high
scatter was also heated. Fmthermore, it would not be logical
. 0f the al, purpo seful thus promoting increased succes
matenal was offset by some other set of adv the internal materials, is a technologic
. antageous f
actors, h anging quality final product.
to ascnbe a human intent to the finding. If, however, a large be they technological (e.g. poor heat-manage of stone , it is unlike ly that the non-purposeful
' ment fac1Ii act. In the case
lie s), accidental

sample of the flakes is examined, and shows a percentage to heating of the inner areas would be either
.

or cultural (this is the way it is done') In

fact expe
m or part ial
Testing the hypothesis
have b en heated, and that the number heated is directly n ent s e appar ent to
l; in most instances, it would becom

show that projectile points can be heated (bum '.

. t) m such a or incidenta
way severe
pro ort10nal to distance from the fire pit, then non-purposeful th t they can be used only once (Pavlish 1985, facture or use of the object that
1987). The se tile artisan dming manu Having formulated a specific hypothesis
for the use of
heatmg by accidental means can be infen-ed. Why? The pomts shatter upon impact with a bone Even heating cause s decre pitatio n of the lithic material.
sueh an unu su of purpos eful heating in the
al heating and the nature and degree

archaeologists can assume that the source of the heated flakes example of heating might afford certam .
advantages. to test its validit y. To aid
was the hearth. Other flakes in the vicinity were never heated. . archaeological record, it is necessary
Increasmg damaging power through the mt ro . Hypotheses

d
00 a tical criteria have been
Should the analysis of a large number of flakes show that all
. .
. . in the testing programme, sets of theore
: 1ct1m of a number of small cutting smfaces ffil ght n l
I crease cation of stone into genera
a model of stages in various developed that permit the classifi
o them are heated, irrespective of whether they are in the fire mtema1 l l lJUry
and foreshorten mobility and life The previous section outlines g,
through Non-P urpose ful Heatin
. categories of Purposeful Heating,
It or some distance from it, then purposeful heating may be
echamcal damage, and, within a rather short period o f li. me with ancient technological heat
phenomena associated given to the
mferred. Why? The archaeologists can assume that, because be used to test for the presence and Non-Heated. More specifically, the terms
(i.e., days), inf ction - a dum-dum projectile of stone. management. This model can
are 'burnt' , 'baked' and
almost all flakes have been heated, there is a high probability . g using TL analyses on a large physical state of these criteria
Other expenments indicate that unheated tanged
pomts or absence of purposeful heatin eful and non-pu rposeful
from a single stage in a lithic 'roasted' as they apply to purpos
that heating must have taken place before the flakes were shot'mto b one under muscle, broke at their bases 1 .
eavmg a number of selected samples the presen ce
heating. The primary objective is to demon strate
generated. Therefore, the heating was probably part o f the sturdy cuttmg edge lodged in the bone (Pavlish & S tical classification of heating
technology. Basically, the theore

avag e within the framew ork of a

or absence of a heating technology
2001) . A proJect1.1e pomt designed with this intent reqmres
.
manufacturing technology. The archaeologist must place the . types of heating through a
can be used to isolate and define

a ce. In additio n to
. . lithic tool biface-production sequen
bs rvations on heated materials from a spe cific stage in a

p mt that is relatively

sh'.1fP and thin in cross-section to series of hypotheses that can be formu

lated to test the validity
identifying the presence and absence of heating
, the goal is to
lit?ic reduction sequence within the classificatory framework l of prehistoric, techno
p mote both bone penetration and selective strnctural failu
re. of a general heat treatment mode ages or disadv antages that
(Fig. 3; also, Figs. 1 & 2). The issue of purposeful vs non n . These theory make explicit the potential advant
This combmat '
10n would alm st always assure that mobility of
logically-oriented, temperature manipulatio of, may have conferred.
purposeful heating is a matter of reconstructing ancient . purposeful heating, or the lack there
the prey would be senously impaired in almost all situation s driven hypotheses are outlined below. g may occur at any
human behaviour. The data may suggest certain actions as This issue is complicated because heatin
where uscle t ssues were overlying the penetrated bone. h to
i_n quarry ing to retouc
. stage in the production sequence from
being highly probable, but absolute assurance is unattainable. The mplication of the results of these simple experiments

The general model the post-m anufac ture
. the end product, and may play a role in
is tat It may be rather difficult to look into the mind of the
sight of the fact
Purposeful heating manufacture and life of a tool. Furthermore, one can never lose
ancient technologist and to understand the rationale for The role of temperature in the acquisition, be purpos eful or non
eration. The that, when present, heating may
manufactming sequence behaviour. In addition, whether that use of materials is in need of further consid h must necessarily
oseful heating can be of two forms: 1. totally heated
Pu y of the heating purposeful. Therefore, such researc
r_p result be a w apon system or a domestic tool system, it is
general model generated to test the validit
matenals (baked or burnt), or 2. partially heated (roasted)6 . an integral aspect proceed on a case-by-case basis.
almost impossible to isolate and substantiate the use or non model is that temperature manipulation was g of lithic
logies. The The strategy for the testing of the heatin
materials. use of heat without considering its role in producing the final of some prehistoric wood, bone and stone techno from a relativ ely well
is that heat materials is to first to analyze flakes
result. It is interesting to note that, if one assumes hunting specific aspect of the general model being tested their therm olumin escent
tradition of understood production sequence for
success, then each of the techniques discussed above for treatment of lithic materials is an aspect of a long Pavlish & Shepp ard
Q.l als vary (TL) light output (Sheppard et al. 1983;
- processing projectile points (i.e., heated projectile point temperature manipulation. Temperatures of materi y
Q., N 1 ? N=l ? through 1983). The intensity of light output in a materi al is directl
=
Cl shatters, or unheated point snaps at tang) can be a 'one shot' either naturally, with environmental changes, or it was last
E I') . While the related to the period of time that has elapse d since
Co:! affair, and each has the potential to be equally beneficial to the human intent; they may also vary accidentally.
0 that have been
heated. The TL comparison of materials
..., fl) hunter. Other experiments have shown that, on average, General Model has been presented in an implicit manne
r, the
ical counte rparts should
rJl
Mode l heated with their unhea ted geolog
unheated projectile points were more durable than those that objective of any study is to abstract from this General
5 can be show a marked contra st in the amoun t of light measu red
(JQ had been totally heated (Pavlish 1985, 1987). discriminative, explicit, specific hypotheses which neutro n activat ion
when reheat ed. The use of instrum ental
within a
used to quantifiably test for intentional heating questio ns con
analysis (INAA) of lithic materi al remov es
of experi
Partial heating known archaeological context. The development ological and
fiable cerning the geochemical similarity of the archae
mental methods in archaeometry for conducting quanti a statistically
"'C a geological materials. Then, by lookin g at
['1. '1 Partial heating is perhaps the most intriguing aspect of the tests within the framework of specific hypotheses repres ents
0 it should be possib le to
= meaningful number of samples,
I') O" heat treatment question (cf., Sheppaid et al. 1983; Pav!ish & fundamental aspect of this kind of study. to assess
of heatin g, and
I') fl) establish the presence or absence
O" Sheppaid 1983). While evidence of its existence certainly can
fll .... whether it is purposeful or not.
N =
>100 fll -
.... N = >100 b gleaned from the aichaeological record, it has rarely been

The specific hypothesis
-< discussed. Why might this be so? Possibly because it is
. y developed for
References
difficult to assess partial heat cleaily and conclusively. How Employing the archaeometric methodolog
for
can one separate purposeful from non-purposeful h eating specific hypothesis testing will permit quantifiable testing gen, eine Jagd
Fig. 3. shows the heating model from the perspective Adam , K. D., 1951, Der Waldelefant von Lehrin
when these material states may in fact be overlapping or the presence or absence among certain ancient group of s
beute des diluvialen Menschen, Quarta r 5, 79-92.
of acquiring information. La rger samples improve depend on unknown and unknowable rationales? For purposeful heating in the manufacture of blades and projectile
selecti on for intentional
probability of establishing heating behaviow: Anderson, D. G., 1979, Prehist01ic
example, in the case of a wooden spear in which the shaft end points. The specific hypothesis is that some ancient groups employing
thermal alteration: tests of a model
e mployed heating in their lithic manufactmin g sequences. ontinental
southeastern archaeological materi als, Mid-C
has re!Il known, but
to heated chert,. but hrs
. defimuons from ones proposed he The ancients' rationale for heating may never be

' Stewait Struever
(Struever 1973).
used the tenns 'baked' and 'roasted' in reference . .
. are different the
Journal of Archaeology 4, 221-254.
one can be certain that, in a number of instances, purposeful

222 223
 Pavlish, L. A.

Boeda, E., Connan, J., Dessort, D., Muhesen, S., Mercier, N., Pavlish, L. A., 1987, To heat or not
FROZEN BONE BREAKAGE EXPERIMENTS
. to heat,

Valla as, H. & Tiserat, N., 1996, Bitumen as a hafting
_ question! 52nd Annual Meeting
of the S .
that is
the
. o ciet ,, PAVLISH, L. A., 1 BE VER, W. F.2 & SHEPPARD, P. J.3
matenal on Middle Palaeolithic arefacts, Nature 380' Amencan Archaeology, Toront o C y tor
' anada 6-l
336-338. Pav Ii sh, L. A., & Sheppard, P. J., 19S3 T ' 0 May,
. . ' hennolu .
1Archaeomet1y Laboratory, Isotrace, University of Toronto, 60 St George st., M5S 1A7 Toronto, Canada,

Crab ree, - E. & Butler, B. R., 1964, Notes on expeiiments deterrnmat1on of Pa!aeoindian heat t
reatment .
llUnescen t
. In Ontan0 2Ministl)' of Finance, Govemment of Ontario, Canada,
m flint knapping: heat treatment of silica materials ' Canada, American Antiquity 48(4) 793 '
' -799
3Anthropology Department, University of Auckland, Auckland, New Zealand
Tebiwa 7(1), 1-6. Pav lish, L. A. & Savage H 2001 Bone
. . . ' ' ' and stone
bre ak ag e
Hester, T. R., 1972, Ethnographic evidence for the thermal m white-tailed deer, in this volume.
alteration of siliceous stone, Tebiwa 15(2), 63-65. Purdy, B. A., 1975, Fractures for the
. archaeolog .
Judge, J. W., 1973, Palaeoindian Occupation of the Central 1
S wanson, E ., L ztuc 'T'
1echnology. M ak"
ist in Qualitative experiments are carried out on frozen animal femurs in an attempt to establish whether or not bone fracturing
_ mg and U .

. sm g ties vary with the degree of freezing. Fracturing of samples cooled to 1 96 C, -40 C, -25 C, 0 C and room temperature
Rw Grande Valley in New Mexico, University of New Stone Tools, Aldme Press, Chicago, 133_ r op er
-

141. f20 oc) is accomplished using a simple two-support beam configuration and a hammer. All sample specimens are broken by
Mexico Press, Albuquerque. Purdy, B. A., 1982, Pyrotechnology: Prehistoric . .
application
with the exception of the -196 degree samples which are easily broken by hand. Although all bone samples fracture in
hammer
Klein, J. J., 1973, T hermal alteration: an aspect of lithic to
che1t methods in North America ' in T' e E
11 volution if
. the roximately the same way, the ease of fracturing increases with decrease in temperature. T he -40 C samples are found to be
app

technology, Unpublished Master's thesis, Department of Fzrst Fire-Usmg Industries, Wertime T A

' & Wertim e capab le of f laking in a manner analogous to that of cryptocrystalline materials. In addition, the -40 C and -25 C samples
Anthropology, New York University, New York. S. F. (eds. ), Smithsoruan Institution press, W . ,

ashi ng ton

Melcher, C. L. & Zimmerman, D. W., 1977, TL determination D.C., 31-41. exhibit two fracture types: one which cuts across bone grain structure and one that follows bone grain structure boundaries.
The unifomi fracturing qualities are postulated to be the result of bone architecture which remains basically unaltered by
of heat treatment of che1t artifacts, Science 197 ' Rick, J. W. & Chappell, S., 1983, Thermal alterat10
" n of s.11.ca
I cooling. It is suggested that the freezing of water in the bone is responsible for the increased ease of bone fracture.
1359-1362. matena 1 s m technological and functio

nal pe rspe ctiv
. e,
Morrow, C. A., 1981, Thermal alteration testing of Ft. Payne Lithic Technology 12(3), 69-SO.
chert, Appendix I in Johnson, J. K., Lithic Procurement
KEYWORDS: FROZEN BONE, FRACTURE MECHANICS, PURPOSEFUL FRACTURING, PREHISTORIC
Rowlett, R. D., Mandeville, M. D. & Zeller' E J , 197
4 The TECHNOLOGY, BONE TOOL TECHNOLOGY.
mterpretation and dating of humanly work '
.

and Utilization Trajectories: analysis, Yellow Creek ed s1.Iiceou

. s
N_ucear Power Plant site, Tishomingo County, Missis matenals by thermoluminescent analysis Prr'ceed"mg of
, v s ordinary man, he must either use harder stronger materials for
. . .
szppz, vol. II, Archaeological Papers No. 1, Centre for the Prehzstonc Society 40, 37-43. Introduction
making the bones, or he must admit a diminution in strength
Archaeological Research, University of Mississippi, Sheppard, P. J., Pavlish, L. A. & Hancock, R. G. V., 1983
in comparison with men of medium stature..." (Physical
the assumption that the
Oxford, 205-221. The use of therm luminescence (TL) in an investigatio 'Jlhis experiment is predicated upon Science Study Committee 1965: 49).
the New World more than twenty
Movius, H. L., 1949, The lower Palaeolithic cultures of of heat treatment m the Epipalaeolithic of North Afnca,
early peoples arriving in Thus, nature's design constraints on bone form and
.
. Aspma have emplo yed a bone working
southern and eastern Asia, Transactions of the American m II, A. & Warren, S. E. (eds.), Proceedings of the thousand years ago may function as expressed in the simple relationship that bone
surviv al strateg y (Bonn ichsen 1979).
Philosophical Society, Vol. 38, Part IV. 22nd Symposium on Archaeometry, University of technology as part of their strength increases as the square of the cross sectional area
is: would freshl y frozen bone be
Movius, H. L., 1950, A wooden spear of Third Interglacial Bradford, Bradford, U. K., 1982, 145-149. Basically, the question posed
alterat ion while the mass increases as the cube of that area has its origins
ion, and, if so, would that
Age from Lower Saxony, Southwestern Journal of Struever, S., 1973, Chert utilization and lower Illinois Valley amenable to human alterat
s frozen in the three century old observations of Galileo.4 This design
hat easier with variou
Anthropology 6, 140. prehistory, in Lathrap, D. W. & Douglas, J. (eds.), process be made somew
constraint is clearly seen in the bones of larger animals. An
one? (Canbly 1979).
Pavlish, L. A., 1985, The role of controlled temperature in Variations in Anthropology: E ssays in Honor of John conditions rather than the fresh unfrozen
elephant, for instance, has extremely thick bones which are, of
_

a c1ent tec ologies, American Anthropological Associ
C. McGregor, Illinois Archaeological Survey, Urbana, Although there is a dearth of literatu re on frozen bone,
course, necessary to accommodate the enormous weight
a great deal of literatu re on fractures in
at10n (Sess10n: Ecology, Technology and Cognition)' Illinois, 61-73. fractured or otherwise,
involved, a weight which often exceeds several tonnes.
ulated over the last severa l millennia. 1
Washington, D. C., 6 December. gen eral has been accum
Bone studies continued throughout the 18th and 19th
ts of fractur es are often accom panied
These historical accoun
ve centuries5 with the development of a better and better
bones thems elves along with intuiti
by descriptions of the
gs.2 understanding of the significance of bone structure, an
subtle ties of their inner workin
judgements about the
understanding that culminated in Wolff's classic expose on
world were
These kinds of medical info1mation in the western
due to bone transformation (Wolff 1892). Wolff's theory states, in
the ages virtua lly uncha nged
passed down through
3 essence, that bone will undergo structural changes due to
religious strictures until the advent of the Renais sance.
being changes in static conditions, be they caused by normal or
that are releva nt to the proble m
The first observations
deal pathological factors. This theory, though the subject of
considered are those made by Galile o (1564- 1642). They
n. He intense debate which continues up to the present day, has
with the interrelations hip of bone form and functio
withstood the test of time and is usually referred to as Wolff's
re alized that bone must increase in thickness in greater
Law. The most convincing proof for this law is presented by
to be comparably
Prop ortion than increased length in order
J. C. Koch in his article "The Laws of Bone Architecture" in
stro ng. He noted that: " .. .if one wishes to mainta in in a great
in an which he demonstrates that the structure of the femur
giant the same propo1 tions of limb as that found

similarity to the works

of the second millennium BC. It bears a great
the Edwin Smith Papyrus dated to the middle
1 The first record of bone fractures is noted in
of Hippocrates suggesting a lost historical connection (Bick
1933: 4).
There was, however, no real emphasis in the
0 (AD 126-199 ) wrote extensively on the subject of bone fracture.
1 Both Hippocr (460-37
ates BC) and Galen
applied to humans.
early observations were made on animals and
classical literature on animal bone fracture. No doubt many
e through the Dark Ages. lbn an-Nafi s (d. 1288 AD) is considered to be one of the most
' The Arab anatomists fo11unately continued to study bone structur
the areas of anatomy and physiology (Milne 1907).
range of work in both
important of these anatomists because his w1itings cover a wide
to apprecia te the importa nce of Galileo's comments. When Dr. Lemuel Gulliver
's Travels
' One need only consider J. Swift's eighteenth century novel Gulliver of a
could not exist in nature because strength
were twelve times his size. This fantasy world
entered Brobdingnag, he entered a country of giants who for example,
Thus, the Brobdin gnag giant would,
ctional area, while mass increases as the cube.
material increases proportional to the square of a cross-se
great as Gulliver and a mass 123 (one thousan
d
of 12' (one-hundred and fo11y-four) times as
have an arm twelve times as large which would have a strength
ay activity, a load
cany, in the course of day-to-d
In other words, the giant would have had to
seven -hundred and twenty-eight) times that of Gulliver's. is reflected
weight on his shoulde rs. The impossi ble nature of the Brobdingnag giant's configuration
equivalent to Gulliver canying eleven persons of his own
ble world existed for the Lilliputs.
in the fom1 that bones take in larger animals. The same impossi
studies are to be found in Koch (1917: 181-186
) and Evans (1957: 9-25).
the history of the develop ment of bone
Excellent summaries of

-Archaeolingua, BAR Ce1lll: Ew: Sa 1.

011 Archaeometry, lerem. E. & T. Biro, K. (eds.), Archaeopress
-

224 Proceedings of the 31" International Symposium

 Pavlish, L. A., Bever, W.
F. & Sheppard, P. J.
Frozen bone breakage experiments
(human) is based on ce .
rta in
requirements of mechanic funda mental
s As mathematical temperature. Those dec
such' a c . ided up on w
tecture produces great s 1emur ,s mner archi ere -196 & Elliott (1957) have selected a figure of 3.68 The observation that high strain rates cut across grain
tren th . - Oc and 20C. While the C, - 4 Robin son

material; bone mate1ial is ? With a small -196c samp oc,

g, nt of
di s amount of esta blish one extreme le was c 25 ,., water by weight, with 72.17 percent of mineral boundaries in the bone approximates the second type of
hOsen
t
4.15
-

. nbU te d ' the oth

'-
m proportion to the variab erentia
Wit h diff . er sampl Ill ere J
y to p e rcent of organic matter. Owing to the differences fracture observed. Thus, the observation of two kinds of
le stre l density

provide a base from whi es wer

ss re qui. re ch any van. e e xp

(Koch 1917: 288). ments of its parts . ation m . e ct e d

rmght be ascertained. to siti es, the conesponding figures, in terms of the fractures in the bones throughout the temperatures employed
fractu r , den
jJll e o f the sample of bone, are 8.2 percent for water,
e q
The - l 96c temperatu uty m in this experiment suggest, as do the consistent spiral fractures
Experimen
tal procedure
a dewar filled with liqu
re was achie
id nitrogen T
ved by p
lacing
h on e .
z
'.\'O

pe rcent for mineral, and 38.18 percent for organic noted above, the bone architecture is not fundamentally

Mechanical properties
prod uced by grinding
dry ice and p ac
he 40C
king the

samp le
.
s w er
In
e
\ er. Of the
water preent, some 10-15 ercent of the total
.
;ial m e is in the spaces m the bone occupied by canahculus,
altered by temperature change, while resistance to advancing
fracture fronts diminishes with lower temperatures.
as ex -25C temperature was bon e in
pressed m obtained b . it Th "u
make-up of bone, designe the architectural Y P lacing the e canals, and osteocytes; 85-90 percent is m the One of the interesting implications resulting from this
d ice and momt bone i versian

aniby n ature to on ng its

anic m atrix, including the collagen fibres and the ground

temperature . n dry .
stress and strain in mobile
s, ave a
cope with normal
placed in a very small
hole that was dri
1 h a th
. e nno m
series of observations and their explanation is that any
the fract re propertie of th
at b
direct inf luence on
end of the bone. This m to e
extre m
e ter
stances,rying
and in the hydration shells of the crystals of bone measuring device which applies very slow stress-strain rates
transfemng compress1on aJ
. . forces
Smee bones
alon g the.
are capable of
was thought not to ser
hole was plac e
iously affect the
d i a po

sition
W hi ch
e
ne r al.
: e lagen andat 100C
D removes the water of constitution will not generate fractures of a type that will be paiticularly

fth col
m a ve1y efficient manne IJ" longitudinal axes fracturing . of other organic matter, but not the water meaningful to the experimentalist attempting to ascertain the
might expe
r, one the sa ple (Brooks et qu ality
al. 1970). The
would be more difficult
conversely, much easier at ri
in the
n o nnal loa
ct that fracturing
d direction' and
placed m a controlled
freezer, as w
oc samp
ere the free
les W e r
of
e
:fthe bone little
rystal. The water of compact bone is so firmly
or none can be removed from the finely
ease with which early humans in the New World may have
fractured frozen bone.
. ght an samples. ze- drie 1>ound that
bone. In fact, it can be ant gJes to the lon d
.
g axis of the w ed cortical bone by enmmous centrifugal forces - 5. Samples of beef cattle femur bone not used in the
icip ate
d that fr Po der
vary throughout the bon e actunng qualities
Experimental re
held water from the original experiments remained in the freezer for a period of
design (Bonfield et al. 1977
as r
flection of its
will
sults
forc es sufficient to strip all mechanically
an d observatio
architectural crystals..." (McLean & Urist 1968, with reference to nine months and expe1ienced a degree of freezer drying.
Gorde 1968; _Yamad a l97o '. u ns
) F n
ey 19 70; These bones were found to be substantially more difficult to
Evans 1957; Ro binson & Elliott 1957).
fractunng expenment, it se om the standp fracture than fresh frozen or unfrozen bones. An explanation
em 1o oint of a Twenty-six bones wer Obviously, with water distributed in small spaces throughout
format which would most li
; ke! a
gical to
PproX!mate.
cho ose a fracturing
catt le femurs selected from
e fractured. The t
those bones col
wenty-four
be ef the bone, it is logical, as was originally considered, that it be the for this difference is that water loss from the bone increased
have been used by a peo J that which might . lected or t basis for assuming the fracturing qualities in various degrees of the bone porosity. Thus, the propagation of fracture fronts in
. p e empJ exp enm ent were of similar gen he
Therefore, 1t was decide 0Ymg a bone tec eral morphoIogy
d that

hnology. of the experiment, whi . The result frozen bone might be different. This idea is reinforced by the bone would become more difficult (Gorden 1968). Air
ch was repeated s
perpendicular to the no nnaJ 1 fracturing . on three separ
of whole bone occas10ns, are given in ate studies that demonstrate that crack propagation is retarded by dried bones of animal and people have been found to be
oad-be
.
appropnate and that attem
p ts to l
anng Iongitud
f a ke the
. .
inal axis was .

ansmg from the experim

.
Tab
le 1 The general
ent are given below
observations the small spaces in the bone (Piekarski 1970). Thus, one may consistently stronger than fresh wet bone (Yamada 1970).
made parallel to the axis o
thought that a quantitativ : f n nn
e e
a! loadin
bon e would also be
g. Originally, it was
1. The relative ease
functio _
of bone fracturin
n of decrease in temperatur
improves as a
assume that the water in bone spaces or vacuoles, upon freezing
will expand creating internal stresses while losing its shock
Studies indicate that air-dried bone which has been bmied for
over a century has an ultimate strength of approximately one
Pen ment e.
indeed, in the long run, thi was preferable, and absorbing abilities by becoming brittle, therefore providing an half that of unburied bone (Oda 1955, in Yamada 1970;
s ma 2. Spiral fractures are pre
being it wasdidecided that b the case; sent in all specimens
but for the time regardle f environment for more efficient fracture propagation. Gorden 1968). This observation finds some support in the
a tem
.
most 1mme ate use fulne
. ss
q Ualitat
becau se
ive expenme .
nt was of the pro
per ture. This suggests
per
_

t1es of bon e embodied in
that many of the mec
;h c
its architecture are similar
The experiment conducted does seem to bear out these studies of Hayes and Carter on post yield subchondral
wouId, m pnnc . 1p . I e, take in sueh an experiment in observations. The overall ease of fracture may well be the trabecular bone in which they suggest that the marrow-filled
. . to acco vanous frozen states
1actors ansmg from the fa u nt some of and in the unfrozen
c
the complicating condition result of the freezing of the major portion of the water in the trabecular bone has greater energy supporting capacity than
ct th at (Evans 1957; Yamada 197
This approach contrasts bone is a 0).
With e complex system. bone cavities and other small vesicles. The ease of ability to that which is not filled (Hayes & Carter 1976). Analogically,
xp en. me 3. Flaking qualities analogo
some part of that comple
x syst
em (e.g.,
nts that look at only
as been frozen to -4o
us to chert are present in
and to a lesser extent in
bone flake the bone, however, may result from the further freezing the freeze-drying effect might easily produce a situation
tested for strength) whic
results. This observation
: h
is
y ot y

sma ll bone pieces
ield very meaning
ful
.
s mples. Though this
exarmna 10n of relevan
observation is qualitative,
the of the water associated with the water-bone interface in
cavities and in the compact bone. Bone flaking has been
where bone absorbs energy at a rate somewhere between that
of frozen marrow-filled bone and frozen bone without the
\!cially true in the t literature reveals a poss
fracture mechanics as o realm of ible reported for elephant bone (dry) and bovid bone (green) at manow. The fact that the relative degree of fracture ease is
ne expl anat1 n. Anderson & Tice
g
prehistoric hunter. Theref o
. . re, It
h
t envisage
W as dec1'de
!
for an Arctic

rozen mterfacial phase
(1973: 107-124) note that an

xists in soil-water systems until -

normal temperatures using a hammer stone and antler billet being considered here in a bone with an air-dried frozen state

n Mach.
testmg dev1ce (e.g., Instro d that an existing (Bonnichsen 1979). need not diminish the argument because air-dried frozen bone
C and hat temperature is
the measuring of torsio i e) would not the most important factor in this
n al ' te Though not directly applicable to the frozen bone fracture fracture ease may, in contradistinction to the unfrozen air
f
be used for
(as compared to pressure for
unfrozen mterface situa
stresses and stra ms m sm n sionaI and ion

all bo compressional example). Assuming that problem, an interesting ancillary observation is that if a small dried bone fracture ease, be postulated to be somewhat less.
idea of using a free-fall h- u uer
e
n-.- samples. Further
more, the analogous interface situa
bone -water has a some hat amount of water remains unfrozen until approximately -40C 6. A theoretical argument can be made for the liquid
because the hammer wo (1 mpact h tion, one might expect that a similar
uld h av amm er) was rejected then ion exchange can take place. Thus, the implication arises constituents of bone being a key element in the qualitative
phenomenon will be b one.
e h a d to present m In bone, however,
height in excess of that . that the fossilization process by mineral replacement can
. . . fr av be dropped from a change in fracture ease noted in the experiment. The funda
1
ai able . bec ause of its vacuolar nature,
on converuen one might also expect pressure

order to lllltiate actures in t devices in continue even in permafrost conditions. Such an observation mental success of bone as a weight-bearing device comes not
. . the bo to pay a mor e important
to des1gn a dev1ce espe ne It was role in determining the final
cial ! deemed premature free has implications for the distribution of minerals through from its strength or stiffness, but from its toughness. To
Y for this zmg temperature In a
expenm entat10n, ddi tlon, the water present in the
smce the re wo rk prior to any Partially or totally fossilized bone (Farquhar et al. 1978). appreciate this point, one need only consider ceramics, for
. sults f bone ":'ould be present in
rom such acti a solu te concentration of some kind
provide some useful guidejj vity might 4. The fracture surfaces in the bone were found to be of two example, which may have great strength and stiffness, but,
n es f r and this factor would also
influence final interface freezing
their hardware design. I
n refl ? future experiments and temp kinds with some having cleavage planes that cut across the nevertheless, have little toughness, breaking easily if dropped,
ecti o n o e atures. It is at least
standard two-suppo rt beam f these decisions reasonable to posit that the bone's grain and others that follow the grain boundaries of the
cOn fig ' a fractunng qualities of the due to brittleness. Bone, on the other hand, is a very tough
was set up for the bone urati o n using bone might be altered with the bone closely. These fracture types have implications for the
fractu . cement blocks removal of these thin (onl material because it is a composite. If one considers bone's
n n g. Th _ y several molecules thick) layers of
accomplished using a ha e actual fracturing interpretation of the experimental results. These two types of index of toughness (work of fracture: kg cm/cm squared
nd - he1 was wat er simply becaus e th .
d t wo eu presence would provide a
Two lots of bone were a kilogramme hammer . fracture according to Piekarski (1970) are dependent upon divided by ultimate tensile strength: kg/cm squared), one
ssem bJ dam pem ng effect to fracture prop
ed 01. the . _ agation. Admittedly, it is
was repeated on thiee se . expenment, which strain rate. He states that: discovers it to be comparable to that of teak wood
paIa te not readily apparent how
pre-frozen to 0 Cin a fre 0 oc
cas1ons. The this bone-water interface proble m
ezer . first Jot was can be co clusively proven. "...a crack propagates at slow rates by following weak (approximately 6.00), about twice that of key steel (2.81) and
roVided ? Some insight into the bone-water
of the Fauna! Oste o-Arc
Toronto; the second' c
fhaeo
0gy Lab
by Dr. Howard Sav
oratory, University
age prbl m m general, how
ever , is provided by McLean and
interfaces of Haversian lamellae or through interstitial bone,
Which seems to be weaker than Haversian systems. At high
over twenty times the toughness of firebrick (Tattersall &
Tappin 1966). This toughness comes from the composition of
oJJecte of Unst m their text Bone:
d
experiment, was kept at r
The experiment design
o om t
em peratu

1mmediately befo
re.

re the
The ater content of bone varies with
the species of the
strain rates, fracturing propagates indiscriminately through all
micro-constituents." (Piekarski 1970).
bone that has approximately a 40 percent mineral, 40 percent
collagen and 20 per cent liquid and colloid content in its
ca li ed amma!, with age, with
van ous freezmg temper fo r the brea the nutr itional state of the individual,

atures . kage of bone at and With the nature of the Piekarski observes that at slow strain rates fibres pull out structure (Piekarski 1970). The bone structure consists of
m a ddihon . bon e tissue under observation. As
to normal room _ from between interstitial bone arid approximate the grainy amorphous mineralization, and, more importantly, crystalline
a representative standard
for the compact bone of an adult surfaces observed in the experiment. hydroxyapatite fibres (Ca10(P04MOH)i) which are imbedded

226
227

Pavlish, l. A., Beve1; W. F. & Shepp
ard, P. J.
Frozen bone breakage experiments
in the less stiff crystalline organic .
collagen matrix This matnx
contns Ii This argument would hold
qmd s and colloids which occupy true even if Paper No. 89, National Museum of Man, Mercury
.
canaliculi, and lacunae
Haversian canals, and at -40oC it is not altogeth
er obvious th
sf rem
a ins c
on stan
erved but would also become totally saturated with water.
. " .All of these spaces are
case. !he hydration shell of uch Wou Pe bone were subsequently frozen, it might acquire some Series, Ottawa, 297.
interconnected and the flow of the apatite fib :: ld be t
liquids under stress can absorb
at a given sub-zero tempera may h Jfjher different fracturing qualities caused by, among other Brooks, D. B., Burstein, A. H. & Frankel, V. H., 1970, The
large amounts of energy increasi ture as sugges Well free
ng toughness..." (Piekarski ted ab ov ze ra. gs, m o-cracks due to water expansion. An expe1iment
icr biomechanics of torsional fractures, Journal of Bone and
less strong fibre matrix, sf'. e creat
1970). Conver ely, one may dedu

energy absorbing potential of
ce that an alleviation of the
liquids and colloids in bon
the matrix sm' is unlikely to

In addition, the .
remain stab! e .
yie ld streng
With the fr
ing a
th
. of

e
ling with
im
this problem should be relatively easy to set up.
ents to establish whether an environmentally
Joint Surgery, American Volume 52-A, April, 507-514.
Canbly, T., 1979, The search for the first Ame1icans, National
the inte r- and extra- cellular water eezing xp er
w? ud tke place in frozen bone and may de of
. The act of freezing, while no thermal gradient in bone (e.g., -40C at the surface to Geographic 156(3), 330-363.
enu?ating these constituents
from the bone, removes their
In other words, sc may well
be diminished
t sc
c ease
to Sill"
.
. duced Currey, J. D., 1968, The effect of protection on the impact
sc" =sf' Vf1 + sm"(l-Vf ) Where C in e inner regions or vice versa) might create stresses
th
pnc1pal toughening advantag (3)
e and replaces it with the improve the fractming quality of the bone should be strength of rabbit's bones, Acta Anatomy 71, 87.
. I

disadvtages of a brittle solid with an ultimate strength loss

of wbi ch .
, i.e., little potential for energy patterns may vary in some of Currey, J. D., 1970, The mechanical properties of bone,
sc-sc" =sf Vf - sf' Vf + sm'( on u cted. Also bone rupture
d
asorpt10 , and thus easy fract l-Vf) sm
? ure. These factors, combined ' - "(l- Vf,). eir specific attributes (e.g., angle of breakage) between wet Clinical Orthopaedics and Related Research,
Although, admittedly presente (4)
and dry bone and warrants investigation. (Aoji 1959, in
with the internal stresses that the . d here m only a cr
bone matrix would have to . '. ude way, November/December, 210-231.
bear as the esult of the expansio this aigument does reqmre con
n of the water (below +4oC) sideration In ,, yamada 1970). In addition, though the periosteum was not Evans, F. G., 1957, Stress and Strain in Bone, Charles C.
aigu . iact' it co u1
. . ed that even if the fibres were to d be
would certainly contnbu expand W .ith th
te to a diminution of bone toug
hness of the water, the first principl e free zi ng cleaned from the bones used in this experiment, its possible Thomas and Co., Springfield, 245.
7. A theoetical case can also es established b .
Y Galileo w ouI Farquhai-, R. M., Bregman, N., Badone, E. & Beebe, B., 1978,
hydroxyapat1te fib es in t?e bone
be presented based on th suggest th at a 1oss of fibre stre
ngth wou ld be mcu. d imp o rtan ce in the fracturing process should be considered in
in addition to that already . rred 0n e an experimental mode as it has been shown to influence the Preliminary neutron activation analysis of bone from the
noted for water. Piekarski has nught, therefore, conclude that . .
fibre volume m Old Crow (Yukon) region, Paper given at 1978 Archaeo
put forward an argument for a 1ivmg b se of fracture in unfrozen rabbit bones (Currey 1968).
is proba blY present at an optimal one ea

calculating the ultimate strength level.

of bone. This mathematical Experiments to determine the influence that physical (boiling) met1y Conference, Bonn, Germany, 14-17 March.
.
rgument pivot arund the volume fraction of the fibre and chemical (decalcification) processing by early humans on Gorden, J. E., 1968, The New Science of Strong Materials,
s and Directions of future
is clearly see in his formula for
? the ultimate strength of the studie s bone that was subsequently frozen should be undertaken. Penguin Books Inc., Baltimore, 269.
bone composite (sc):
Subsequent experiments shou Ko 1953; Okamoto 1955 & Uehira 1960, in Yamada 1970). Hayes, W. C. & Carter, C., 1976, Postyield behaviour of
SC=sf Vf + sm'(l-Vf) ld have a larger s
(1) . ample' s0 Finally, hafted and unhafted hammerstones (Bonnichsen 1979) subchondral trabecular bone, Journal of Biomedical
that a more detailed qualitative estimate on the
where sf is the ultimate stren
. gth of the fibres, Vf is the degree of sho uld be used in some future experiments to see if such Research 7, 537-544.
volume ract1on of the fibres and vanat10n in frozen bone fract ..
ures can be made. In Ko, R., 1953, The tension test upon the compact substance of
. sm, is the yield strength of .
the d es1gn of an instrument capa addition, implements influence the way in which bone can be fractured.
the matnx (Piekarski 1970).
ble of testing w1t' h meas
bl ows the resis ured the long bones of human extremities, Kyoto Prefectural
tance to fracture of the entir
Extnding his argument to bone
in the frozen state, and . .
system, and any vanat10n in that
e frozen bone Conclusions University of Medicine 53, 503-525, in Yamada, H.,
assunung that the volume frac system's resistance should
tion of hydroxyapatite in bone b 1970, Strength of Biological Materials (F. G. Evans, ed.),
decreases as a function of temp undeaken. This approach wou
ld permit one to begin
would be a corresponding chan
erature decrease, then there
quantify the results obtained. t The study of the fracture of frozen bone is a field with Williams and Wilkens Co., New York, 297.
ge in volume fraction of the direct implication for the understanding of prehistoric Koch, J. C., 1917, The laws of bone architecture, The
fibr s. Thus, the difference betw Th probl ms associated with
: een room temperature and phase change in the liquid technology in cold climates. The future course of this area of American Journal of Anatomy 21, 177-298.
40 C would represent a fibre volu constltents m the bone in the
region of freezing ought to be McLean, F. & Urist, M., 1968, Bone, University of Chicago
: me decrease to Vf, dirninish study is still uncharted. The observations contained in this
mg the overall bone composite lookd into as well as the possibilit
strength to sc' as noted below . ies associated with water report are qualitative and based on a small sample. They, Press, Chicago, 314.
loggmg. With regard to this latte
sc' =sf Vf, + sm'(l-Vf,) r problem, if a fresh bone

(2) however, suggest that the general spiral fracturing of bone Milne, J. S., 1907, Surgical Instruments in Greek and Roman
were for a time in a cool water envir
onment, it would be well remains unaltered with cooling due to bone architecture, and Times, Clarendon Press, Oxford, 178.
Number of Temperature at Breakage that bone fractures and flakes more easily at lower Okamoto, T., 1955, Mechanical significance of components
Fracturing Observations
Bones Sampled Degrees Celsius temperatures. The water in the bone is postulated to be the of bone tissue, Journal of the Kyoto Prefectural
Relative scale
of Ease
important contributor to these qualitative changes though University of Medicine 58, 1004-1006, in Yamada, H.
(2) -196C bone's composite nature is probably also important. Future 1970, Strength of Biological Materials (F.G. Evans, ed.),
Broke very easily Broke \\lith spiral fracture
Liquid Nitrogen experiments will no doubt generate yet more questions for Williams and Wilkens Co., New York, 297.
(6)
Hand broken
-40C answering; but they will, it is hoped, answer some that have Physical Sciences Study Committee, 1965, The Physics of
All samples Spiral fracturing, flakes
(dry ice) already been posed. In conclusion, one must leave open the Lilliput, in Physics, Copp Clarke Publishing Co., 48-51.
fractured
easily detached easily and have
final deposition of the question of a prehistoric frozen bone This text makes references to G. L. Galileo, 1638,
sharp edges; flakes and scars are
technology, but one can suggest that the findings make the Discorsi e Dimonstrazioni Matematiche, Northwestern
similar to conchoidal fractures
associated with cryptocrystalline possibility a more feasible one. University Press, translated by H. Crew & A. de Salvio.
materials; t\\lo types of cleavages are Piekarski, K., 1970, Fracture of bone, Journal of Applied
(4) -25C
noted. References Physics 41, 215-223.
Two blows for one
(dry ice) Substantial amount of shatter with Robinson, R. & Elliott, S., 1957, The water content of bone,
and one for the numerous splinters, some flakin
other three
g. Anderson, D. M. & Tice, A. R., 1973, The unfrozen inte1facial Journal of Bone and Joint Surgery 38-A, 167-188.
(6) 0C water contents in frozen soils from surface area measure Tattersall, H. & Tappin, G., 1966, The work of fracture and its
All broke with one The bone produced spiral fractu
(freezer) res
very forceful blow ments, Ecological Studies 4, Springer, New York N.Y., measurement in metals, ceramics and other materials,
but would not flake. The blow
Journal of Material Science IO, 296-301.
s
required were more forceful than those 107-124.
Aoji, 0., 1959, Metrical studies on the lamellar structure on Uehira, T., 1960, On the relation between the chemical
(5) +20c
required for the lower temperature samples.

(room temperature)
All broke with one The fractures are similar to those human longbones, Kyoto Prefectural University of components and the strength of the compact bone,
of
very forceful blow froze n bone , but they break in
a Medicine 65, 941-965, in Yamada, H., 1970, Strength of Journal of the Kyoto Prefectural University of Medicine
noticeably less dynamic manner Biological Materials (F. G. Evans, ed.), Williams and 68, 923-940, in Yamada, H., 1970, Strength of Biological
and
(3) 0C
have more resilience.
Wilkens Co., New York, 297. Materials (F. G. Evans, ed.), Williams and Wilkens Co.,
T\\lo ve1y forceful These bone were very difficult
(freeze-dried) to break Bick, E. M., 1933, History and source book of Orthopaedic New York, 297.
(9 months in freezer)
blo\\ls for t\\IO of moreso than bone at room temp
erature. Surge1y. The Hospital for Joint Diseases, New York, 254. Wolff, J.,1892, Das Gesetz der Transfo1mation der Knochen,
them and one for
the third. Bonfield, W. & Grympus, M. D., 1977, Anistrophy of the Quarto, Berlin.
Young's modulus of bone, Nature 270, 453-454. Yamada, H., 1970, Strength of Biological Materials (F. G.
Bonnichsen, R., 1979, Pleistocene bone technology in the Evans, ed.), Williams and Wilkens Co., New York, 297.
Table 1.
Beiingian Refugium, Archaeological Survey of Canada

228
229
 FLUME EXPERIMENTS WITH STONE AND BONE

PAVLISH, L. A.,1 KLEINDIENST, M. R.2 & SHEP PARD, P. J.3

1Archaeometry Laboratmy, 1sotrace, University of Toronto, 60 St George st., M5S 1A7 Toronto, Canada,
2Department of Anthropology, Univeristy of Toronto, Toronto, Canada,
3Anthropology Department, University of Auckland, Auckland, New Zealand

A recirculating laboratory flume was used to study the sorting and relative transport of stone and bone materials. Fifty-one
flume runs were conducted with Froude Numbers between 0.06 and 1.71. Bone and stone movement was plotted as a function
of their rate of movement in centimetres per second (cm/sec) with respect to their individual mobility numbers (U/OJ).
Low, transition and upper energy fl ow regimes show a clear separation in the rate of movement of bone and stone.
Settling velocity and drag coefficients are calculated for the material. T hese results have implications for understanding
distributions of artifactual material on some archaeological sites, and may provide a key to interpreting the potential for
movement on others. Results are applied to field problems.

KEYWORDS: RECIRCULATING LABORATORY FLUME, RELATIVE TRANSPORT OF S TONE AND BONE

MATERIALS, SET TLING VELOCI TY, DRAG COEFFICIEN TS, INDIVIDUAL MOBILITY NUMBERS,
GEOARCHAEOLOGY, FLUVIAL SORTING, COMPE TEN T THRESHOLD VELOCI TY, BEDFORM.

Introduction materials. The results of the primary and derived hydraulic

A recirculating laboratory flume was used to study the
sorting and relative transport of stone and bone materials.
Their movement was plotted as a function of their rate of
movement in centimetres per second (cm/sec) with respect to
individual mobility numbers (U./w). Low, transition and upper
energy flow regimes show a clear separation in the rate of
movement of stone and bone. Settling velocity and drag
coefficients can be calculated for the mate1ials. These results
have implications for understanding distributions of artifactual
material on some archaeological sites (Pavlish et al. 1987;
Sheppard & Kleindienst 1996) and may provide a key to
interpreting the potential for natural movement on others.
The flume research reported here was designed to provide
observations on the transport of stone and bone material in a
unidirectional streamflow. Geoarchaeological interpretation
of the processes of fluvial entrainment, transport and
deposition of cultural materials has become an integral part of
palaeoenvironmental reconstruction (Behrensmeyer & Hill
1980; Bintliffe 1975; Brice 1978; Butzer 1971; Davidson &
Shackley 1976; Kraft et al. 1980; Levin et al. 1980; Rapp &
Gifford 1985; Schick 1987, 1992; Shackley 1975; Stein &
Farrand 1985). The selective sorting of stone and bone in the
fluvial context presents archaeologists with multitiple
problems in interpreting the material distributions recovered.
Archaeological sites associated with fluvial sediments
deposited by variable flow regimes may have artifact
distributions that appear to be lacking certain size elements in
the assemblage. A basic question often asked is this: Could
Water have sorted the stone and bone on a site by removing the
smaller elements; and, if so, are the palaeoflow conditions
amenable to quantification?
With this potential problem in mind, a series of experiments
Was designed to evaluate the possibility of selective sorting
and differential transport of materials under different flow
conditions in a laboratory flume. Experiments were cm1ied
out in lower, transitional and upper flow regimes using a bed
of very well sorted Ottawa sand of medium grain size
measuring about 0.3 mm average diameter. Fifty-one runs
Were carried out with the flume using stone and bone
parameters from these runs are given in Fig. 1.
Theoretical considerations
The motivating force responsible for the movement of
material in streamflow can be expressed in several ways.
Velocity (U) is one meaningful pmameter that has been
traditionally used by geologists and physical geographers to
relate current strength and particle size (competency
relationship). Bed shear stress (tb) also has been commonly
used by the engineering profession to express the relationship
between sediment movement (including rate of movement)
and flow intensity; it implies a knowledge of stream depth and
slope. Bed shear stress is a measure of the fluid drag force
operating on a unit area of the streambed, and indirectly, it is
a measure of the intensity of the turbulence in the streamflow.
It is therefore a good measure of the motivating force acting
on streambed materials. Shear velocity (U.) can be expressed
as U.=(tJp)112 (where tb is bed shear stress and p is mass
density of the water) or as U.=(grbS)112) (where g is
acceleration due to gravity, rb is the hydraulic radius with
respect to the bed, and S is the mean water surface slope).
Either formulation provides a good measure of the motivating
force acting on streambed materials; and it is this parameter,
U. that has been incorporated into this analysis. Finally,
streampower (tbxU) per unit area (where U is mean stream
velocity) is also a sophisticated measure of the transportation
capacity of streamflow because it combines the two most
meaningful transport parameters, namely, shear stress and
velocity.
Stone and bone particle movement can be expressed in
te1ms of a transport mobility number based on either shear
velocity (U.lw) or mean stream velocity (U/ro). The settling
velocity (w) is a measure of the resistance offered to particle
movement (Fig. 2). The ratio of the shear or mean velocity to
the settling velocity is a measure of the stream motivating
force with respect to particle resistance force (Lane & Koelzer
1939; Simons et al. 1959; Jopling 1965; Allen 1982).
IfU./w < 1, it is unlikely that the particle will be carried in
suspension, and at values around and above 0.25 it is likely

Proceedings of the 31" lntemational Symposium 011 Archaeometry, Jerem, E. & T. Biro, K. (eds.), Archaeopress -Archaeolingua, BAR - Centi: Ew: Se1: I.
 Pavlish, L A., Kleindienst,
. M. R. & Sheppard, P. J.
Flume experiments with stone and bone

transition velocities tially two-dimensional, and do not make allowances for the
12 28 cm fsec and 0.018 cm/sec; the
o.OOng between 0.02 cm/sec and o.44 cm/sec; and the upper fact that stone or bone in a natural environment might fan out
11 f811gJ regime velocities of 4-38 cm/sec (plane bed), from a point of origin in a wide arc, which theoretically could
D0o cm/sec (standing waves) and 20 - >100 cm/sec approach 180 degrees. The flume, however, does provide a

- 10 Z3 'du n es). Bone velocities were as slow as 0.0001 cm/sec good approximation of net downstream movements, and,
(an
E 9 for
e lower flow .regime, but were comparable with stone in thus, it simulates results that are a measure of the potential for
(..) er flow regimes. differential dispersion in a stream environment.
th upp
en 8
he data from the upper flow regime indicate that It is difficult to quantify the total movements of individual
- differential
transport velocitis of particle are trnslated ito particles. This problem is particularly acute in the lower flow
"O sort ing of the matenal by respective settlmg velocity. regime where bedform movement has a strong influence on
e
{f cti ve
e 7 the potential for particle movement and the direction of that
this regime dispersal is quite rapid, increasing with the
_g 6 movement. With the movement of ripples and ripples/dunes
hang e of bedform from plane bed through standing wave to
:; along the stream bed through an area with prop01tionately
e 5
tidune. Sorting takes place in the lower dune/ripple flow
larger stone and bone particles, these particles are alternately
"'O
egime, but at a greatly diminished rate. The lower energy
r

regime runs plotted in Figs. 3 and 4 used 99.9% of the run
..c 4
- time, but the actual rate of transport was on the average only
STANDING WAVE/ANTIDUNE
/20,000th that of the upper regime runs. This observation is
T 'IRANSffiON: PLANE BED/STANDING WAVE consistent with observed natural geological processes.

2
0 PLANE (FLAT BED) Thus, relatively instantaneous transport velocities translate STANDING WAVES AND ANTIDUNES
0 TRANSffiON: RIPPLE/PLANE BED
.A RIPPLE/DUNE
over a period of time into sorted materials. An important cave
I e NO MOVEMENT at that needs to be noted is that the flume studies are essen-
. .. .
100

.
. . 1
.
.

... . ... I
Q..__22 _J.-J..
..., 5-l--L._l.OI ---:-i_--L
_ L-.L...l___j
.L...L
I
UPPER
PLANE SEO AND STANDING WNES
50 IOO
U (mean velocity: cm /sec) FLOW . ...
REGIME ...

Fig. 1. A plot of the hydraulic radi .

us (rb) versus mean velocity
. .
The stabzhty fields are referenced to the (U) 0J.Ffiow.

10 RIPPLE /DUNE RUNS
Fraud Number (F) and expe . ...
..t.'(
that the particle will move along the bed. Likew
nmental numbers are incl
uded. 100
,,.
... t':Y" f
"1f. .f .
s.h n ..
. .
... t ..
...
ise based
Settling velocity . . .
...
a .
the data, if /(!) < I, the particle will have
no oveme .1 ..

..
.

An exarnmat10n of the flume data indicates --

.. -=).
.
that all stone and .1
. ... ..

Sttling velocity is a fundame
some bone material w transported as bed or ntal factor in understanding ..
.{
saltating load. particle movement. There are
..
The values of mobility nu mbers have implic three complicating factors
ation 101'
c present when s ttling particles 10 ... . ..

understanding and evaluating archaeological distrib . are not spheres: i) velocity can I
utions that

v'.111' with particle orientation; nd

may have been altered by fluvial processes. ii) a particle can settle at
differnt rate as it re-orients
during fall; and, iii) non RUN" 19 ANilDJNE v
"

sphencal particles re-orienting RUN" 13 STANDING YAVE

as they settle through a water
RUN 5 Pl.mi:: BED

~
column do not have to follow v
a. FLUID DRAG( u,) a veitical path (Middleton & o Rl..tl" 4 TRANSITTON $ v

Southard 1977). Therefore, the RUN" 3 DUl\E .01 c

c
calculated settling velocity is 0 Raj.. 2
v
a net velocity in the case of v
all non-spherical particles that do
not fall along a vertical path
BUOYANT WEIGHT (a:w) .
All experimentally-derived 0
settling velocities are net TRANS1Tl0N
value, and thus tend to unde RUN "' I STANONG WA'Jt.S
restimate slightly true settling INCIPIENT ANTI -
veloity. As demonstrated by v
OONES;
data here, this variation is not
considered to bias results sign 0 0 .001 v v RUN # 49 Ft..ANE BEO WITH
ificantly. 0.1 aa o c INCIPIENT STAl>ONG
W141'CS;
a& ODoO 0
" 48 OlJNE
Data analysis
.ol. RUN
0
0 #50 WNE

V RUN '11<47
'
The 0bectiv e m runrung the flume in all flow regimes was

to establish b th differential LOWER

and absolute rates of transport,
.0001
?
.
H

b.
. FLOW
smtm g, entrame m nt potential and deposition 0.01
. ...
..,,. ..
of stone and T ., T o" REGIME
bone matenal within each
. .. ...
flow regime, and between the m. o;f1p" Io

.. ..,

.
.
plot of the average rate of transport of stone flakes .
Fig. 3 is ., .
as a funt10n of their respectiv ., '"' 'f'
+&lit--

e mobility numbers in differing

"W"<'ft

ow regimes. Fig. 4 shows simi

lar results for bone movement

m he flow regimes. In both
Fig. 3 and Fig. 4, three flow
w
regimes are clearly defined:
the lower flow regime (ripples 0.2 0.4 0.6 0.8 1.0 I.< 0.2 0.4 0.6 0.8 1.0 1.2 1.4
Fig. 2. Mobility numbers express a particle's potential
:nd d unes), th transition (was
hed out ripples/dunes), and the MOBILITY No. u. lw MOBILITY No. U*/w
ppei_ flow regime (plane bed,
for movement w ith respect to stream flow conditions. standing waves, antidunes).
The rat of transport for ston
Shear velocity (U.) and settling velocity (ro) are the forces. . e in each flow regime varied Fig. 3. A plot of mobility number (U,/OJ) for par ticles vs the Fig. 4. A plot of bone mobility number (U.IOJ) vs defined rate
widely, with lower flow regim
e velocities ranging between rate of movement. The flow regimes are clearly defined. of movement; the flow regimes are clearly defined.

232
233
 Pavlis h, L. A., Kleindienst, M. R. & Sheppard , P. J.
Flume experiments with stone and bone

This observation has implications for interpreting artifact

buried and then
re-exposed. A particle must be exposed to between U. and r1 for movement other than minor
"I"'D can be expressed show no potential
chance of movement. Experimental observations U,/m = 0.38 r1
With. the
equatt.o O 5 ility numbers between 0.15 and 0.32
showed distributions that may have endured fluvial disturbances.
have any m + 0 25
"I",_, n dj ustment. Mob Fluvial sorting of stone has long been recognized as a
the lower flow regime only 2-4% of the stone a greater range of streamflow

indicate that in On the average, therefore a . tie substantial movement but

330 1
-;o mcre ae m m source of potentialcomplication in lithic studies (Kleindienst
on the average are exposed at any one time,
' l
ct. Fig. 5 shows that

num ber (U.lw) resulted in a 100 l ustrnent movement as one would expe
and bone particles % incr e m obility
1961; Isaac 1966). When cultural material is exposed to the
the dista c n of te
with the pecentae
of exposure decreasing as stream velocity
npples/dunes develop deeper troughs and
traveled by a particle. The formula
permits one to alculate the average
(U.l o 25)/0.3
8
n e
se large
particles have values .near. the origi
ionship betw een
.
mobility streamflow, it will tend to be concentrated by fluvia
l
increases: 1.e., relative dis ce :::: d!D
imensionless graph where the relat select ive sortin g as a result of the remov al of
litudes. When exposed on the surface, the particle expect th particle to travel with respe one Wo d is non-linear. In these experi washi ng and
long er amp uld er and relative distance ral mater ial is
ct to the gher
m num b tends towards the host sedim ents by erosi on. As the cultu
rnust be subj et d to a current that exceeds the velocity numbers m the sample. This formu1 o bility rs that the slope [(U,/ro)/()] be dictated by
_ _ . a may be useful .
With platy me nts, it appea s, beca use of the expo sed, its own poten tial for move ment will
1mtiat e movement: the latter is termed the part!c1es t?at have settling velocities becomes smaller. In other word
required to between 7 and 25 0 as U,/(J) its own U./w. Because a parti cle's settli
ng velocity depends
veloity or critical velocity (Uc). The . Cm/sec. e large r mate rials, once
competent threshold The impl ication of the analysis is that high velocities that are required to mov actual potential for
n average, do so as on its size, density and shape, the
b
velocity can vary substantially for non little ably will cont inue to
competent threshold movement can be expected when
mo I ty numb a particle staits to move, it prob strea m location and
such as silts, sands and larger stone er s are and not trapped movement will be dicta ted by its
cohesive sediments under 0.25. A wide range of flow cond exposed at the smface of the bed
itI"ons, however
, do es Jo ng as it is that are present consequent U.
alread y noted, threshold movement has been Penm.t some movement at lower mob" stream
pa rti cles. As
lit number . by J ower energy micro-regimes in the
F hs. The
exp res sed in terms of stream velocity, bed shear stress and exmple, experiments using large stone

I m icles ra
ngi

ng
or
in bedform depressions such as dune or
antid une troug
stone Bone movement
stre am pow er. Few data are available, however, on the
required for the movement of bone and
weght from 0.5 gm to 365 gm (core) had
:o
.
b Iity num? rs th

in
at experiments show
that trapping efficacy of
ll
large
stone
r
s were
esh old condit ions vaned from 0.36 to less than 0. 05 -vis the smaller one. Sma fair measure of the
th r
.
. t veloc1t1es
of particles exists vis-a of a lai ge Mobility number still provided a
stone materials in silty, sandy and gravel bed streams. The 30-40 cm/sec and U of approximately by the eddy system m the lee
5 cm/sec ' mate n.als sometimes trapped ents. The distance
s), and movement potential of the bone elem

threshold depnds in a complex manner on both the properties with mobility numbers greater than 0 20 t in sedimentologic al te1m
stone (a shadow wake effec sets were averaged for
.
. .

showed very slight travelled by bone element pairs and

of the matenal and on the textural attributes of the host face (queuing effect).

movement (weight range 0 5 gm t0 5 gm the upst ream a dimensionless plot of

) At veloc"f I ies of sometimes on presentation purposes. Fig. 6 shows
mon in an actual stream

& Goswami 1966; Brayshaw 1983).

sediment (Rathbun 50 to 60 cm/sec in a transitional flow regim . Low-energy micro-regimes are com , the mobility number
e flake matenal the relative potential for movement
under 8 gm havm g mobili . ing ability of larger stones, flakes
environment. To test the trapp

ty numbers greater than 0 17 moved travelled by each bone

.

(U,/w) versus the relative distance

Stone movement flume upstream of a range of

when exposed on the surface of the stream under 8 gm were injected into the

riments, on average, it
maten.als approximately 10 gm to 365 gm, .
bed. Larger
Flakes that were less than element group. In these flume expe
particle sizes from 20 gm to 365 gm. er mobility numbers
did not move appears that bone elements with great
Th sand grains, aveaging 0.3 mm in diameter, that were ::: .
bly m . he downstream direction when exposed
. to 2% by weight of the trapping piece
could consistently be
will travel farther proportionally in a
quantitative relationship
us d m the flume expenments
began to move at velocities of regime (U=86.94 cm/sec).
e condit10ns for 45 minutes (U=99. 7 cmlsec
, removed from a standing wave flow
m 17.5 cm/se c to 21 cm/sec. The smaller stone particles U.=7.9). However, they d"d .
fro I undergo mmor adjustment to the
o w ed in ipient ovem nt at 25 cm/sec. This type of higher energy flow condit1ons
sh by settling into the sand This -
ent 1s asso ciated with the particle realigning itself so was a result of sand bemg

mo vem removed from the upstream side of BONE FRAGMENTS

hydrodynamically .
it is more compatible with the the particle perrnitfmg I t to sli de mto dp/lJ'r(I. 7)
t
that the resultant scour hole 0.9
streamfl ow. Threshold velo

d ire ction of city for the smaller As a consequence of thi s type of movement,
some pieces
particl es with lengths measuring less than 35-40 mo:ed upstream as much as 20 cm during the 45 minute

sto ne mm
1-
achi eved at app roximately 25.5 cm/sec.' As the antidune run Block Y pieces
w as tended to settle almost vertically 0.8
rea mflow velocity was increased, the distance that an w hile platy pieces tended to move slightly upstream or

st SCAPULAE
might move when exposed also increased.
individual particle downstream (Allen 19S2).
On th e average, the maximum distance of travel per exposure Fig. 5 als shows the plot of U,/ro versus for the larger- 0.7
.
one dune wavel ength from dune trough to dune trough. s1zed matenal (symbo1 'O'). Mob1lity .
was . numbers of less than CART/LAG
A flake could cover any lesser distance. While this movement
was primarily in the dO\:nstrea direction over 179 degrees
0::
E2 0.6
LONG BONES
(LARGE)
RIBS (SMALL)
of arc, there were occasional displacements in the upstream
0.9
direction onto the face or peak of an oncoming (downstream ..J
<::(
METACARPALS
a
moving) dune. The ctual path takn by an individual particle 0.8 * t- 0.5
RIBS (LARGE) METATAfiS..LS
often apeared erra1c and unpredictable, with each exposure ::> z
. 0.7
ence on the downstream direction or w
havmg little or no mflu
..

distance of subsequent moves. This attribute of semi-random 0.6 b 0.4

PHALANGES

SKULL
--

dp/0(10+)
direction and distance implies that sorting of the materials in Cl. MANOIBLEe

::?: 0.5
CARTILAGE
the flume will take place very slowly, and need not be clearl :!I w FMORA
O)

evident in any particular run. However, if enough moveme :i 04 >0.3

oti\11-r
t: cARA4LS
8

is initiated, the ?articles with slower settling velocities
. _J
ll:! 0.3 i1 \j \..\.. TARSALS
PELVES
(i.e., smaller and lighter) will tend to move farther than those
of faster settling velocities. This separation is slow to
rd 0.2 tS"
TIBIAE .HUMERI
FEMORA
0.2 a::;
develop, but can be clearly seen in Fig. 5, a dimensionless :ULNAE' u*

plot where average mob!lity numbers for a sample of stone 0.1

u*
w = 0.38 dp/[ +0.25
O.l
RAO!! w =0.50 dp/0+0.08

particles are plottd gmst the istance ratio [(()ID): the
*FIBULAE

dist nce that the md1v1ual particle moved divided by the _i.; "1 __,__o---'-
1
. -=0 7-
. I -1-'--1...
-' 0.2 0.3--'--L-'--
.L -L-L..L.
0.4 0.5 0.6 0.7__,--'---
0.8__._
-'- 0.9 _,__,
___._ _ l.O
maximum distance atamed by the particle travelling the QL--. 0.6 .L--1-..-1---Li....-.L.-...\--1-_a...--t.j,,._...l.-o.i-. u ...i-_..--'"---'--'-_,___..'---*

dp!) 0.7 0.8 0.9 1.0

.
farthest]. While there 1s a great deal of scatter in the plot as a 0 0.1 0.2 0.3 0.4 0.5dp/D
RELATIVE DISTANCE TfiAVELED -
.
result of the erratic nature of the individual particle
.
movement, the trend 1s clear: particles that have higher D
RELATIVE DISTANCE TRAVELE
Fig. 5. The direct relationship between U, (shear velocity)
mobility numbers, and thus a greater probability of .
and distance travelled for particles. Stone flakes
movement, do tend to travel farther. The linear relationship .
with U. less than 0.25 have little movement. element travelled
number ( U ,/OJ) vs the distance that each
Fig. 6. A plot of bone element mobility
furth est.
' Water temperature influen ces the threshold value of incipient m ovement cnttc,
al ve1ocity.
u, values have been corrected for 20 degrees C water temper atu
re. with respect to the one that travelled

234
235
 Pavlish, L. A " Klei
nd'1enst, M. R. & Shepp
ard, p J. Flume experiments with stone and bone

given by U./w 0.50d/D + 0.08. This is at best a n

This behaviour greatly Levin, J., Davidson D. & Cullingford, R., 1980, Time Scales
=

increases th
e p0tenti.al for results are based on average values, and must be
app roximation, however, as bone behaves rather differe n t} Th ese
once the bone is entirely m ovem that obtain for such values. in Geomorphology, John Wiley & Sons, New York, 360.
than stone in various flow regimes because of shap e a n .
mstantaneously realign
. par
exposed' b
a 11 e 1
.
with the stre
.
ecause It will
aimost
ent .
viewe
d subject to the caveats
vertheless, they may h e1p to present a meanm

gfu1 picture Middleton, G. V. & Southard, J. B., 1977, Bed Configurations,
density factors. which often immediately am, an a N Mechanics of Sediment Movement, Society of Economic
At U as low as 10 cm/sec some small bones and c artila g e .
At high velocities ' the larg
precedes m
ovement
ction
; the m echa
nics of movement and sorting of stone and bone
bee, are, and will be taking place as long as water
Palaeontologists and Mineralogists Short Course No. 3,
re
.
alig ned t o present the least smface area t o streamflo
w
.
for trappmg small bones
e b
a phe nome
o nes have the sam

e pote nti
al
at have
Binghampton, N. Y., 7.1-7.42.
(incipient movement). At velocities between 13 and non that was als an d sediment mteract.
'

20 with
large stone particles Bee
ause of therr
o note d Pavlish, L. A., Jopling, A. V. & Zhang, Z., 1987, Fluvial
crnfsec the remaining small bones showed in cipient Ji near nature

can often be mechanical

tra ping as
, the re
References transport of stone and bone: an experimental approach
m ovement and some of the larger bones began to realign well as hy dr
. trapping. In mechanical
trappmg, a larg aulic from flume to field (Session: Studies in Taphonomy),
themselves parallel with the current. At these velocities the er long bone,
skull started to move downstream. Between 20-25 cm/sec
examp 1e, w1'l1 actually pin
Cartilage was the most comm
smalle bones to ; the stream be
for
d.
Allen, J. R. L.,
1982, Sedimentary Structures: their character
am, 593.
52nd Annual Meeting of the Society for American
Archaeology, Toronto, Ontario, Canada, 6-10 May.
the small bones began to move in erratic paths analogous on y trapped materi
al. These and physical basis, Vol. l, Elsevier, Amsterd
observations on relative bone
. element transport eyer, A. K. & Hill, A. (eds.), 1980, Fossils in the Rapp, G., Jr. & Gifford J. A. (eds.), 1985, Archaeological
with those noted for stone materials, and the remaining larger may have use Behrensm
m certain kinds of taphonornic . , 338. Geology, Yale University Press, New Haven, 435.
tudy as Fig. 6 can Making, University of Chicago Press, Chicago
bones showed incipient movement. The larger bones began to
move at Uc between 25 and 30 c m/sec. With ripples/dune s
for larger bones in a river settin

T ese ume experiments ind
;.
be scaled
Bintliffe, J. L., 1975, Mediterr anean alluviation, P roceedings Rathbun, R. E. & Goswami, A., 1966, Sediment transpmt
mechanics: Initiation of motion, by the task Committee
moving through the bone field, movement was lim ited t icate that stone and of the P rehistoric Society 41, 78-94.
bone
paiticles with U./m greater than
Bed microtopography and bedload on preparation of Sedimentation Manual, Committee on
bones experiencing total surface exposure. With longbones ' It . 0 25 w111 have a good ch

ance B rayshaw, A. C., 1983,
. of undergomg some lateral mov PhD Sedimentation of the Hydraulics Division, Journal of
ement w1'th exposure to transport in coarse grained alluvial channels,
is relative1 y uncommon for the entire bone to be exposed the
stream flow. Bone has greater Hydraulics Division, American Society of Civil Engineers
Thesis, University of London, London, England.
f actor which retards their movement. This is obvious w t i va1ues depending upon the
. van'ab'IJity m threshold UJ
element. Consequently
(I)
of the Near and 992(456), Proc. Paper 4959, 251-253.
respect to rib bones (Fig. 6) which have not travelled farther . . Brice, W. C., 1978, Environmental History for
Schick, K., 1987, Expe1imentally derived criteria
b:
ever-mcreasmg number of pa1ticles
have the potential of e Middle East, Academic Press, London, 384.
than any of the longbones, even though their mobili t removed from an extant sample at the
g
assessing hydrological disturbances of archaeological
K. W., 1971, Environment and Archaeology: an
num bers are much greater. As velocity increased through th of clecreasmg
.

.
site location as a functi'
1ength of artifact witli an attend .
ant mcrease m
on
.
Butz er,
ecological approach to prehistory, Aldine, Chicago.
sites, in Nash, D. T. & Petraglia, M. D., (eds.), Natural
flow rane of 25-60 cm/sec, larger dunes were generated. . .
U I ffi. Fmally, with pait1cles less than 30-35 mm Formation Processes and the Archaeological Record,
Davidson, D. A. & Shackley, M. L. (eds.), 1976,

m 1 eng Geo
th, the

Thus, while fewer bones were exposed at any one time, th ese
dunes generated larger troughs and thus provided a greater
. distance approaches 100% ! Therefore, it follow
potentia1 for total bone exposure and consequent movement
At velocities greater than 45 cm/sec, the skull would mov
downstream at velocities that approached
streamf low. This element separates out so quickly that on
would never expect it to be present if sorting by water were a
f actor in a bone assemblage distribution.
Small bone elements moved downstream relatively rapid}
with respect to other whole bone elements. They did follo
normal movement patterns, but because of their mobilit
potential, they were often carried substantial distan ce
(20-30 cm) with each exposure. Both the pelves and the
?
scapulae moved su stantial distances with respect to other
bone elements. Their plate-like morphology presents a large
surface area to the stream currents in most attitudes.
Therefore, one would expect these bones rarely to be present
in well sorted taphonomic assemblages, but they might be
fo und in downstream depositional contexts. The vertebrae
. gauge for measuring average stream conditions in an area
appear the next most likely to be absent from a stream-sorted
collection, along with an assortment of caitilage eleme nts.
Carpals, tarsals, metacarpals, metatarsals and phalanges all
seem to move at approximately the same rate with respect to
other elements. The ribs, as noted (Fig. 6), are immobile even
when 90% exposed, because of their morphology, which in
tum explains their immunity to relative
expresed through their mobility number. The mandibles an
humen appeai to have the same movement potential in spite
of their differing mobility numbers. The femora, tibiae
fibulae, radii and ulnae all appear to have a similar potentia
for movement. The movement of these longbones
. IS
' W hen exposed totally they align themselve
charactent1c.
par allel with the current, but as they drop over a dune fac
they will align themselves parallel with the axis of the du
u ough which is approximately at right angles to streamflo
.
p oportlon that can be moved in streainflow
through substantial
s that sorting
of 0 atenal by size, with an almost complete
: removal of one
fraction, wo ld be an unlikely outcome of exposu
that of th . re to high
: water conditions. In comparison with the high water
clunng 1ow water conditions, the paiticles <30 mm
conditIo
have
mob 1'Jity numbers >0.25 (U./w) and >l (U/ro), and therefore
s bject to movement ( l/1560th that of stream), while paiticles
sized 35-40 mm and above are immobile. Lag formation by
deflation may still take place.
Consequently, one can
conclude that for an almost
complete removal of a certain size range of particles from an
assemblage to occur, that size must be mobile2 during average
stream flow conditions, while larger sizes are not mobile.
Also, the percentage of particles that are removed above the
size that is totally removed is therefore a function of exposure
to above-average water conditions. Thus, the comparative
absence of a size fraction in an assemblage may serve as a
over long periods of time.
Summary
This flume study attempts to bridge the gap that often exists
between the results gathered from research carried out in the
movement a
laborat01y and the subsequent application of those results to
interpretation and solution of field problems. The detailed
flume experiments permit some general assumptions about
stone and bone particle movement to be quantified through
l the use of mobility numbers. A mobility number was derived
from a measured settling velocity of a particle and the stream
s shear velocity or mean stream velocity. These values were
' plotted against the relative distances travelled by each
: respective particle, and trends of movement potential versus
: mobility number were quantified.
BAR, International Series No. 352, Oxford. 86-107.
archaeology: Earth Science and the Past, Duckworth,
London, 408. Schick, K., 1992, Geoarchaeological analysis of an Acheolian
to Site at Kalambo Falls, Geoarchaeology 7(1), Zambia, 1-26.
Isaac, G., 1966, New Evidence from Olorgesaillie relating
Shackley, M. L., 1975, Archaeological Sediments: a survey of
the character of the Acheulian occupation of the site, in
analytical methods, Halsted, New York, 159.
' ns,
Cuscoy, L. D. (eel), Actas del V Congreso Panafricano de
y ed Estudio de/ Cuaternario II, Sheppard, P. J. & Kleindienst, M. R., 1996, Technological
P rehistoria
change in the Earlier and Middle Stone Age of Kalambo
Publicaciones del Museo Arqueologico Santa Cruz de
are
Falls (Zambia), The African Archaeological Review 13,
Tenerife 6, 135-145.
Jopling, A. V., 1965, Hydraulic factors controlling the shape
171-196.
of laminae in laborat01y deltas, Journal of Sedimentary Simons, D. B., Richardson, E. V. & Albertson, M. L., 1959,
Flume studies using medium sand (0.45 mm), U.S.
Petrology, 784-786.
Geological Survey Water Supply Paper 1498-A, 17.
Kleindienst, M. R., 1961, Variability within the late Acheulian
Stein, J. K. & Farrand, W. R. (eds.), 1985, Archaeological
assemblages in Eastern Africa, South African
Sediments in Context, Peopling of Americas Edited
Archaeological Bulletin 16(62), 35-52.
Volume Series, vol. 1, Centre for the Study of Early Man,
Kraft, J. C., Kayan, I., & Erol, 0., 1980, Geomorphic
Institute for Quaternaiy Studies, University of Maine at
reconstructions in the environs of Troy, Science 209,
Orono, Orono, Maine, 147.
776-782.
Lane, E.W. & Koelzer, V. A., 1939, The relation of suspended
to bed material in rivers, Transactions, American
Geophysical Union 20, IV, 637-641.

' Therefore, as a rule of thumb, if an assemblage has a break in size fractio

n distnbuuon,
. one would e xp ect to be able to express that
.
. .
then, as an approx imation,
break in tem1S of an average mobility number (UJco > o.25). This obser .
. r1es t hat the average U. for the flow regi. me m
vauon imp . . 1s
question . > 0.25 that of the
setting velocity of the smallest particle remaining (U.<0.2Sco).

236 237
 ONE AND STONE BREAKAGE FROM BOW-DRIVEN ARROWPOINTS IN
B
T WO WHITE TAILED DEER CARCASSES

PAVLISH, L. A.1 & SAVAGE, H.2

'Archaeometry Laboratory, Isotrace, University of Toronto, 60 St George st., M5S IA7 Toronto, Canada,
2Department of Anthropology, University of Toronto, Toronto, Canada

Stone projectile points hafted on modem arrow shafts were shot into the left side of two white-tailed deer carcasses. T he bow
used in the experiment was calibrated using both a ballistic pendulum and high-speed photography. A 66 cm draw on the bow
was used for the experimental shots, and it produced a range of velocities of between 35 meters and 42 meters per second. T he

bone damage done to the scapulae and the ribs was recorded. Bone and stone broke with forces of between 300 and I 000 lbs
[J.3 x Id nt and 4.4 x J(J3 nt]. T he bones were cleaned and the damage was photographically catalogued. T he observed damage
to the white-tailed deer bones may provide a useful frame of reference for the interpretation of similar damage on bone recov
ered from an archaeological context and insights into ancient hunting technologies.

KEYWORDS: EXPERIMENTAL ARCHAEOLOGY, ANCIENT TECHNOLOGY, BONE BREAKAGE,

STONE BREAKAGE, DEER BONES, BOW-DRIVEN ARROWPOINTS, BALLISTIC PENDULUM.

Introduction Bone source

The experiment reported below represents a small but sig
nificant part of a project which had as its goal the reconstruc
tion of aspects of ancient technology. The objective herein was
to quantify the velocity of stone point-tipped arrows, the forces
of impact such arrows have when hitting bone, and the conse
quent bone damage. The forces generated are capable of
destroying both bone and stone, as well as the occasional
arrowshaft. The resultant damage to deer bones and stone
projectile points was recorded. The observed damage provides
a frame of reference for the interpretation of similar damage
observed on archaeological samples. This paper provides an
outline of the experimental design, the results obtained from the
perspective of the damaged bone, and observations derived
from those results. Bone is a composite material which is
extremely durable having an ultimate tensile strength of
approximately 1400 lbs/in2 (100 kg/cm2). Its tensile strength is
one-half that of brass, twice that of teak wood, and 40 times that
of cast iron. Bone is very capable of absorbing energy from the
impact of stone projectiles and is tough enough in many
instances to break or shatter the stone. Bone injuries resultant
from stone and metal implements used for medical purposes
(e.g., trephination, Ortner & Putschar 1981) or weaponry (Noe
Nygaard 1974; Knowles 1983; Turner 1983) have been report
ed from time to time in the archaeological record. In addition,
studies of ancient butchering practices (Guilday et al. 1962;
Lyman 1978) and a number of replicative experiments with
respect to butchering techniques and their effect on bone have
been carried out by a number of researchers (e.g., Stanford et
al. 1981). However, there appears to be no known literature
which attempts to replicate and quantify bone injury due to
stone projectiles. Thus, this study may be useful for establish
ing the ground work for fu1ther research of this kind.
Experimental design
Bow and arrow
The experiment was carried out using a standard 25 pound
bow with modem arrow shafts hafted with stone projectile points
manufactured to an archaeological standard (cf., Pavlish 2001).
Two white-tailed deer carcasses were obtained from the
Ministry of Natural Resources of Ontario and stored in the
freezers of the Department of Zoology in the Ramsay W right
Building, University of Toronto until used in the experiment.
Archery space was provided in the IsoTrace Laboratory by
A. E. Litherland, Department of Physics, for the experiment.
A small crane was used to suspend each deer, after thawing,
by the forelegs. Prior to the experiment, it was observed that
the animals (FA-343-18 and FA-343-21) had multiple frac
tures of the extremities, ribs and mandibles, primarily to the
right sides of the deer. The arrows were shot horizontally from
a measured distance from the targets, and all pertinent data
were recorded. The bones were then cleaned and the damaged
areas identified and described.
Results
A total of 122 shots were made at the two deer carcasses,
using 62 different projectile points at an average distance of
two metres. Thirty-eight percent of the shots resulted in point
breakage (46). Bow draws of 30 and 45 cm did not generate
forces sufficient to penetrate the animal skin, while 60 and 66
ems draws did penetrate to the bone or into the chest cavity.
Breakage of projectile points was primarily due to contact
with bone (43), but such contact did not always lead to break
age as 64 shots (52%) were influenced by bone. Fibrous liga
ments and tendons often adjacent to the bone are believed to
arrest the arrow's movement without leaving a mark on the
bone. Therefore, only 67% of the shots striking bone resulted
in the breakage of the projectile points (cf., Table 1). Bone and
stone breakage occurred with calculated forces of between
approximately 300 and 1000 lbs (1.3 x 103 nt - 4.4 x 103 nt)
being generated by the impact of the arrows. Table 2 gives the
depth of penetration and associated work and rate of work
(power) done for producing the bone injuries. Bone injuries
due to the impact of the arrow-points on the bones themselves
were evidenced by finding the projectile points imbedded in
bone, indentations and scratches on the bone surface, notches
on borders or iidges of the bones; or bevelling of the fracture
planes inward from the direction of flight of the arrow-point.

Proceedings of the 31" lntemational Symposium on Archaeo111et1y, le rem, E. & T. Biro, K. (eds.), Archaeopress -Arclweolingua, BAR - Centi: 111: Se1: 1.
 Pavlish, L. A. & Savage, H. Bone and stone breakage from bow-driven arrowpoints in two white tailed deer carcasses

Stone Bone Stone Bone Total

from that of the ruTows. In general, the car showed a single, small imbedded 343-18: X wt. 20.9 2.0 gm, X vel. 32.9 2.9 m/sec; FA-
Remaining Breakage Breakage Influenced Shots . i mpact
on th left ilium in the hip-bone
outside of the deer carcasses produced fractu e anterior to the acetabulum . Although the unpre 343-21: X wt. 20.4 1.5 gm, X vel. 33.5 2.2 m/sec. These
No. of 10 38 46 64 122 . res of th . point just
. e nbs,
either as simple transverse fractures or splinteri of chance must be considered a possibility, data show that there is no statistical difference between shots
anows 7 . . ng and ra .
diat- dictable element
L_j mg fractures, but without points of impact or (FA-343-18) and the taken at the respective deer with regard to weight and
bevelled p
Ianes the differential injury between the doe
of fracture. FA-343-18, the 1-112 year old doe velocity. There were 38 injuries to the bone examined that are
LJ6
Percent 8% 31% 38% 52% (FA-343-21) due to projectile points crossing
. , showed fo heavier buck
. . . . ur
shots % proJect11 e pomt-re1 ated InJu nes on three left ribs contralateral ribs (cf., definitely associated with the aJTows that struck them. Ten
fiive .
lll JUn th rough the chest cavity to damage right
59% to the left scapula, and 12 injmies to seven
' es differences in body aJTows produced injuries that left direct evidence in the form
right nbs Tab les 3 and 4) may be a function of the
L---'I '-'-----' by
anows which had traversed the chest cavity from of broken stone projectile point fragments. Five shots left
.

left to g mass and tissue resistance between the animals (about two
. . . n ht
Table 1. The number and percentage of the 122 bow shots Two 1mbedded pomts were found m the left scap the doe's impressions or scratches that were independent of related
. . ula, and tw and a quarter times as many shots passed through
that occurred in the four non-exclusive categories: . . o
pomts m the nght nbs. Some aJTows were observ through that of the buck). (Table 4 shows that injmies. Eighteen anows caused chipping while six totally
. . ed to bounc
e body cavity as
1) stone remaining in bone; 2) bone breakage due to stone; .
back, after st nking the carcass, especially after
striking It Ill 7.5 times as many chips and notches were found on the doe's perforated the bone (e.g., scapula). Two shots shattered ribs
3) stone breakage; and, 4) bone influenced shots. . . . .

the v1c1mty of the left scapula which provides a

ribs as on those of the buck.) without imbedding. All partial penetration left imbedded
shield-lik
e
Also noted are the 26% relationship protection for the 1ibs. The left scapula in li" Indentations and scratches were found only on the buck pieces of stone. Therefore, 31% of all the shots resulted in
. , l'e , 0verIies
between the shots that resulted in bone breakage port10ns of the left 2nd to 6th iibs, and would prote and the heavier animal provided the only examples of shat identifiable bone injury although only 8% of all the shots and
. ct them
and the ones that had stone remaining; from aJTow-pmts. In the anomalous position tered ribs. Table 4 records the bone injury observed as a func 26% of bone injury shots had remains of stone projectile
of being
and, the 59% relationship between the shots that are influ suspendd ve1t1call by the forelegs, the location of the tion of increasing forces and summarizes those observations. point fragments in evidence. Thus, while 64 shots (52% of
scapu
enced by bone and those that actually left signs of breakage. lae relative to the nbs of the thorax is unce1tain. In the total) had been influenced by bone in some manner, only
FA- 343- Both tables present information on the recovery of imbedded
21, the 1-1/2 year old, heavier buck, five left ribs points and the bone injury detected from the experiment on 59% of those affected by bone left an identifiable record in
showed
The effect on the projectiles, some of which had been heat seven rueas of damage and two imbedded projectile the bone recovered (38).
points. the two deer carcasses. The mean weight of the projectiles
treated, is also noteworthy but regrettably, outside the The left scapula had four points of damage, one of which
had and the velocity at which they were shot at the deer are: FA-
mandate of this discussion. At the outset, it was necessary to an almost intact anow-point in situ. Four right ribs show General comments
ed
distinguish damage done to the bones by the impact of the car points of impact, one of which had the tip still imbedded. Increasing force
The
0.. It is understandable why there is so little uncontrove1tible
:.a
Bone Depth Pen. Time Accel- Force
() evidence of projectile point injury to bone recovered in the
Work Power
Tot. thick (sec) eration (lbs) (ft-lbs) (ft-lbs/sec) archaeological record. The experiments concentrated on
..c
(in) (%) (ft/sec2) (newtons) (joules) HP B
0
trying to hit bone at close range, yet only 8% of the shots left
(cm) (m/sec2) (Watts) z parts of points imbedded. A hunter, in many instances, would
Bone
probably consider it a poor shot if bone were hit as the poten
Fa 343 18
(18) 7th .125 .00026 -5.83Xl 05
80% 815 8.49 44700 tial of actually downing an animal quickly would be greatly
rt. rib RIBS (left)
.150 (81)
6th 2 2 diminished if it could still travel relatively easily. In other
embedded .32 - l .78Xl 05 3627 11.55 60426
7th 1 1 instances, however, only one shot would have been required
oint .38
1 l th 1 1 regardless of whether or not bone was hit. Natural decay

(18) left .242

RIBS (right) processes through time further greatly diminish the opportu
.00038 -2.90xl 05 416 8.38 22050
25% 1
spacula .950
6th 1 nity of finding any bone on an archaeological site let alone
(40) 2 1
7th 3 x injury on the bone. However, when presumed injury is iden
embed ia -0.88xl 05 1851 11.40 29840
8th 2 2
.68 tified on an archaeological specimen, it can be compared
9th 1 1
with these experimental results. Unfortunately, without the
10th 2 2
(18) left .365
100% .00051 -2.30xl 05 298 9.08 46310 actual stone fragment, one often cannot unequivocally estab
11th 1 1
scap. bone .365 (84) lish the presence of an aJTow-related injury, but one may be
12th 2 x 2
shattered .93 -0. 70Xl 05 1326 12.35 62664
1 able to state the general probability of its occunence. Once
.93
L. scap xx 2
totals 21 [4] 15 3 3 the possibility of anow damage is established, one can make
a range of observations about the hunting technology being
(21) L 4th .210 .00032 -3.50xl05 489 8.55 26720
100% FA 343 employed. For example, one may be able to say something
rib embed .210 (48.6)
RIBS (left) about the forces being employed by ancient hunters with
.53 -l .07Xl05 2176 11.63 36255
.53
4th 1 x their bows or atlatls and make inferences about their hunting
5th 1 x 1 techniques.
6th 2
(21) L 6th .100 .00016 -6.50XlQ5 968 8.06 12900
50% 8th 2 1 </)
rib embed .205 -e </) -e </) v </)
(23.5) 1 v v v v </) v
13th 1 .... i::
.25 - l .98xl 05 4308 10.96 17531
</)
....
....
;:I i:: ;:I i::
;:I
v ;:I i::
;:I
RIBS (right) c '2 ;:I 2 i:: 2
.52
c; - 2 - 2 ;:I - '2
-
-
6th 1 1 c. </)
- </) 2
- v v
.D .D .D .D c
8th 1 1 </) .D 0 c
(21) L 8th .230 .00035 -3.lQXlQ5 443 8.48 24230 0 0 i:2 i:2 i:2 i:2
0
100% 11th 1 1 v
..c
i:2
rib .230 (44) 1
0.. </) ,.j ,.j ii ii <;
....
v <;
12th 1 x s ..c
.58 -0.95Xl 05 1984 11.53 32824 "' 0 0 0 0 0 0
.58
L.ilium 1 x 1 VJ z z z z z z 0
L. scap xx l l 1 FA 343 18 - 70 35 (3) 4 (7) 12 16 5 21
totals 17 [6] 5 3 4 3 2
(21) L .170 .00025 -4.44xl05 612 8.68 34720
100% FA 343 21 - 52 27 (5) 1 (4) 1 ll 2 13
scap just .170 (63)
totals for 38 [10] 5 18 7 6 2
penetrated .43 - l .35Xl 05 2723 11.80 46998
both deer totals 122 62 (8) 11 (11) 16 27 11 38
.43

Table 3. Relative bone damage Table 4. Bone injury from arrow point damage
Table 2. Depth of penetration, time, acceleration, force, work and power for selected shots. as a function of increasing force. as a function of location.

240 24 1
 Pavlish, L. A. & Savage, H.

Observations
References
EXPERIMENTAL RE SULTS
General
Baker, J. & Brothwell, D., 1 980, Animal Diseases in
Arc hae
FROM THE szAZHALOMBATTA ARCHA E OLOGI C AL PARK
1 . Based on expeii . ology (Chapter 7, Traumatic Injury), Academic
mentation, bone Press,
. damage due to hunting London. POROSZLAI, I.
proJect'l
1 es will .
be relat . .
ively rare m the archaeol
context. Archaeol
ogicaIIY related proce
ogical Guilday, J. E., Parmalee, P. W. & Tanner, D. P., 1 962, Abo
ri _
.
rarefy sue h disco ..
veries [bone InJUn .
sses will further
es from natural causes in
inal butchering techniques at the Eschelman Site (3
6 a l Matrica Miizeum, Szdzhalombatta, Gesztenyes u. 1-3., 2440, Hungmy

w1'Id aru. ma1s occ 1 2), Lancaster County, Pennsylvania, Pennsylv

ur on onIy about ania
0.04% of the skeletons Archaeologist 32, 59-83.
recovered (Baker
and Brothwell
1 980)] . Knowles, K., 1 983, Acute traumatic lesions, in Hart, G. D The Archaeological Park, as the first open-air archaeological museum in Hungmy, represents a unique approach toward
2. The penetration .
of the h ide and
bow with a dra w
flesh of the deer requires a
som ewhat in excess
of 1 6 lbs (7 kg).
(ed.), Diseases in Ancient Man, Clark Irwin, Toro
Canada, 61 -83.
nto '. reconstructing the past. Szdzhalombatta is very rich in archaeological sites and remains amongst them the most imp011ant ones
are: a Bonze Age tell-settlement, an hvn Age earthwork with a huge rampart, an Iron Age tumulus cemete1y covering 50 hectares,
3. Bone and stone
300 and 1 00 0 lbs

break age ccurre
d with forces of between Lyman, R., 1 978, Prehistoric butchering techniques in the a Roman military fort and its vicus militaris, etc. The park is situated in the southernmost part of the Hallstatt tumulus cemete1y
. (1.3 X 1 0 nt and 4.4
. x 1 03 nt). lower Granite Reservoir, southeastern Washington, Tebi in an area of6 hectares. The five best-prese1ved tumuli can be found here. One of them, tumulus No. 115 - excavated by Mrs. Agnes
4. PIOJect
. 11es were oft
en stopped by fibro
us ligaments and wa 1 3, 1 -25. Holp011- is unique in Europe because the wooden structure of the burial chamber has survived for 2700 years in its original fonn.
tendons ad'Jacent
. to the bone Ieavm g no
damage on the bone Noe-Nygaard, N., 1 974, Mesolithic hunting in Denmark illus It was decided to conserve and reconstn1ct the prehistoric grave in situ. The interior construction and the exterior presentation of
surface Itse1f.
5. Identifiable bone trated by bone injuries caused by human weapons, Jour the tumulus reconstruction reflect the original situation. The tumulus reconstruction is divided by a fence from the so-called "living
in'Jury may pernut .
a partial reconstruction nal of Archaeological Science l, 217-248. area", where reconstructions of houses ftvm the Bronze- and Iron Ages are being erected. The work began here in 1996, when two
of the techn01 ogy
used.
Ortner, D. J. & Putschar, W. G. J., 1 981 , Identificat ion of houses, some hearths and fireplaces were built and a prehistoric seed-planting experiment started. Bronze casting, potte1y making

Bone damage pathological conditions in human skeletal remains, and firing took place together with the use of prehistoric tools. In 1997, our work enlarged into environmental reconstuction. Our
Smithsonian Contribution to Anthropology 28, 479 pp. aim is to present the natural and cultural landscape of the Middle Bronze Age and Iron Age. Our present-day climate is very similar

The types of da (trephination pp. 95-1 00). to the subatlantic climate of both prehistoric periods. This means that oak forests advanced at the expense of beech. 117e replanted
ma ge w hi ch are
observed on deer bone as a Pavlish, L. A., 2001 , Experimental Archaeology: Bow, Arrow vegetation will thus be representative of the Bronze and Iron Age landscape. The park is going to be a centre for experimental
result of these exp .
enments are as
. . follows: and Projectile Points, Paper given at the 31st International archaeology and education. The goal is not only to create a place for tourists but also an area where eve1ything is authentic and
l . The m dentmg of b . .
one surfaces, with or without retention of
.
the prJectJ1e poi . Symposium on Archaeometry, Budapest, Hungary, in this constructed on the basis of the archaeological evidence. This will be a place where we will be able to present prehistoric lifestyles,
nt tips.

2. Notching of thin volume. handicrafts and agriculture. Archaeologists will be able to carry out various experiments as well as to test their ideas and
. bone edges, e.g., .
nbs Stanford, D., Bonnichsen, R. & Morlan, R., 1 981, The Gins hypotheses derived from the results of different excavations and empirical obse1vations.
3. Creahon of frac .
tures with bevelled

. surfaces slanting away berg Experiment: modem and prehistoric evidence of a

from the directi o
. n of the impact
of the point. bone flaking technology, Science 212, 438-440. KEYWORDS: EXPERIMENTAL ARCHAEOLOGY, ARCHAEOLOGICAL PARKS, HUNGARY.
4. Creation of fra
. cture rmes radiat
ing out from the point of Turner, C., 1 983, Taphonomic reconstructions of human
impact.
5. Perforation of th violence and cannibalism based on mass burials in the The Archaeological Park, as the first prehistoric open air
in bone structures
, e.g., scapulae and ribs. American Southwest, in Lemoine, G. & MacEachem, A. museum in Hungary, represents a unique approach towards
(eds.), A Question of Bone Technology, Archaelogical reconstructing the past.
Association of the University of Calgary, 21 9-240. Szazhalombatta is very rich in archaeological sites and
remains of which the most important ones are: a Bronze Age
tell-settlement, an Iron Age earthwork with a huge rampart, an
Iron Age tumulus cemetery covering 50 hectares, a Roman
military fort - called Matrica - and its vicus militaris, etc.
The settlement got its name from the Hallstatt tumuli: Szdz
is hundred, halom is tumulus. The tumuli are situated in an
area of 1 200xl 300 m along the road leading to the earthwork
(Map 1 ). These people who lived in the nearby fortified
settlement and played a leading role in the Iron Age society
were buried under these tumuli. In 1 847, 1 22 tumuli were
surveyed (Viragh 1 980: 39-46), nowadays 80-90 burial
mounds can be recognised on site but most of them have
eroded and been destroyed.
In spite of the fact that the whole cemetery and the settle
ments are under archaeological protection and a part of them
is a nature conservation area, the owners plough the land,
create orchards or build houses, cellars etc. In 1 990 the
museum suggested to the town municipality to buy at least 6
hectares - where the five biggest and most preserved tumuli
can be found - and show it to the public as a park (see Map 1 :
Archaeological Park).
According to the results of the modem excavations carried
out in the southern part of the cemetery, the tumuli are dated
back to the second half of the 7th century BC, to the Hallstatt
C period (Holport 1 985, 1 993: 30). Two ty pes of burial could
be identified:
- urned or scattered cremation with stone packing under the
tumulus
- urned or scattered cremation in a grave-chamber with
stone packing under the tumulus.
Between 1 990 and 1 996 one of the so called "large tumuli"
(No. 1 1 5) was unearthed, its original height was about 6 m
(Holport 1 996: 34-42). Under this tumulus, unique and
outstanding architectural remains came to light: an almost
intact wooden grave chamber with a funnel shaped corridor.
The museum decided to conserv e the timbers and reconstruct
the chamber and the tumulus itself in situ. The hot charcoal
filling - remains of the funeral pyre - were brought into the
chamber and this smothered burning helped to preserve the
wooden construction. The bottom of the 5,5x5,5 m E-W
oriented log-walled chamber was covered with flat stones
with a boarded floor above. Human ashes were found on the
beaten earth floor of the corridor which exactly joins to the
center of the eastern chamber wall. Both the grave chamber
and the tumulus were surrounded by a built stone ring.
The conservation process started as an experiment and was
very difficult. No other site is known from where d1y wooden
remains were successfully conserved. To prevent the dry
timbers from crumbling into powder they had to be
strengthened with different chemicals. The whole process was
worked out, organised and led by Mr. A. Morg6s, chief
conservator of the Hungarian National Museum (Morg6s
1 999: 335-343).
The possible reconstruction of the grave chamber was
planned by archaeologists and conservators (Holp01t 1 999:
303-309).
In the architectural construction the original form of the
tumulus can be seen (Fig. 1 ). As the grave chamber - on its
original site - was never visible and open for the public, we
decided to present it now in a modem space. The E-W oriented

242 Proceedings of the 31" Internatio11al Symposium on Archaeomet1)>, Jerem, E. & T. Biro, K. (eds.), Archaeopress-Archaeolingua, BAR- Ce11t1: Ew: Se1: 1.
 Poroszlai, I. Experimental results from the Szdzhalombatta Archaeological Park

seen here. As the building process is always a building

experiment, authentic documentations are carried out from the
beginning.
.1 In the following I summarize the (re/construction of an

Early Bronze Age house revealed in the nearby tell settlement
in 1990. (Poroszlai 1992: 154-155, 1996: 6-8, Fig. 2., 1997:
63-66, Abb. 6-7). House 4 came to light on level 6, on the first
' '
Bronze Age level (Nagyrev culture). It was a NW-SE oriented
' ' j
i, .Q. mud walled, round cornered house with two rooms divided by
7 a light-structured wall. The kitchen was 20 cm deeper than the
i , room. There was only one deep post-hole in the central part of

' i a, the dividing wall, 16 cm in diameter and 96 cm deep - the

place of the main post supporting the purlin. Outside the house
,, i
11
i along the SW side of the wall there were some post-holes of

14-15 cm and 6-8 cm in diameter, 4-20 cm far away the wall.
fJ 11
Parallel to the SW wall 5 more post-holes (22-26 cm in
ii
diameter) came to light in 1991 after removing the wall
,,
0
' " remains and there were other small stake holes under the

11 ilut1,,
ii&; Fig. 1. Axonometric view of reconstructed tumulus No. 115.
v.o ' e.--,
f$4
Prehistoric life is also introduced to the public within the 6
hectare area. Next to the reconstructed tumulus an area was
carefully chosen and enclosed by a wattle fence. In two units
(Bronze and Iron Age) houses are being built (Fig. 4). We are
not going to build "a village" but using original ground plans
from excavations, constructions of houses, pits, outbuildings
dividing wall (Fig. 5). The mud walls were ve1y thin, 5-10 cm.
On the excavation, there was no evidence for the entrance
but according to the orientation of the house we consider it
may have been on the SW or SE side.
Two types of reconstruction could be supposed:
- a gabled roof house
- a hipped roof house.
In both case the basic problem was that the thin walls could
hardly bear both their weight and the weight of the roof.
Consequently the post holes found outside the wall must have

Map 1. The Iron Age (Hallstatt culture) tumuli together with the Iron Age and Bronze Age fortified settlements, Szazhalombatta.

tumulus can be visited from the W-E direction to demonstrate
that it is an alien process. The architects considered it very
important to use the most modem material (concrete and steel)
to show the contrast with the original material (wood and
stone). The tumulus inside is divided by a corridor, parallel to
the original funnel shaped one (Fig. 2). The approaching
corridor has a sloping ramp with concrete wall to give the
feeling of going downwards when going upwards. Entering the
tumulus you are on a steel bridge, under and around it the stone
packing can be seen well. A 20 cm thick black painted feno
concrete shell is above the grave chamber and original grey is
above the conidor indicating the difference (Fig. 3).
The spectacular presentation has a definite scenical order:
first a 10-minute-long multimedia show can be enjoyed about
the site, life and bmial customs of the people living here, then
tumulus No. 115 is presented with sound- and light effects. Fig. 2. Inside reconstruction plan of tumulus No. 115.

244 245
 aeological Park
the Szdzhalombatta Arch
Experimental results from
Poroszlai, I.
0
- - - - - - -. .-. - - - - - - - - - - - ... - - - - -- - - - - - - - - - - - - - -- -

ure where the roo

been the remains of such a struct f was
supported by lateral posts. Since with gabled ro
. of
reconstruction round comers are not available, the hipped roof

.
0
house type was chosen. There are two mai n posts mside, the 00
lengthwise The roofing 0f th
purlin does not run to the end e
!.

. ly from the end

house is made by rafters spread out radial 0f
. The height of the wall
the purlin, the roof follows this curve !.izelemen

. . .
tion both edge s of the house
is 180 cm. With this reconstruc
.
porary houses were about
are symmetncal. As the contem .
8-12 m, a 11 m long and 6,5 m wide house was bm1t here
(Fig. 6) Oak was used for the main posts and a.sh for other

rafters and other supporting

structura1 elements. All the
structures were fasten ed with wooden nails and ropes' 1
. .
the excavations we often find . -.
O

strengthened with willow. On

- - - - - - - - - - - - - 11'
'. . . . -. -.
- o o
- .

0
'
-

. ()o
- - -
-
covered with reeds.
I - - - - -
- -

reed 1mpn. nts so the house was o

- - -
_I -
-

- - - - -- - - - - - - 0
. 0000 0
'. -

modem iron too1s

During the building process both .
. axes and sickl es w ere used
Fig. 3. Tumulus No. 115, copies of Bronze Age shafthole
elements. Computer graphic.
.
time was measured, compared
and recorded. Using these tool
grave chamber and
modem
the
Bronze Age tell site.
of house 4 from the
Fig. 5. Ground plan

l
/
j
/

of house 4.
Fig. 6. Rec ontruction plan
to
-long experiences
we need 8-10 year
s were Our opinion is that
overed - e.g. tree crop.
ctions were disc count a real average
more of their fun post- holes planted again, some
of
sickles; to dig of the har vest is
or better cur ved The larger amou nt
barked with axes dles, anot her the seeds from the
ear.
ght han ing after shelling
used with long strai it is used for bak
shafthole axes were onm enta l reconstruction
chisel. The main result of
1997 is an envir
axe was used as a istoric umn 1997 and Spri
ng
and growing preh are territory. In Aut
is an area set out for sowing plan for the 6 hect nze
There and ta - istic of the Bro
bushes - character
ccon spel
seeds - Triticum dico 1998 several trees and
seeds. Both types of Age s. It was le species, oak spe
cies,
and Iron were planted: map
during the Bronze- and Iron Ages -
were widespread arm, who sent
Ancient F el, haw, sloe etc.
Ji ctor of the Butser ash.walnut, elm, com
Peter Rey nolds, dire crop ural landscape of
!'
ons how to carr y out the " sent the natur al and cult
them and gave the
instructi Our aim is to pre
m eters in 16 Age. Our present-day
ent. Within 400
square Age and Early Iron
fl growing" experim the Middle Bronze both
are sow n. The lantic climate of
350 gramm seeds/plot similar to the subat
exper imental plots, climate is very at the
ut 5 cm deep;
the forests advanced
into drills abo It means that oak
seeds are sown in
row s
man ured , prehistmic periods.
ome plot s are
rows is 30 cm. S expense of beech.
distance between the sure d ever y tw o ental reconstruction
the
growing of the whe
at is mea of the environm
som e are not. The spelta In the first phase oodl and .
the dicoccon and and create the w
height of both the original grass
weeks. The avarage goal is to replant grass
est. The h arves t is ies of the original
135 cm before the harv of the total spec
was between 55 and The development On
bronze or ston e-bl aded bush es takes 4-5 years.
with the copies of the growing of the
made by hand or takes 6-7 yea rs, fruit
and eastern border,
r the ear. st, on the northern
sickles. The stem
is cut unde
from 5,6 the edge of the fore
had some 126 kg
first year, in July 1996, we trees will be grow
n. es,
In the In one plot ses with vegetabl
means a more than
20 fold har vest. ens around the hou
kg seeds which There are small gard e wer e
entl y with in 1 cies planted her
we had 0,32 kg,
consequ lentil, pea - all spe
on 1 square meter e.g.: horse-bean,
hectare it means
3.2 tonna.
alombatta. 247
Fig. 4. P lan of the Archaeological Park in Szazh

246
 Poroszlai, I.

EXPERIMENTAL FIRING OF CLAYS USING SALT WATER

VON DER CRONE, M. J. & MAGGETTI, M.

fs,;zhal.ombatta - ,\-;:l1aeological -j;;;:j 1 /

LS! Tdenmg plan I. phase . /'.

Institute of Mineralogy and Petrography, University Peral/es, I700 Fribourg, Switzerland
---.I
/ ..:

"If he wants white pottery, as is more frequent, he uses sea-wate1: If he prefers red or bronze coloured potte1y he makes use
of well- or cistern stored-wate1:" This exce1pt from the book on the potters of Djerba by Combes & Louis (I967) makes reference
to the central theme of von der Crone (I994). By adding salt to a redfiring calcite-rich clay its su1face turns white during firing.
This bleaching phenomenon has been studied in von der Crone (I994) by using simplified "synthetic mixtures" consisting of at
lea st two up to five of the compounds illite, quartz, calcite, dolomite and hematite, considering parameters such as
mineralogical and chemical composition, quartz and calcite granulometry, the firing conditions (oxidizing atmosphere) as well
as the nature of the additives - mainly NaCl along with other salts. These results are then compared to eight natural clays taken
fmm different localities. In using XRF spectroscopy, powder diffraction, Gandolfi, electron microscopy, neutron activation and
Mossbauer spectroscopy it is shown that the bleaching obtained with complex synthetic mixtures is comparable to that of
natural clays and no supplementary firing phases occur with the natural clays. In this article some of the results from the
analysis of these natural clays are presented. The best bleaching is achieved with added halite at temperatures of 900-950C.
The drying is of great importance and it is during this process that the water soluble halite is enriched on the surface of the pot.
. i.t;; Reconstruction of the Iron Afterfiring, the suiface is composed mainly of quartz, plagioclase and pyroxene with no hematite. Depending on the Ca content,
2 ' .
. f} gehlenite may be present. The absence of hematite is due to the newly formed Ca-silicates. Howeve1; the red-coloured core of
the same sample contains considerable amounts of hematite with less pyroxene and plagioclase. The chemical composition of
the clay is the decisive factor influencing good bleaching. Clay rich in CaO permits the formation of Ca-silicates, such as
pyroxene and gehlenite which combine with the iron in their structure. Also, the purity of the white colour depends directly upon
the iron content - the more iron present, the more yellow the colour becomes. Halite accelerates mineral decomposition and
subsequent phase fonnation. Actually, gehlenite and pyroxene appear at temperatures as low as 700C. Furthermore, there is
no free CaO observed during the whole firing process. Another direct effect of halite addition, supplementary to the bleaching
effect, is the loss of K, Na and Rb in the form of chlorides.

KEYWORDS: CL AY S, SALT WATER BLEACHING, FIRING, TUNESIA, SCHW ITZERLAND.

Introduction as a mineralizer in the clay, also attack the walls of the kiln and
can even destroy them. The bleaching in connection with salt
Fig. 7 Environmental reco The most remarkable thing beside the big choice of potter or sea water has been studied by Dufumier (1982), Bearat
nstruction - P hase I.
wares in Tunisia are their colours. The eye is blinded in the (1990) and Beaiat et al. (1989). Dufumier (1982) concluded,
found in the layers of the nearby Bronze Age tell sunlight by a brilliant white. Upon looking closer it can be that the bleaching occurs only in calcite-rich clays, that it is
site or Iron Holport, A.,
Age settlement site and analysed by archaeobotanist
1993, Kora vaskori halomsfros temet6 Erd
s. seen that almost every piece has areas where the white colour only the combination of calcite and halite/sea water which lead
Szazhalombatta hataniban, in Poroszlai, I.
This reconstruction gives an impression that the (ed.), 4000 ev merges into red. Also, the inside of narrow and deep jars turns to the bleaching, that the iron content remains constant, that
Archae a 100 halom vdmsaban, 23-34.
ological Park is the small-scale reproduction of the red close to the bottom. With the aid of ceramic bodies it can the Cl-ion is the responsible factor and not the Na-ion, and that
prehistoric Holport, A., 1996, Architectural remain
landscape (Fig. 7). s in the tumulus be seen that it is just a thin layer that is actually white. The the addition of salt to clay results in a lost of K and Na during
cemetery of Szazhalombatta, in Poroszlai,
The park is going to a centre of experimenta
be I. (ed.), ceramic bodies look like a sandwich, with a white rim (on the firing. He concluded furthermore, that the glass phase
l Excaations at Szdzhalombatta I989-I995, 34-42
archaeo logy and education, a place where every . both sides) and a red core. Although the white rim looks like plays an important role. Von der Crone (1994) showed how
thing is Holp01t, A., 1999, Theoretical and practic
.
au hentJ.c and constructed on the basis of archae
ological
al problems of a slip, it is not. The white outer side and the red core are made ever, that the number of crystalline phases is higher in the
reconstruction in the case of an Iron Age
v1dence. It can be used both by teachers to teach tumulus, in of the same single step clay and were not treated differently. white rim compaied to the red core.
prehistoric Jerem, E. & Poroszlai, I. (ed.), Archaeology
lifest le, handicraft and agriculture, and by of the Bronze The only difference to complete red pottery is that the potters Based on the following observations of Fabbri & Fiori

practJ.ce what they learn from books. The park is
students to nd Iron Age, 303-309, Archaeolingua 9, Budapest. use sea water instead of rainwater or add table salt to the clay. (1986) and Schmidt (1972) it was concluded that formation of
expected to Morgos, A., 1999, The conservation plan
be used by archaeologists to carry out various expe of the Iron Age timber It can be assumed, that the potters know that the dissolved HCl is related to the reaction of halite with the clay minerals
riments as structure of the grave chamber at Szazha

well as to est their ideas and hypotheses derived
from the Jerem, E. & Poroszlai, I. (ed.), Archaeology
lombatta. in salts in the sea water are responsible for the bleaching on the at 500C, complete decomposition of calcite at temperatures
results of different excavations and empirical observa e
of the Bronz surface, but they surely have not thought about the chemical between 500C and 700C and absence of CaO dming the
tions
ince Autumn of 1996 each year our museum
organi es
and Iron Age, 335-343, Archaeolingua 9, Budap
.
Poroszlai, I., 1992, Szazhalombatta-FOldvar
est. and mineralogical processes which lead to this bleaching. whole firing process, Bearat (1990) and Bearat et al. (1989),
environmental and experimental archaeological , in Bona, I. (ed.), This trick and the amounts of salt used are based on empirical whose research is a continuation of the work of Dufumier
courses for Bronzezeit in Ungarn. Forschungen in Tell-Si
students. The paper are published. References can edlungen knowledge and tradition. (1982), assume that the alkaline-metals volatilize in the form
be found on
an Donau und Theiss, 153-155.
the Web site of the "Matiica" Museum and Archaeolo The use of salt is not only known from Tunisia but from the of chl01ides. They explain the effect as an accelerator of
gical Park Poroszlai, I., 1996, Excavations in the Bronz
Fmther information by e-mail: matlica.muzeum@m e Age eaithwork in whole of the North African area to the Orient (Persia). Brooks reactions of halite with the possible formation of CaCl2 by the
atavnet.hu.
Szazhalombatta between 1989 and 1993,
in Poroszlai, I. et al.
(1974) and Matdon (1971) write about Antique (white) reaction of HCl and calcite. The following article focuses on
(ed.), Excavations at Szazhalombatta I989-
References I995 5-15. ceramic bodies from Israel and Mesopotamia. Arnold (1971) the mineralogical reactions taking place dming firing.
Poroszlai, I., 1997, Ein archaologischer arkP in mentions potters in Yucatan who use salty clay and Rye (1976)
Szazhalombatta, Ungam, Das Altertum
Holport, A., 1985, Asatasok Szazhalombattan 1978 -1982, 43 ' 59-68. observed potters in Pakistan who added ground salt to the clay. Composition of three natural clays
Viragh, D., 1980, Varsanyi Janos, a
el6zetes jelentes, Studia Comitatensia 17. magyar regeszet els6 Salts as an additive in ceramics are not only used by aitisans
geodetaja, Geodezia es kartogrdfia 1.
but also in industry (Heimann 1989; Laird & Worcester 1956; Out of eight clays (from different localities) investigated in
Palomo et al. 1985; Schmidt 1972, 1978). Attention should be von der Crone (1994) three characteristic ones, AG, AD and
paid to the use of salts because the gases, which act positively TM 1, have been picked out for this article (Table 1). AG is

248
Proceedings of the 31" Intemational Symposium on Archaeo111et1)', Jerem, E. & T. Biro, K. (eds.), Archaeopress-Archaeolingua, BAR- Centi: Ew: Se1: I.
 Experimental firing of clays using salt water
von der Crone, M. J. & Maggetti, M.
Wo Sp Ana 11
Ge Or He
- Qz An Px
AG v v v
AD TM 1 AG AD - xx
TM 1
Illite 60 65 28 32 40 Si02 74.50 55.96 -
-A. G 1 xxxxx
x
v v
60. 26 xxxxx
AG 2 v
Chlorite 0 x
0 6 Al20 3 17.02 14.16 xxxx x
12.70 AG 3 v
v v x
Kaoli nite 35-40 60- 65 6 Fe203* 2.00 xxxx xx
5.93
4.69 AG 4 v x
x x x
xxxx xxx
Montmorillonite 0 5-10 48 Cao 0.24 17.92 AG 5 v x
14.27 xx xxx x
xxx xx
AG 6
MgO 1.29 2.30 xxx x
4.61 xxxx x
AG 7
Quartz 40 20 28 K20+ Na20 4.20 2.64 5.6 4
. T he relative quantities of the dif.fe
ren phases
2 - AG 7, all fired at 95ooc.
Carbonates 0 25 29 C0 2 0.27 7.63 12.48 of AG and the mixt ures AG
Table 3. XRD-analyse s
- t-<., An Anorthite, Px Pyroxene, Ge = Gehlemte,
. . .v = l/2x . Qz - Quar .
=
Feldspar <5 < 10 5 LOI 4.30 10.60 the Iie1ghts .r
OJ the pe aks .
=

16. 43 are correlated to . t e, S p = Spin el , Ana = Anatase, ll lllite.

vvoll astoni
=

- atite, Wo m
0r- Orthoclase ' He - Hem
=

Table 1. Mineralogical and chemical composition1 of the three clays (AG, AD, TM 1). association present in the experimental
theoretical association
Only selected major elements listed. *Fe101 exper. specimen (x-ray diffraction)
Fig. 2
specim. Fig. 1
from the clay quarry Aga, 1 km to the east of Kleinaga Clay AG Qz + Sp+ [11] + [Or] + [Ana?]
Qz/Mu
AG 1 Qz+Mu
(Thi.iringen, Germany). It is a tertiary clay of the "Luckenauer Qz + Sp+ [Or] + [Ana?]
Qz/Mu
Tonhorizont" with a lot of silt and fine sand. AG is very rich Diffraction analyses of the ceramic body of the unaltered AG 2 Qz+ Mu
Qz+An (+He)+ [Or]
Qz/Mu+Di
in qumtz and contains no carbonates. The clay minerals are clay AG show quartz, orthoclase, spine!, anatase(?) and illite AG 3 Qz+ Mu +An
Qz+An (+Px+ Ge+He)+ [Or]
illite 2/3 and kaolinite 1/3. The iron content is low. The firing (relictic phase) (Table 3). The addition of halite (AG 2) leads Qz/Mu+An+ Di
AG 4 Qz+An e)+ [Or]
colour (without any additives at 950C) of AG is light orange. to a change of colour at the surface from orange to deep red. Qz+An+ Px+ Ge+ Wo (+H
An+ Di+ Qz
AG 5 An+ Di/Wo + Qz
AD is from Tunisia from the hills beyond Guellala (isle of The core is more lightly coloured. Hematite, which is Qz+ Ge+An+ Px +Wo (+He)+ [Or]
An+ Ge/La+ Di
Djerba) and displays the typical salmon colour of these clays. considered to be responsible for this change, appears only AG 6 An+ Di/Wo +(Ge) Qz + Px +An+ [Or]
Di
AD contains about 25% carbonates. The clay minerals are when calcite is added (AG 3), whereas the peaks of spine!, AG 7 An+ Di/Wo +(Ge)
kaolinite, illite and montmorillonite. The iron content is anatase and illite disappear. More calcite leads to the
medium. The firing colour (without any additives at 950C) is formation of plagioclase (AG 4) and then pyroxene and ons of AG 1-7.
ed and theoretical phase associati
red. TM 1 is a mixture of clays, dolomitic marls and sand gehlenite (AG 5). The colour in the core remains orange-red Table 4. Experimentally detemiin
. 2 the different mixtures of
stones from the upper "Siisswassermolasse" from the Grube but the surface turns white - at first partially, then the whole pose. Wl thin the system of Fig. .
erature of 95ooc is not high e
Mettlen (Thurgau, Switzerland) and a rnicaceous sand from phase, it is assumed that the temp AG 3 and AG 4 contam som
of the experimental specimen is covered (AG 5). AG describe the same path.
Weinfelden (Switzerland) and is used by ZZ Ziegeleien Plagioclase, pyroxene and gehlenite are present in the core enough. . .
. metastable gehlenite. . .
Ziirich for making tiles. The content of clay minerals is about and in the white rim. Hematite is found only in the core, The addition of calcite to AG
makes its compositlon n_io:e
The diffe renc e betw een AG
6 and AG 7 is clea r y. vlSlble
35%, mainly composed of montmorillonite and illite. It from the j oining line of quartz-m

ullite to the aO-pole :'ithin ralo gica l com posit10n. G
nepheline only in the white rim. In AG 6 the rim becomes to the naked eye and in the mine
mm) but turns a little yellow because of the the syst em Of Fig 1 From AG 3 on there is form
at10n of
whe reas in AG 6 ge leite,
contains about 30% of carbonates (calcite and dolomite). The thicker (about 1 . .
7 cont ains only pyro xene ,

5
maximum m G 5. From AG
oth ssociat10ns
iron content is medium. The firing colour (without any anorthite. Anorthite reaches a pres ent.
higher Fe content. Now gehlenite is the dominant phase .
thite anor thite and pyro xene are
in the ubtnangle anor
additives at 950C) is red. to AG 6 (the mixture is then um situat10n (Fig . 2).
besides quartz; pyroxene increases and plagioclase decreases roug hly represent the equi libri
gehl enite ) anorthite and quartz decom-
compared to AG 5. The yellow from AG 6 can be turned back diop side/wollastonite-
Results of the natural clays to white by replacing calcite with dolomite (AG 7). In this
after firing case more pyroxene is formed, gehlenite and wollastonite are e AG
no longer present and plagioclase has strongly decreased.
e AD
All three clays were investigated with and without halite Table 4 shows the experimentally determined and the
(Table 2). AG, which has a very simple mineralogical theoretical phase associations of AG 1-7. o TMl
composition (no carbonates), was studied by admixing According to the chemical composition of AG 1 and AG 2,
calcite, dolomite and hematite in addition to halite. If no other spine! does not represent an equilibrium phase (Fig. 1). Its
indications are given, the samples were fired at 950C with a formation can be explained by local illite-illite points of
1 hour holding time. contact. For mullite, which would represent an equilibrium
Forsterite

AG I =AG 2,5 YR 7,5/6

AG2 =AG+ 1,5% NaCl 2,5 YR 4,5/8
AG3 =AG+ 5% Calcite 1,5% NaCl 2/3 of spec. 2,5 YR 516, 113 10 YR 8/1,5
AG4 =AG+ 10% Calcite 1,5% NaCl spotted 2,5 YR 5/6-10 YR 8/1,5
AG5 =AG+ 15% Calcite 1,5% NaCl lOYR 5/6
Periclase

AG6 =AG+30% Calcite+ 1 % Hematite 1,5% NaCl 2,5 y 8/2

AG7 =AG+30% Dolomite+ 1% Hematite 1,5% NaCl white
ss/_-"-=20-"--40;---"-w;---stooss
MgO + 1/2 Fep3
cao + 112 Fei03

f rent admixtures to this clay and su1face colour after firing (Munsell soil colour charts).
Table 2. Shows the dife Fig. 2. Mixtures AG 1-AG 7, AD and TM 1 in tl e hase
Fig. 1. Mixtures AG 1-AG 7, AD and TM 1 in th phase
.
diagram after Osborn & Muan (1960). Abb e 1at10ns:
1 The values of the oxides (Si02 - K,O in wt%) are presented without the LOI. Results of the analysis of the clay minerals in relative quantities (wt%), quartz,
diagram after Osborn et al. ( 1954). Abb1e ia wns: see Table 3, La = Larnite, Ra Rankuute.
:
=

see Table 3, Mel = Melilite, Trid Tndmute.

=
carbonates and feldspar (orthoclase + plagioclase) in absolute quantities (wt%).

251
250
 Experimental firing of clays using salt water
von der Crone, M. J. & Maggetti, M.

to associate the iron surely to a distinct component but it may

Clay AD appears in the system S-C-M-A onl be pyroxene (diopside). After Noller (1983) Fe3+ occupies in
. . y at 15 %
Accordmg to the chenucal composition of Al 0
' 3 diopside the Mg-position (with octahedral configuration) and
. . . we shou1
The experimental specimens of AD display a thin but d expe t -
it is mamly pyroxene, some anor thite that
and sub the Ca-position.
continuous white rim after filing. AD was fired with I wt% of ordinate
gehlenite which represent the firing phases d
. According to Kreimeyer (1985) the distribution of the XRD
halite in steps of 50C between 650-1000C. The bleaching The influence of halite on the filing pha es a pyroxene with a composition ?f:
P eaks of AD indicat

ses
occurs first at temperatures around 750-800C and is best 1.1 and TM 1.3 is shown in Fig. 4. P m T TM l, AG 7 fits best with
. yroxene
cr CaM gosFeo,;Alo.sSi 1.sO6 The distribution of . .
around 900-950C. Diffraction analyses were made of the drastically from TM l to TM 1.1. The diffe m ea ses sized by
. . . rence betwee fassait (ASTM 25-1217) or a pure diops de synthe .
specimens at 650C, 750C and 950C (see Table 5). At n T M
I. I to TM 1.3 1s low, that is, hahte reaches its a low iron content which
Kreimeyer. Both pyroxenes indicate

max1ma1 eff
650C calcite is mostly decomposed. Firing phases are mainly ect
at around 1 wt%. (compared to the other
is effectively the case in AG 7
presented by anorthite, pyroxene and subordinated wollas
pyroxene bearing samples).
tonite and gehlenite, where gehlenite only occurs in the core. Correlai?n between chemica
The same is true for hematite. compos1t1on and firing colourl Conclusions
The projection of AD falls within the system shown in
Fig. l in the subtriangle anorthite-quartz-diopside/wollas In the Figs. 5 and 6 the opticl observations
(colour) are These investigations have shown that bleaching is possible
. . .
tonite and in the system shown in Fig. 2 in the subtriangle con-elated to the chenucal composit10n. It is valid
for all eight with all types of clays by adding halite (provided that thy
. .
anorthite-diopside-gehlenite/larnite, both times close to the clays and the "synth'
etic nuxtures"from von der Cron
e (1994) contain carbonates). A content of about 1 wt% f hal 1te is
joining line of anorthite-pyroxene. That means that the .
The second diagram in particular shows that the pure most favourable. It is already sufficient to obtam mmeral
observed association at 950C fits the theoretical association. the white colour depends directly upon the iron content.
ness o f
associations close to equilibrium situation at 95ooc, where s
I.I
3. Experimental specimens of TMI, TM
Fig. a non equilibrium situation (Magetti 198 6) is normal at this
Qz Cc II/Mont An Px Ge Wo 95oo c. Beca use of the thick ness . .
Or He and TM 1.3, fired at temperature. The observation on natural clays contammg salt
the sample the outer zone of TM I is oxidi ze more
xxxxx of or halite can be summarized as follows:
650C xx xx v xx x v
than the core and contains more hema
tite. By addmg 1 to/o
.
750C xxxxx v white and contams
een rim and core becon_ies
x x x outer zone turns
v of halite (TM I.I) the
- The difference in colour betw
x
_ e (TM I.3, 3 wto/o)
halll
to processe occumng
addin g more
no more hematite. By is due
visible with firing, but it
950C xxxx xxx xxx v v xx
this zone becomes thicke1:
mula tion of salts m the outer
during the drying stage (accu
zone).
g at 650C 1 a dryg
Best results are achieved by dryin
f rent phases are
Table 5. XRD-analyses of AG (+ 1 wto/oNaCl) at different temperatures. The relative quantities of the dife
small amount of a com-

Fe3+, the rim contains a very s). Potters m Tumsia

_

3, Mont=Montmorillonite. tic zone

oven (in our moderate clima
correlated to the heights of the peaks. Same abbreviations as in Table

mens , Fe3+ exists

m three
ponent w1"th Fe2+ In both speci
luded , that some Fe3+ dry their ware in the sun. . . .
. It can be conc
Clay TM 1 To obtain more information about the position of the iron in different configurations Ca-s1licat1zt1on:
- Halite/NaCl results in a strong
.

.
edral coordination wheeas
the unfired clay AD, the core and the rim of AD (fired at atom s coexist in symetric tetrah n of the white nm consists
ination. It is not possible - The mineralogical compositio
All experimental specimens of TM I show zonation after 950C with 1 wt% halite) were investigated by Mossbauer the others display octra hedra l coord
firing (Fig. 3). In TM l (without halite) the zone close to the spectroscopy. Fig. 7 contains the different spectrums.
Pyroxene Gehlen ite
surface (3-5 mm) is red, the core light brown. The boundary Plagioclase
AD contains 5.2% Fe,0,. Of these 5.7% is hematite.
between core and rim is sharp. Despite this optical difference, Hematite is already indicated in the room temperature 501-------i
15------
25-----i
mineralogical (XRD in Table 6) and chemical analyses (XRF) spectrum (RT spectrum) with a weak six line spectrum (Fig. TM TM
TM
of core and rim are identical. 7a). The abundant ferrihydrite is indicated in the RT-spectrum
'$
Three zones are visible in the cross section of TM 1.1 and in the Fe3+ component with large quadrupol splitting and is 20 40
TM 1.3. From the surface to the inside a yellowish zone well visible in the 4.2 K spectrum (Fig. 7b) as a six line
10
follows a light red zone and then the greenish grey core. The spectrum with a smaller magnetic field.
transition area of the outer zones is diffuse. In TM 1.1 the The ferrihydrite is therefore present in form of super
light red zone is much thicker than the yellowish, while in TM paramagnetic particles with a size < 100 A. The Fe3+ doublet
1.3 it is simply inverted. The change from these outer zones to exists in the RT-spectrum as an overlying of several
the core is sharp as in TM 1. The zoning of these experimental components, while in the 4.2 K spectrum it is mainly due to the
specimens can be explained by their thickness (which is more clay minerals (based on the small quadrupol splitting
than twice that of the others) and the influence of the gas characteristic for clay minerals). The ferrihydrite contributes
phase during the firing. At the surface the oxidizing about 35% of the whole iron, the clay minerals at least 55 %.
atmosphere predominates and leads to the formation of Furthermore, there is a low amount of a component with Fe2+.
hematite, while the different atmosphere (guided by the gases The existence of hematite (12.9%) in the core of the fired
1.3 I. I 1.3
of the reacting phases) in the core does not allow the I.I
specimen (Fig. 7c) is remarkable, while it is missing in the I I.I 1.3
formation of h ematite. The Al203 content of TM 1 is 12. 6%. RT-spectrum as well as in the 4.2 K spectmm of the rim I.3, fired at 950C.
em't.e m T'M I, T'M I I and TM
.FP lagwclase, pyroxene and gehi

This is important because the coexistent field of anorthite Fig. 4. Quantitative analysis OJ

(Fig. 7d and e). Whereas all the iron in the core exists as

Qz An h & ili
600C v x v v
800C 900C 950C 1000c l050C x v v
xxxxx x x
TMl v
TM 1 6,25YR 6/6 x v
5YR 5,5/6 5 YR 6/6 5 YR 6,5/6 5YR 6,5/6 7,5YR 7/5 xxx xxx v v
TM 1.1 xxxxx
TM 1.1 7,5YR 6,5/5 v
5YR 7/6 lOYR 8/4 2,5 y 8/3,5 xxxxx xxx xxxx
TM 1.3
TM 1.3 7,5YR 6,5/5 5YR 7/6 2,5 y 8/3 2,5 y 8/4
ive quantities of the different
. /i I and 3 wtm 'J halite' fired at 950C. The relat
70 0.F .
'J TM I'. TM I wit
Table 7. XRD-anal yses 0F viations as m Lable 3'
r
. F t11e peaks v - l/2x Same abbre

heights OJ

phases are correlated with the . .

_ .

Table 6. Firing temperatures of TM 1 and colour of the fired experimental specimens (suiface).
=Penclase, L1 =L une.
La=Lamite, Le=Leucite, Per
TM I.I= TM 1 + lo/oNaCl, TM 1.3 =TM I+ 3%NaCl.

253
252
 van der Crone, M. J. & Ma
ggetti, M.
Experimental firing of clays using salt water

Fe2o3
0 HL Proceedings of the International Clay Conference
mainly of pyroxene, plagioclase and quartz (subordinated
0 AG Denver, not paged (first proofs).
0 BL nepheline, wollastonite, orthoclase).
90 O GI hematite - is bound in Heimann, R. B., 1989, Assessing the technology of ancient
0 AG _ The iron - in the rim not present as
6 NE 20 is white, although it contains Fe. pottery: the use of ceramic phase diagrams, Archeo
80 0 GI py roxene pyroxene
80 + PN, AD, DJ, 6 NE It is possible to predict bleaching if the chemical or materials 3, 2, 123-148.
_

TM I, TM2 0 /';
Kreimeyer, R., 1985, Die Abhangigkeit der Brennfarbe von
red 40
+ PN, AD, mineralogical composition of the clay is known.
D J,
10 <:no 60 TM I, TM Depending on the iron content whether the bleaching may Ziegeln von der Zusammensetzung der Ausgangs
0 70 red 0 2 _

ei/
+/';
result in a white or yellow colour. An iron content of more substanz, 5th Meeting of the European Clay Groups,
0
60 o than 5-6 wt% Fe,01 leads to yellow. Konka, J. (ed.), Charles University, 515-520.
I 60 40
white-red/ yellow-red _ The optimal firing temperature for good bleaching is Laird, R. T. & Worcester, M., 1956, The inhibiting of lime
I between 850-950C. blowing, Transactions of the British Ceramic Society 55,
50 yellow 545-563.
20
References Maggetti, M., 1986, Majolika aus Mexico - ein archaomet
0 white risches Fallbeispiel, Fortsc/11: Mina 64, 1, 87-103.

CaO+MgO 20 40 Arnold, D. E., 1971, Ethnomineralogy of Ticul, Yucatan Matdon, F. R., 1971, A study of temperatures used in firing
Cao 60 80
Mg O potters: Etics and Emics, American Antiquity 36(1), ancient Mesopotamian pottery, in Science and Archae
20-40. ology, Brill, R.H. (ed.), 65-79, MIT Press, Cambridge,

Fig. 5. D agram (Si02+Al201)-(CaO+MgO)-Fe201. The Bearat, H., 1990, Etude de quelques alterations physico Mass.
Fig. 6. Diagram Fe20rCa
boundmy !mes are based on the mixtures with eight natural . O-MgO. A bleach'
mg to pure chimiques des ceramiques archeologiques, These de Noller, R., 1983, Untersuchungen zur Farbigkeit oxidierend
wh 'lte is only possible with
clays and some "synthetic mixtures" a low iron conte gebrannter Tonkeramik, Dissertation der Freien
nt. doctoral, Univ. de Caen, 162 p.
(see von der Crone 1994).
Bearat,H., Dufournier, D., Nguyen, N. & Raveau, B., 1989, Universitat Berlin, 165 p.
Influence de NaCl sur la couleur et la composition Osborn, E. F., Devries, R. C., Gee, K. H. & Kraner, H. M.,
a)
chimique des pates ceramiques calcaires au cours de leur 1954, Trans. AIME 200, 38-39.
cuisson, Revue d'Archeometrie 13, 43-53. Osborn, E. F. & Muan, A., 1960, Phase equilibrium diagrams
Brooks, D., Bieber, A. M., Jr., Harbottle, G. & Sayre, E. V., of oxide systems, plate l, American Ceramic Soc. and
1974, Biblical Studies through Activation Analysis of Edward Orton, Jr., Ceramic Foundation.
Ancient Pottery, in Archaeological Chemistry, Beck, C. Palomo, A., Vazquez, T., Blanco-Varela, M. T. & Puertas, F.,
W. (ed.), Advances in Chemistry, series 138, American 1985, The mineralizer effect of fluorspar in relation to
Chemical Society, 48-80. the form of addition to an industrial raw mix, Tonind.
AD Combes, J. L. & Louis, A., 1967, Les potiers de Djerba, Ztg. 109, 10, 752-755.
unfired
96 RT Publication du Centre des Arts et Traditions Populaires Rye, 0. S., 1976, Keeping your temper under control, Arch. &

-10 Tunis, 310 p. Phys. Anthrop. in Oceania 11, 2, 105-137.

0
+10 -10 von der Crone, M., 1994, Der Einfluss des Meerwassers auf Schmidt, E., 1972, Bekampfung von Kalkschaden <lurch
0 +10
die Weissfiirbung beim Brennen keramischer Massen, Chloridzusatze und andere Massnahmen, Silikat-Journal
c)
Dissertation der Universitat Freiburg (Schweiz), 177 p. 11, 2/3, 33-41.
100 Dufournier, D., 1982, L'utilisation de l'eau de mer dans la Schmidt, H., 1978, Mi::iglichkeiten zur Verbesserung von
'#-
preparation des pates ceramiques calcaires, premieres Ziegelrohstoffen <lurch Zusatze, Ziegelind. Int. 9,
c:
0 observations Sur les consequences d'un tel traitement, 500-517, Development in Sedimentology 35, F. V.H. van
-Cii
Vl
Revue d'Archeometrie 6, 87-100 . Olphen, Elsevier.
.E
Vl Fabbri, B. & Fiori, C., 1986, Influence of sodium chloride on
c:
co thermal reactions of heavy clays during firing,
.=
Q)
> AD Core
.;; 94 RT
co
Qi -6
0:: 0 +6

d)
e)
10
10

I
I

i
I
I

I
93 AD Rim
RT
95 AD Rim
4.2 K
-6 0
+6 -10 -- ---1
0 +10
Velocity (mm/s)

Fig. 7. Mossbauer spectrums of

the unfired cl.
ay AD, the core and the
white rim of AD fired at 95o
RT = room tempera oc
ture.

254
255
 CHEMICAL AND PETROGRAPHIC DISTINCTION BETWEEN
THREE MEDIEVAL BRICK PRODUCTIONS IN SWITZERLAND

WOLF, S.

Institute of Mineralogy and Petrography; University of Fribourg, CH-1700 Fribourg

The bricks from St. Urban, a Cistercian monastery in the Canton of Lucerne became subject of archaeological and
archaeometric inqui1y because of their unusual size (45x30x25 cm) and their extraordinmy decoration. From decoration
themes it was assumed that apart from the manufactory at St. Urban two other production sites at Fraubrunnen and Frienisberg
(Canton of Bern) existed. Chemical and petrographic analysis of bricks from the three sites has been carried out to address the
question of whether the bricks found in Fraubrunnen and Frienisberg were made in St. Urban, or if these monasteries had their
1 tion
own production sites. The combination of the results of chemical and quantitative image analyses and arts-historic inf0111a
on the decoration indicates the existence of three individual manufactories.

KEYWORDS: SWITZERLAND, 13TH CENTURY, BRICKS, X-RAY-FLUORESCENCE,

QUANTITATIVE IMAGE ANALYSIS.

Introduction found in other monasteiies or nearby c1t1es and castles in

St. Urban, a Cistercian monastery founded in 1194, is
situated about 60 km north-west of Lucerne,
Switzerland (Fig. 1). This monastery is well-known for its
unusual building bricks, which were produceq between 1260
and 1285 (Zemp 1898; Schnyder 1958; Goll 1994). The
particularities of these bricks are their large sizes, 45x30x25 cm
or larger, and the richness of their high-relief decoration. About
200 brick types, which differ in size, form and decoration have
been identified. Actually, the bricks were not only used for
building the monastery at St. Urban, but the monks probably
also sold them (Schnyder 1958): bricks of this type have been
Switzerland. Fraubrunnen and Fiienisberg (Fig. 1) are two
other Cistercian monasteiies, where bricks similar to those
Central produced in St. Urban have been found. Evidence from singular
decoration themes on bricks suggests that Fraubrunnen and
Frienisberg monastery had their own production sites, although
until now, no other manufactory independent from St. Urban
has been recognised (Schnyder 1958; Maurer 1998). Neither at
Fraubrunnen nor at Frienisberg waste pieces or a kiln indicating
brick production have been found. The purpose of this paper is
to investigate the hypothesis of three production sites by
different analytical methods. The present study is part of a PhD
thesis at the University of Fribourg (Wolf in prep.).

FRANCE

SWITZERLAND

North

t,Okm
ITALY

0
1
-- 1

Fig. I. Map showing the geographical and geological locations of the three Cistercian monasteries discussed in this study.
Fr: Fraubrunnen, F: Frienisberg, U: St. Urban. Grey area indicates distribution
of the Lower Sweet Water Molasse in Switzerland.

Proceedings of the 31" lntemationa/ Symposium on Archaeometl)', Jerem, E. & T. Biro, K. (eds.). Archaeopress-Archaeolingua, BAR-Centi: Ew: Se1: I.
 Chemical and petrographic distinction between three Medieval brick productions in Switzerland
Wolf, S.

Qtz
Analytical methods Geological situation
1400
Sampling
.

Th geograp cal nd geological situation of the
studied 1200
.
sites is shown m Fig. 1. The three sites are situ
ated n
A total of 86 biick samples from St. Urban (n=51), sedimentary deposits (Lower Sweet Water Molasse)
of t .-21000
Fraubnmnen (n=20) and Fiienisberg (n=l5) were selected for same geological unit (Letsch 1907). The geologica
chemical, mineralogical and petrographic analyses. The major comprises red clays, silts and sandstones (Keller et al.
l uni Ul
c
Q)
Qtz

199Q c 800
-
ity of the bricks are part of Swiss Museum collections in Basel, Muller et al. 1984; Peters 1949). The sandstones
ar Q)

Bern, Lucerne and Zurich. Samples of 15 to 20 gm were needed composed of quartz sands and granite rock fragments;
>
the ,p
ro 600
for full chemical and mineralogical analysis and thin section. clays consist mainly of illite, muscovite, chlorite and an iron
0:::
hydroxide (Wolf in prep.). We assume that the red illitic clay 400
s
Microscopy and quantitative image analysis and the sandstones represent the raw material for the bricks.
200
A great number of thin sections (n=86) of the three sites has Results and discussion
been studied in detail under a polarising microscope. A careful of petrographic, mineralogical
selection of 13 thin sections, which are representative for each and chemical characterisation . -....,_ -
-. .... ... ...._.
.-... __
-
.. 20 25 30
-...
-

site, was made to perform quantitative image analyses. In b .

- -- .._,
-

....:... .:._...
- .

.

}@!! . . .--.. ....

angle 21'} ()
order to account for an eventual heterogeneity in the sample,
-
Microscopy and quantitative image analysis: In thin .
-_ . _ .

2 '.- . , -- , _ 111
-!'

five areas (6.88 mm ) were analysed per thin section. The section (refer to Maggetti 1982) we can distinguish between I - ,, .. .
..
.. Fig. 3. X-ray powder diffraction pattern of three brick
images were processed using digitised analysing software a fine grained matrix (grain diameter <0.015 mm) and non
:t .-
. -.- ..
-
... -

.

samples. The diffraction patterns reveal similar phase
-
. -
.. ... "
(IMAGENIA, Biocom, Lyon). plastic inclusions (>0.015 mm). The bricks show a red - ... 116:
-

... compositions. Sample no. 7: St. Urban (a), sample no.

matrix and non-plastic inclusions of grain diameters - . -
.- .
- ' Frienisberg (b) and sample no. 105: Fraubrunnen (c).
.....
- -
..
.
between 0.015 and 10 mm. The inclusions consist of quartz, . -
-
Mineralogical analysis Qtz=quartz, K=potassium feldspm; P=plagioclase,
. - ,
' ., -..
plagioclase, potassium feldspar and rock fragments . _...
r

'
...
.!'II -
H=hematite, S=spinel.
Phase composit10ns were determined by x-ray powder (quartzite and granite). Clay pellets (Withbread 1986) of
a .
diffraction (D500 SIEMENS, CuKa radiation) equipped with various diameters (0.5-2.5 cm) are identified. Secondary trace elements.
con-elation trends. This is also true for some
_ -
-
-
.. -" ._. ,., . -
- _,.
a graphite monochromator (Institute of Mineralogy, University calcite crystals, which are lining some pore walls, are rare. tive conlation
Fig. 4a (Si0/Alz03) shows a fairly linear neg
--
. - ..
..

of Fribourg, Switzerland). A step angle of 0.02 29 and a Small muscovite particles (0.015-0.1 mm) are hardly
. . .. . .... ....
.... .
... _,
...
-

i -'!'
, - -
. - ..
-
-- trend, whereas Ti0/Al203 (Fig. 4b), Cr+
Ni/MgO (Fig. c)
measuring time of 1 sec./step was chosen for analysis. observed. We determined the abundance of grains, i.e. the - ...., positive con-elauon
and Na,O + KzOI Fe203 (Fig. 4f) show
, 111'
.
-

. .... .... -
and most of the
. - --
ratio of the surface occupied by the grains to the total
trends. No con-elation has been found for CaO
..

surface, and the grain size distribution. Following Delesse's er, the con-elatin
trace elements (Rb, Sr V, Y, Zn, Zr). Howev
Chemical analysis ..
'
,1..
of non-plastic
.
Principle the brick's temper proportion ( vol%) equals the
can be ascribed to varying proportions

.. . I
Chemical compositions were determined by analysing ratio between the cumulative surface of the grains and the _.....,., - .. . "' - .
.. ..
inclusions as already confirmed by quanti
tative thin section
major (Si, Ti, Al, Fe, Mn, Mg, Ca, Na, K, P) and trace element total surface of the analysed area (De Hoff & Rhines 1972).
-
. .
.
.. .....
analyses. Furthermore, referring to the ge . logical si ation,
(Ba, Cr, Cu, Ni, Pb, Rb, Sr, V, Y, Zn, Zr) concentrations using Digital images (Fig. 2a-2c) of parts of typical thin section
I '
high roportion f
high silica concentrations are related to
,

,.

-

-
X-ray fluorescence (Philips PW 2400, Rh-cathode) at the (area=6.88 mm2) of each site visualise the petrographic
.., .. -
"
,,
silica-rich minerals like quartz and feldsp
ars. High values m
Institute of Mineralogy, University of Fribourg, Switzerland. characteristics of each sample group. Referring to
...

..
...
.,
aluminium, magnesium, iron, potassium,
.
chromium ad
The calibration included 39 standard compositions for major quantitative analysis (Table 1) for a total of 13 representative - -
nickel, which represent the composition of
the initially plastic

._.,

t1 .
.

elements, and 20 for trace elements. For sample preparation non-plastic trae

thin sections the three sites show remarkable variations of
matrix (illite, muscovite, chlorite, biotite and
refer to the PhD thesis of Zanco (1998). proportions of non-plastic inclusions and matrix: St. Urban tion f non-pls uc
.. ':" .. .. . minerals), are related to a low propor . .
ted m a high silica

samples have a high (about 24 vol%) content of non-plastic
inclusions. In this respect the sites are separa

inclusions. The bricks from Fraubnmnen have a

- '
aluminium -
low aluminium (St. Urban) group and a high
Data treatment ..

comparatively low quantity of inclusions (6.64 vol%),

It 'I
....
has
_

- as lso
.. low silica (Fraubrunnen) group. Frienisberg
!.

.
.. ..

Chemical data were analysed using statistical programs whereas Frienisberg samples with about 10 vol% lie tative results - an interm ediate compo sit10n.
quanti

with
available under the statistical package SY STAT (version 5.2). between Fraubrunnen and St. Urban.
. . " ... ... , ... shown
Rb/K20 (Fig. 4d
By looking at the scatter plots CaO/MgO and . .
_

The raw data were recalculated by x-m/cr, where x is the given Mineralogical analysis: X-ray diffraction analyses ed as outliers, Le.
and 4e) three samples can be identifi
percentage of a constituent, cr is the average and s is the showed that the bricks have the same phase composition at (112) and the
ungrouped samples: the Fraubrunnen
standard deviation of the group (Picon 1984). This treatment the three sites (Fig. 3). We identified quartz, plagioclase,
rnrn 3 by their ele:a ed
Frienisberg (139) samples are characterised .
was necessary to account for concentration differences between potassium feldspar, hematite and spinel. proport10ns of illit
Fig. 2. Digital images of a representative thin section K,O and Rb concentrations. Different
the chemical constituents. Cluster analysis uses the average Chemical analysis: Table 2 contains the analyses (average , Fez03) can explam
no. 7: St. Urban (a); no. 105: Fraubrunnen (b); mscovite (K,0, Rb) and chlorite (MgO
linkage of the mean Euclidean distances matrix which is and standard deviation) of the bricks from Fraubrunnen, one in sample
no. 116: Frienisberg (c). their "outlier'; position. The presence of limest .
defined by the measured concentration values of 18 (Si, Ti, Al, Si02 and
Frienisberg and St. Urban. All the samples are aluminium 142 (Frienisberg) can explain its lower
Fe, Mn, Mg, Ca, Na, K, P, Ba, Cr, Cu, Ni, Rb, Sr, V, Y, Zn, Zr) silicate iich bricks characteiised by a silica (Si02) content Al,03 values (Fig. 4a) and CaO concentratio
n that is
of
elements. The probability of right assignment was tested by ranging from 60 to 75 wt%, aluminium (Al203) concentrations no. of thm images per total counts vol% dobble the values of the rest of Frieni sberg samples

sections thin section npi (mean) 2 vs

discriminant analyses. between 15 and 20 wt%. Iron as Fe203 varies from 3.5 to 7.5 (Fig. 4d). On the Discriminan t factr
wt%, and titanium (Ti02) ranges from 0.5 to 0.85 wt%. As outlier s were
Discriminant factor 1 plot (Fig. 5) the
for
3978 6.64 0.86
Contamination the other major elements the magnesium (MgO) content Fraubrunnen 4 5
1.91 input separately. Discriminant analys is shO\ S a clear
4 5 4621 10.26
Frienisberg the outlie rs. The
ranges from 1.4 to 3.5 wt%, and both, manganese (MnO) and
24.18 3.50 separation of the three groups and
5 5 9938
A post-firing contamination has been identified concerning phosphorus (P205) concentrations are below 0.2 wt%. All St. Urban
three "outliers'', one from Fraub runne n (112) and
the element Pb in the Frienisberg group. The values vary samples have a low CaO content varying between 0.5 and do not belong to
3
alstic inclusions (npi) with two from Frienisberg (139, 142),
between 24 and 204 ppm and are therefore not considered for wt%. Sodium (NazO) varies between 1.5 and 1.8 wt% and KP Table 1. Volume percentages of non-p
one of the existing groups.
diameters >0.015 mm of the three studied sites.
statistical analyses. between 2.6 and 4.8 wt%. Most of the major elements display

259
 productions in Switzerland
ction between three Medieval brick
Chemical and petrographic distin
Wolf. S.

5
142 0 112
Fraubrunnen St. Urban
. Frienisberg St. Urban
Conclusions thirdly, the three sample groups foim linear trends m 51 outliers 0139
. scatter 15 20
d iagrams. The assumption that the biicks of the thre . n ()
() average

6)
e sites average () average
A couple of observations and analyses (Wolf in prep.) were produced from the same raw materia1s renders
. . the
suggest that the source of raw material of the three sites was di stmction between the possible production sites di 63.85 2.15 70.29 2.10
fficult. Si02 64.46 1.47
extracted from the same lithological units: firstly, the three Moreover, we have no indication (kiln or waste pie .
0.79 0.03 0.64 0.06 N' o
. . ces of Ti02 0.73 0.03 - Frienisberg
monasteries are all located on Lower Sweet Water Molasse nc
b k ) f
. .
s or a bnck production site at Fraubrunnen
or AlPJ 17.70 0.69 18.13 0.84 15.81 l.03
deposits C<
eller et al. 1990; Muller et al. 1984), secondly, the F nernsberg. Nevertheless, quantitative analysis and che .
. . ffilcal FeP3
' 6.40 0.30 6.84 0.49 4.98 0.60 0
.
composition of the bricks evinced variations in matrix- 0.08 0.02
nuneralogical composition of the bricks is the same and 0.15 0.01
MnO 0.13 0.01 u
3.02 0.36 l.99 0.28
MgO 2.89 0.18
80 Friertisberg (n=15) CaO l.78 l.24 1.39 0.67 1.13 0.50 -5-
l.76 0.19
a) 6 Fraubrunnen (n=20) b) NaP l.66 0.14 l.78 0.12
3.20 0.28
+ St Urban (n=51) 112 4.10 0.24 3.90 0.23
75. 0.9 KP
0.15 0.02 0.10 0.02
PPs 0.14 0.06
:j:\., 100 100
---l
-70

lat* -
0.8
A sum 100
- 1 0+--+-....
...

0
.... +
0
0.7 + + Ba 449 33 420 17 431 19 -10 -5 0 5 10 15
65
- - +ittt
11 153 14 118 12
FACTOR(l)
illlt * Cr 150
C'I
A 0).6 * -t
142
Cu 39 3 50 14 28 5
O
..... ro. 142 A ..... \f+ Ni 78 5 83 11 54 7
112 ++ 163 11 Fig. 5. Results of discriminant analysis using Si, Ti, Al, Fe,
CJ) 0.5 167 10 178 9
Rb Mn, Mg, Ca, Na, K, P, Cl; Cu, Ni, Rb, Sr, Y, V, Zn, Z1:
93 11 103 31
55. Sr 95 20
0.4 34 2 30 4 Fraubrunnen (n=19), Frienisberg (n=13), St.Urban (n=51)
Pb 69 52
134 8 110 15 sites and outliers (n=3) are clearly distinguished.
v 129 12
so 3
2 40 4 31
10 15 20 25 10 25 y 34
12 osters St.
Zn 113 7 122 10 95
Maurer, C., 1998, Die Backsteine des Zisterzienserkl
Al203 (wt%) 17 177 19 ag am "Greifswalder
Urban im Kanton Luzem, Vortr
Zr 156 5 168
fswa ld, Germany, 16.-
Backsteinkolloquium 1998, Grei
300 Fe20/ total iron as Fe3+ 19. 4. 1998.
c) 139 6 d)
=

Maggetti, M., 1982, Phase Analysis and Its Significan

ce for
142 Table 2. XRF analyses: average and standard deviation (cr)
, J. S. & Franklin, A. D.
/;,. Technology and Origin, in Olin
A t;t, 5 - of Frienisberg, Fraubrunnen and St. Urban samples. , Washington, Smithson
-250 (eds.), Archaeological Ceramics
s . "' Major elements in wto/o, trace elements in ppm.
ian Institution, 121-133 .
c..
c.. -A A 112
e'-
4 -
Muller, W. H., Huber, M., Isler
, A. & Kleboth, P., 1984,
- t .... inclusion proportions: the low inclusion proportion of
Kmte der zentralen
Erlauterungen zur geologischen
,11A

..... 200
z 142 !3- Fraubrunnen and the intermediate
composition of Frienisberg
Technischer Bericht
Nordschweiz 1:100000, NAG
RA
Although it has not been
+ -
+ ++ 0 distinguish them from St. Urba
n.
84-25, 119-133.
A -ti-ii-+ 2 ously three independent manu-
possible to identify unambigu en an einigen
"'"
U1so ++ u Peters, T., 1949, Mineralogische Untersuchung
. '4-+t+++ + that chem ical and petrographic
factmies, it is remarkable ffen, Schweiz. Min. Petr.
guish between the schweizerischen Ziegeleirohsto
1 ts to distin
. analysis show consistent resul
eithe r Fraubrunnen Mitt. 49, 391--405.
brick s from alyse, PACT
three sites. Not at least, some 1984, Le traitement des donnees d'an
0 are not found on Picon, M.,
100 ns, whic h
I I I l I I I I I I I or Frienisberg have decoratio
2 3 4 0 1 2 3 4 of chemical and 10, 379-399.
0 1 comb inati on rliche
bricks from St. Urban. The 1958, Die Baukeramik und der mittelalte
rm the existence of Schnyder, R.,
Mg0(wt%) MgO (wt%) quantitative image analyses seem s to confi
osters St. Urban, Bemer
h is supp osed by arts- Backsteinbau des Zisterzienserkl
sites, whic
three individual production eli-Verlag.
Schriften zur Kunst 8, Bern , Bent
200 historians. isation of argillaceous
W hitbread, I. K., 1986, T he char
acter
112 ons, Archaeometry 28,
- e) A 7 -
f) 112 References
inclusions in ceramic thin secti

79-88.
A

- s from St. Urban: analytical
-

139
. 139
1972, Microscopie Wolf, S., in preparation, T he brick
'2J.
.... 6
A Hoff, R. T. & Rhines, F. N.,
Cistercian bricks in
and technical investigation on

De
-
s
-
- + fln' ff "" quantitative, Masson editions, Paris
, 147-178.
Switzerland, PhD thesis, Univ ersity of Fribourg, CH-
St. Urban, Bericht der
-

Goll, J., 1994, Die Klosterzie gelei

8:;1so - +
+f- + + + :"'142
++ +ft+++i++* Stiftung Ziegelei-Muse um 11, 6-10 .
Zanco, A.,
1700 Fribourg.
1998, Provenance and Technology of
Galloroman
H., Mozley, P. S. & Matter,
-

Keller, B., Blasi, H.-R., Platt, N . Western Switzerland,
Terra Sigillata Imitations from
-

142 tur der distalen Unteren

-
A., 1990, Sedimentare Struk
Unpublished PhD thesis,
University of Fribourg,
ihre Bezi ehungen zu Diagenese
Susswassermolasse und
CH-1700 Fribourg.
chen Eige nschaften am Beispiel Festschrift zur
und den petrophysikalis
-
A Technischer Bericht Zemp, J., 1898, Die Backsteine von St. Urban,
der Bohrung Langentha l, NAG R am 25. ]uni 1898,
s Ziirich
Eroffnung des Landesmuseum
100 90-41, 2-62.
Zu1ich, Landesmuseum Zillich.
I I I I I I I I I 1 I
2 5 2 3 4 5 6 7 8
Letsch, E., 1907, Die schweizer
ischen Tonlager. Beitrage zur

F e203 tot (wt%) Geologie der Schweiz, Geote chnische Serie 4, 159-160.

Fig. 4. Scatter plots of the three discussed groups (n= 86): 4a) SiO/ 1 + N'111'M
IA[2o3 4 c) c.
- Al2O3' 4b) TiO:f1'1 . g 0,

4d) CaO/Mg O' 4 e) Rb!'K2o 4f) Na20 + K20/Fe203 tot) (for discussion see text) (group symbols as in 4a).
'

261
260
 General Archaeometry

APPLICATI ON OF S TRUCTURE ANALYSIS IN ARCHAEOMETRY

FERENCZ, CS., FERENCZ-ARKOS, I. & FEHER, A.

Geophysical and Environmental Research Group, HAS-Eotvos Lorand University,

Pazmany Peter setany l/A, Budapest 1117, Hungary, e-mail: csaba@sas.elte.hu

The paper presents the applicability and effectiveness of structure analysis in archaeometry. As a consequence of structure
analysis of the Holy Crown of Hungmy, it is demonstrated that the Crown is a uniformly designed and produced unity as a whole.

KEYWORDS: STRUCTURE ANALYSIS, REMOTE SENSING, HOLY CROWN OF HUNGARY.

Objectives Technic: remote sensing;

Calculated characteristics: Descartes coordinates in mm,

Plenty of hypotheses exists about the origin of ancient and from these the measures (width, heigth, diameter etc.)
remnants. In some cases analysing the structure helps us to in mm (see Table 2).
choose the correct version among them.
Measured Angles Coordinates Remarks
spot
Application of structure analysis (degree,minute,second) (mm)
Hor. Vert. Hor. Ven.

They may be useful if R, 29"35,6' 9016,0' 0 0 Reference

- the structure itself is complex, R. 30"08,0' 90"17,0' +25,4 -0,8 y

- the object has definite measure-data for the different parts,

D., 27"35,0' 223,3 Y.
- the object is not heavily damaged,
32"09,0'
- the time-stability of the measure-data or their proportions is D., Z/41,0' 212,9 Y.
acceptable, 32'02,8'

the different hypotheses have structural consequences. D., Z/42,9' 210,3 Y.

32"01,5'
D.. 2/47,0' 203,9 Y.
Benefits of structure analysis 3157,9'

exactness, possibility to keep the method under strict A, 27"44,2' 9021,1 90,4 -4,l Y.
A., 3158,9' 9018,0' +116,4 -1,6 Y.
control,
H" 29"18,0' 8919,9' -13,8 +44,l Y,
- no starting suppositions will be needed, H,, 30"24,0' 89"19,9' +38,0 +44,l Y,
- all the characteristics can be measured without any direct v, 90"19,4' -2,7 Y.
contact with the (generally) easily destroyable object using v, 9123,6' -53,l Y,
s, 2907,0' 88"56,5' 23,2 +64,5 Y .CO
remote sensing technics (e.g. geodetical methods, stereo
s, 30"37,7' 88"52,0' +50,4 +68,2 Y .CO
photography, laboratory version of aerial and satellite -----..------------- ----
--

passive remote sensing, passive spectrometry using the K, 29"57,9' +18,l Y.

backscattering of the normal light irradiation etc). K, 2941,2' +4,5 Y.
K, 29"32,l' -2,8 Y.
K. 29"19,l' -13,4 Y.
Illustration of the method 3003,2 +22,4 Y.
K,
K, 29"08,7' -21,8 Y.
Structural analysis of the Holy Crown of Hungary. K, 29"49,3' 88"38,2' +11,l +79,4 Y.
K, 29"25,8' 87'45,0' -8,0 +112,6 Y.
The originally accepted hypothesis: the crown consists of
K, 2957,3' 87"57,T +17,6 +112,3 Y.
two main parts (the so called "corona graeca" and "corona K ,, 2914,1' 88"16,8' -17,4 +96,8 Y.
latina"), coming from distant parts of Europe. Ku 29"35,9' 88"07,0' +0,2 +104,7 Y.

K' 8846,1' +73,0 Y.

Control of the method
I

K', 88"45,8' +73,2 Y.

K', 88"43,4 +75,2 Y.
K'' 8839,0' - +127,5 Y.
Ratio-analysis of the coronational mantle.
K'' 88"51,2' - +117,6 Y.
Original hypothesis: a certain part of the mantle was cut in
K', 88"03,8' +107,3 Y.
the course of history. K'' 88"10,9' +101,6 Y.
K',. 88"23,3' +91,5 Y.
Determination of the main measures K'' 29"37,8' 88"01,0' +1,8 ... 109,6 Y.
K' " 29"29,6' 9904,9 -4,9 ... 106,5 Y.
on the Crown
K'u 29"33,6' 88"13,0' -1,6 ...99,9 Y

K' 2941,4' 88"09,5' +4,7 +102,7 Y.

Specification of the measurements:
------ -----------H-------------------------------------------------------------------

Instrument: optical theodolite Table 1.

(using in geodetical measurements); Distances between the projectional planes in coordinate
Measured characteristics: angles (i.e. polar coordinates) determination: at the crossing bands Y+=2790 mm,
(see Table 1 and Fig. l); at the front YH=2700 mm.

Proceedings of the 31" lntemationa/ Symposium on Archaeomet1)>, Jerem, E. & T. Biro, K. (eds.), Archaeopress-Archaeolingua, BAR- Centi: Eiu: Se1: I.
 Ferencz, Cs., Ferencz-Arkos, I. & Fehe1; A. Application of structure analysis in archaeomeny

Measures Name of measure Measured Ideal data Avenge

Only a short summary of the total detailed stru Name of measure
ctura1 analy .i mm inch data deviation
ss
can be presented here. That means the discus (mm) (inch) (mm) (%)
sion of the
A) basic measures of the main parts Width of the throne
Height of the ring 50,4 1,98
of Christ (UNIT) 25.4-25,5 l 25,4-25,5 0
B) main measures of the Crown Width of bands With bead--wire 50.5 $ 51,8 1,99 $ 2,04
C) control of the method (as seen today) Front view diameter 203,9 8 203,2-204,0 -0

measure of bands without omamentics 50,4 $ 51,5 1,98..$ 2,03 Full height 127,0 5 l27,0-lZ7 .5 -0

(today stage, Height of upper part 76,6 .3 76,2-76,5 <I

A) T he basic measure
calculated) Height of ring 50,4 2 50,S-51,0 -1

Probable original cut-measure

-
50,4 -1,98 Width of bands 50,5-51,8 2 50,S-51,0 -2

Result: the dominant appearence of one common Vertical height of

measure m of bands
the two parts. This measure is cca. 50 - 52 mm $52,3 :>2,o6 cross -52,3 2 SP,S-51,0 <3
,1 e . 2 inc
h

Vertically projeeted height of
---- -----------------------

Accuracy of scattering of these measures: 0.5 - 3.5 the cross, from base
%. Lenght of the cross
Side lenght of the upper Pantokrator
Consequence: The Crown is a precise handmade object. from the base- -56.S < 60,0-(2,22 < 2,36) -- meaningless
plaque [15, etc.] -50 -l,97
Distribution of the base-measure: -rim (not integer)
Frontal Pantokrator plaque
Lower part (corona graeca): cca. 48.7 - 52 mm. height:$ 48,7 $1,92
(inclined cca. 16' backward) Front-back diameter 215,9 8,5 215,9-216,8 -0
Upper part (corona latina): cca. 49 - 51.8 mm. together with width:::; 49,7 $1,96
[The "ve1tical" height of the cross: 52.3 nun.) mounting

The base-measure is common with very high accuracy. This - the bead-Wire fomting a rim Table 4. Analysis of the enframing sizes of the Holy Crown.
covers the band sufficiently ;::52 ;::2,05
means that there must have been one "etalon" for cutting these
accurately ax:,;:,31t11:26
accessories (ring, bands, Christ-plaques etc.) for both parts -49 1 93
of Apostole-p!aques on the
-
Height ,
circumterence
(Table 3). bands (characteristic, [15, etc.D
Distance of the small golden
B) Main measures of the Crown loops on the ring, holding -;2 > 50 -2,05 > 1,97
the strings of small pearls

Fig. la. Measured points on the Crown. - Frontal view. (average distance, calculable
Let the measures be presented in inches, or let the width of
from the circumference too)
Christ's throne be used as a unit. This latter one is cca. 25.4
mm - 1 inch on both Christ-plaques. It is to be noted, that all Mean value cca. 50,5 cca. 1,99 "' ----
+.-- ----

the measures of the frontal view are integer without exception Maxima.I deviation from the mean: t3,5%

(Table 4,Fig. 2) !
The numbers representing the measure-data in inch - but Table 3. Measures near 2 inch on the Holy Crown
solely on the complete Crown, and not on the upper and lower ( 1 inch=2,54 cm).
parts separately - produce a complete golden-sectional se
quence: 3
1,2,3,5,8.
e.5
The circumference data of the elliptical ring and the bands
confirm the above discussion (Figs. 3, 4). Fig. 3. T he base line of the Crown is elliptical, its perimeter
is the closing value of the dimension sequence and the ratio
C) Control of the method sequence at the same time: the perimeter is given in inch,
the numbers of ornaments along it are: 8 ornaments
Let the ratios of the mantle be examined. (plaques+gems) and the 13-13 loops fixing
The measures on the mantle are unstable, but the ratios are the strings of little pearls.
stable reasonably. Let the main divider circle of the drawings <')

be considered and the radius of it be used as a unit.

Measured parameters Dimensions

Height to the bottom of cross 127,0mm

Front-view diameter (D,.) 7.03,9 mm
Front-back diameter 215,9 mm
Fig. 1 b. Side view. (Interpreted analogously to D..)
Height of the ring ;o,4 mm
(very precisely identical measured from the
front ..,;ew and the side view)
Width of the bat)ds Width bead-ornaments 50,5 - 51,8 lll!ll

.I \. '
(today inegular because of damages)
Originally shaped Width of bands Without
"
m
omamentics as seen today (calculated) cca. 50,4 $ 51,5 min "' E
Lenght of the cross from base to top cca. 56,5 !Dll1 lii
E
Total lengh t of the cross cca. 58,5 !lllll
Projeeted lenght of the cross along K
La 1 + 2 + V,. ,.. 2 + V,, -t 1 s 6 ... 2V, L > ; -= 6 + 0, 28; L < 8
the vertical axis
from the base 52,3 mm
2v,. > o.28 data: v. co ... -inch
from the contourline of the
upper central plaque 55,3 - 55,5 lll!ll 8 Fig. 4. T he closing of the contour dimensions on the bands
(frontal view). Simultaneously the necessity ofV
Fig. 1 c. Measured points on the Crown. - Rear-side. Table 2. Some measures of the Holy Crown. Fig. 2. Frontal sketch of the Holy Crown. and the range of its values will be obtained.

264 265
 Ferencz, Cs., Ferencz-Arkos, I. & Fehil; A.

Now the ratios can be seen on the next figure: These ratios Conclusions EXPERIMENTAL DATA ON THE TRADE OF RAW M ATERI ALS IN
are very near to a golden sectional graphics, but are not
EUROPE DURING THE LATE BRONZE AGE
complete. Now a hypothesis presents itself. Namely, in case Structural analysis may be an effective
the mantle was originally planned according the rule of the tool in
archeometrical investigations.
SZABO, G.1 & SZONOKY, M.2
golden section, and later a part of the graphics was cut. So one In the presented example this means the
followings:
may calculate the original shape. This can be seen as a dotted - The Holy Crown of Hungary is a uniformly
designed an
d
1 Koszta J6zsef Museum, Szechenyi liget 1, 6600 Szentes, Hungary,
line in Fig. 5. produced unity as a whole.
2Dept. of Geology and Paleontology, J6zsef Attila University, Egyetem u. 2-6, 6722 Szeged, Hunga1y
This result is acceptable and it is in an excellent - The Holy Crown was made according to a
very strict tu 1
agreement to the earlier reconstructions (Balint 1977; e
system me
. Iuctmg the golden section's iules as
_

well.
Mihalyffy 1928). The method of structural analysis works - It was planned in the measure: the ancient
used inch. The technological, manufacturing processes, which very often recquired special knowledge, abilities and technical methods
well in this case too.
and tools as well as the utilization of special raw materials pointed to not only regional relationships, but to such connections
References (only as samples) as well, with the help of which we were able to make historical conclusions. Our analysis of the bronze finds and evaluation of
=1,8
2 field-work observational data have been widely supported by a series of archaeological experiments carried out in Regoly, then
Beothy, M., Feher, A., Ferenczne Arkos, I. &
Ferencz, Cs., later at Bolcske and in the Archeological Site of Szazhalombatta besides the number of scientific analysis carried out in various
1981, Egy regi kor kozmol6giajanak emleke: A laboratories. It can be clearly seen that the acquisition of the rocks used for bronze manufacturing can be connected to three,
magyar
Korona (A Record of an Ancient Cosmo
logy: The clearly distinguishable supply areas. With the help of the results of the experiments carried out so far we managed to draw the
I
Hungarian Crown), (in Hungarian), Fizikai
I Szemle 31 , borders of two regions, which were responsible for the Late Bronze Age metal raw material supply ofTransdanubia. The bronze
\ 473-482. objects northern in their origin and the sandstones with special qualities convenient for casting, which were found in the
\
\ Balint, s., 1977, Unnepi kalendarium
\ (Celebrational Carpathian Basin reinforce the assumptions of the existence of a trade route pointing beyond the Alps. This also poses the
\ Calender), (in Hungarian),
\ Szent Istvan Tarsulat, question of international trade and the importance of a Europe-size division of labou1; greater than that of the Carpathian Basin
'
\ Budapest.
' size besides the question of the bronze supplying raw materials. Since in this case we can definitely talk about not only an
'
'
'
Mihalyffy, E.,1928, Pannonhalma, (in Hungarian), Magyar international trade meeting the demands of some people in terms of consumer's goods and luxurious commodities but a well
...
Mtiveszet 411 .
' ........ organized international trade of special industrial raw materials at a European level, as well.
L Ferencz, Cs., Feher, A., Ferencz-Arkos, I., Henne!,
..-.. ___ ____ ,,,..
S. &
Beothy, M., 1994, Structure analysis and other aspects
in KEYWORDS: LATE BRONZE AGE, EXPERIMENTAL-ARCHAEOLOGY,
Fig. 5. The ratios of the drawings on the mantle. the investigation of the Holy Crown of Hungary and the
ARCHAEOMETALLURGY, PETROLOGICAL ANALY SIS.
coronation regalia, in Sacra Corona Hungariae, Bakay,
K. (ed.), 189-297, Varosi Muzeum, K6szeg. The new bronze finds and foundries which have come to only a couple of copper-ore occurrences in Hungary (Ruda
light recently in Tolna county along the southern parts of the hegy, Lah6cza-hegy, Bajpatak, Velem, Bozsok, Rohonc,
river Danube pose a number of technical and technological Tokaj),5 a number of foundries and metallurgical centers
questions.1 The microprocesses observable in the bronze finds might have existed in this area,6 which manufactured metals
drew our attention to the phenomenons and processes related in different qualities due to the composition of the ore. (The
to the manufacturing and utilization of these objects.2 The fact that the component elements of the ore change in parallel
technological, manufacturing processes, which very often with the mining of the ore-deposits makes this picture more
required special knowledge, abilities and technical methods colorful and sophisticated.)7 According to Szegedy E., on the
and tools as well as the utilization of special raw materials basis of the metallurgical, technological analysis of the Late
point not only to a system of regional relationship, but also to Bronze Age objects, it is possible to define the once existing
such connections, with the help of which we are also able to metallurgical centers and their trade relations as well.8
make historical conclusions.3 Our analysis of the bronze finds Recently, however, Czajlik Z., on the basis of his personal
and evaluation of field-work observational data have been observations and experiences at various sites has claimed that
widely supported by a series of archaeological experiments there are no real existing data indicating or referring to Late
carried out in Regoly, then later at Bolcske and at the Bronze Age metallurgy at localities within our national
Archeological Site of Szazhalombatta as well as a number of borders.9 For example from what we may call the most well
scientific analyses carried out in various laboratories.4 In the known metalwork center in literature; the Velem locality
following parts I would like to give additional inf01mation on despite the numerous field-experiments that had been carried
the trade of the two basic raw materials indispensable for Late out there, no evidence - finds or traces - of metallurgy came
Bronze Age metallurgy: the bronze used for melting and the to light. Though in most cases in the area near the ore
sandstones used for making moulds. occurrences the waste rock burrows are still clearly visible on
A number of Hungarian scientists agrees with the the surface even hundreds of years later as well. 10 There seems
traditional view that though we may suppose the existence of to be a contradiction here, the reason for which might be that

' Szabo 1993; Szabo & Oszvald 1996.

Szabo 1994.
' Szabo I 993a; Szabo l 996a; Szabo 1994-95.
Szabo l 993b; Szabo 1995. I would like to express my deep gratitude to Poroszlai Ildiko, museum director and leader of the Archeological Park for her kind
support in carrying out the open-air experiments. I also appreciate the work of Balogh Andras and the campers of the archeological camp.
' Vastagh & Kiszely 1962: 232; Szegedy 1963: 33.
6 Hampel 1886-96; Josa 1910; Damay 1910; Miske 1904, 1907, 1908, 1913, 1928; Szantai 1878; Lazar 1943: 280-287; Mozsolics 1973, 1984: 21-23;
Koszegi 1988; Kemenczei 1983: 61-67; Kemenczei 1984.
7 Pasztor et al. 1990: 10-11.
8 Szegedy 1963: 40.
Czajlik et al. 1995: 30-35; Czajlik 1993. I also would like to express my gratitude to the author for his kind help and verbal data.
10
Otto & Witter 1952; Otto 1973: 1-9; Zschokke & Preuschen 1932; Pittioni 1957; Eibner 1982, 1993.

266 Proceedings ofrhe 31" lllfemario11a/ Symposium on Archaeo111et1)'. Jerem, E. & T. Biro, K. (eds.), Archaeopress-Archaeoli11gua, BAR-Ce1111: Ew: Sei: 1.
 Szabo, G. & Sz6n6ky, M. Experimental data to the trade of raw materials in Europe during the Late Bronze Age

the earlier records in literature do not make any difference order to gain better drying results a more loose-strnctured characteristic strnctural elements of the Late Bronze Age special technical and technological knowledge, which are
between the ore-processing metallurgical centers, and the maybe organic material thinned mould cast was prepared. 1 metallurgy. If we examine the occurrences and locations of basically characteristic and occur in large amounts in the
metalwork centers doing the manufacturing of finished or Even hundreds of wax moulds could have been prepared, and objects similar to the ring-shaped finds circular in cross Trasdanubian regions, in the Tiszaszentimre find set together
semi-finished bronze raw material pieces. This is also true for by embedding them next to each other they could also have section, and having ornamentations made up of spirally with the rhomb cross section bronze rings generally
the other major metalwork centers in the Carpathian Basin: in been casted at the same time. The b1ittle fracture surfaces running, circular sets of lines as well as their roles or widespread in the Carpathian basin indicate the movement of
their neighborhood the evidence of ore-processing, the observable in most cases on one edge of the objects prove that designations in the Late Bronze Age it can be clearly seen, that this unique object as some kind of currency. 24 Its role of
burrows are also missing. 1 1 the casting taps had been broken from the casted strings or in Transdanubia the ring-shaped raw material finds are equally simply being a raw material however, would not explain such
Consequently in Hungary due to the geographical location lines while warm, then the bronze line still straight was occurring in the major metallurgical centers (Velem, Lengyel, distant occurrences of this really peculiar, thus well-traceable
of the ore-mines and the nature of the work, the metallurgical reheated and heat-treated so that it could be formed to gain the Regoly etc.) as well as at minor human settlements, such as ingot like areas along the tiver Tisza. Namely in this area the
centers connected to the ore-occurrences are separated desired shape. This way with the help of a simple Kisdorog or Szakaly. Besides the almost industrial scale nearby metalwork centres - situated either to the north or the
geographically as a matter of course from the metalwork technological process one could gain numerous raw material production going on at the major metalwork centers, the ingots east - were basically responsible for raw material suppo1t. All
centers doing the further manufacturing of bronze on an pieces, which could have been widely used and easily reaching the tiniest villages could have served as raw material these factors point to the fact that the pieces Transdanubian in
industrial scale on different levels, similarly to the structures transported either by having them striped onto a rod or a supplies for the local blacksmiths. The massive spread of their origin and appearing in distant places also point to the
of human settlements. Thus the extraordinarily rich, Late leather stripe. bronze tools made the local manufacturing of simpler objects movement of the rings derived from their function as some
Bronze Age metalwork developing in the Carpathian Basin As I have already mentioned this is only one of the possible such as bracelets, ankle- and foot-1ings, needles and fibulas,20 kind of a currency, the well-developed Late Bronze Age trade
could have gained its supplies of raw materials only from forms of the raw material pieces, since all the major which could be produced from single bronze strings or lines, and circulation of money and the well-organized support of
mines in the margin areas due to the geographical location of metalwork centers working on an industtial scale could have possible and necessary besides the production and mending of bronze raw materials.
the ore-occurrences. This is not a unique phenomenon in developed besides their peculiar products their own scale of simpler bronze mouldings or casts. The manufacturing of the In the permanent foundties there was some kind of
Europe since with the exception of the recycled objects, the raw material forms, either in the form of tools, jewelry or bronze raw material itself however - even because of the lack preference for the sandstone moulds, which could have been
flourishing northern Bronze Age metalwork utilizes only weapons as well. We have knowledge of sickle-shaped ingots of ores - would have been far beyond of what the minor repeatedly utilized. In the two foundries excavated in 1995 at
imported raw materials as well. 12 Besides the simplest loaf, - which are otherwise inconvenient for utilization - such as settlements could have achieved. But with the help of the the Bolcske-Sziget location the sandstones used for the
tongue and bar-shaped raw material pieces, in the domestic the ones mentioned by Hamper J. from Kalnyikfalva17 as well ingots, which reached them through the means of trade - and production of moulds display a great variety. Besides the
find sets one can find pieces of particular forms and as an octagonal rod, such as the one known from Regoly were quite valuable thanks to their material and this way could heavily compacted materials thinned with sieved quartz sand,
designations. 13 Recently our attention was caught by a ring Veravar. 18 On the latter one even the steps of cutting are have served as some kind of money substitutes - the minor which are almost impossible to tell apart from the real
shaped, multifunctional piece, unique in its ornamentation clearly visible, during which from the solid rod minor pieces settlements could also join a larger scale net of division of sandstones, there are real sandstones occurring in large
and appearance. 14 were cut off for purposes of further manufacturing. The traces labor, that of a Carpathian Basin size. numbers as well. This time I would like to give a description
Among the ring-shaped finds coming from locations at of cutting and the fracture smface refers to the following: first The ornaments of the ring-shaped finds, which recquired of only the most important objects, which were also examined
Szakaly-Ftityiilos and Kisdorog-Hegyiszant6k we managed to the heated rod had been cut in circularly by a chipper or - as special technological knowledge did not intend to represent the in thin-sections.
find numerous pieces circular in cross-section and having a we also checked it out in practice - by a sacketed-axe, then a real or possibly barter value, or the weight of the object. The
spirally running, circular ornamentation, made up of 5-9, piece of the desired size was broken off. Bronze heated above characteristic ornamentation and the technological knowledge Mould for the casting of needles
almost parallel, gently contorniated lines on their surfaces. 800C can be untempered to such a degree that the cutting related to it were convenient for telling apart the products of with a head similar
The ornamentation is missing near the edges of the iing surface becomes totally smooth, such as in case of the casted the different metallurgical centers. The bronze rings appearing to that of a poppy-head
shaped piece; the contorniations or inscriptions occurring pie of the Tiszaszentimre treasure finds, from which a pie in the Tiszaszentimre find set together with their analogies,
very often faintly on the outer side are even more difficult to slice was cut out in all likelihood by using a similar method.19 which primarily can be considered as ingots ve1y typical in The find is intact only at the upper side, where tt is
notice on the inner side of the ring-shaped piece. On one edge The edge of the tool - the well-hammered, previously their appearance, and the other pieces different in their shapes completely straight lined. The left hand side is not totally
of the pieces a jagged surface of fracture with faint edges, thoroughly heat-treated sacketed-axe - used during the but similar in their roles or designations - such as the open complete, thus it is impossible to tell accurately whether there
while on the other edge very often a rounded ending can be experiments did not go blunt relevantly even after several ended, thick casted rings, which very often have cast seams could have been more needles in the mould besides the five
observed. Similar finds are very frequent in the Trans cuttings. After cutting in the rod we relied on the fact that the and remnants of casting taps on them (Pacin,2 1 Retkozberencs22 ones presently visible - though it is very likely since there is
danubian (Dunantul) treasure find sets, but they can also be bronze turns extremely brittle at approximately 600C, thus etc.) - could be convenient objects for revealing the market a gradual decrease in the size of the needles toward the right
observed in the Great Hungarian Plain (Alfold) - in the by hammering the hot bronze ingot we managed to break off areas of once existing ancient bronze raw material trade. hand side. The right side of the mould is ragged, but the
vicinity of the major metalwork centers as well, just like in pieces of the size indicated by the in-cuts . At other times The ring-shaped finds or rings thanks to their raw material cambered connection of the outer needle's edge to the casting
settlements made up of only a couple of homes. On the when we were cutting larger bronze ingots for melting and content represented a great value in the given age. As the gutter point to the fact that there were no more forms
ornamented ring-shaped finds one can often observe traces casting, we did not cut them in advance, but we cut them up thoroughly collected, minor bronze pieces appearing in the inscribed into the mould on this side. On the lower part only
and signs of hammering, shaping and cutting indicating into shapeless, smaller pieces by cold cracking. The treasure find prove, the pieces thanks to the extraordinary incomplete remnants of the casting gutter can be seen. In the
further processing of the material. 15 characteristic, coarse, "greasy" fracture surface is a reliable importance of the bronze raw material had extremely high mould the sides of the needles are rather rectangular - when
As the phenomenons observable on the surface of the indicator of this cold cracking method even hundreds of years values, thus as some kinds of indicators of value they could moulded they could have a diamond-shape, which indicates
objetcs and the archaeological erxperiments proved the later. have served as means for making the barter and normal trade that they must have been hammered subsequently to gain a
manufacturing of the above mentioned ring-shaped pieces Disregarding certain objects, on the basis of what have been easier. The ring-shaped raw materials, due to their material, round shape and thus stretching the otherwise small, 6.7-7
might have consisted of the following steps: first a wax mould said earlier, the peculiar ingot forms, which can be dated to a shape, widespread occurrence and weight changing according centimeters long needles.
covered with more liquid clay layer was used, then later in wider time period within the HA A era outline some to given units23 were especially convenient for functioning as The height of the mould is 8.8 centimeters, the width is
some kind of a good having universal equivalent, thus 8.4 centimeters and the thickness is 3.6 centimeters. It is
fulfilling the role of the ancient currency. The bronze rings or made of reddish -greyish-black in the highly burnt areas -
" According to Pasztor G. a mine and a smeltery must have been working in Velem (Pasztor et al. 1990: 10). His views are generally accepted in the ring-shaped objects besides their primary role of being a raw friable, tabularly compacted ceramics with high quattz
archeological literature as well (Miske 1929), though researches done by a magnetometer so far has not been able to detect anything about the presence of
material, wonderfully accomplished this new function as well. content. The locally derived (Danubian) fine-grained sand
furnaces in the locality (Vastagh & Kiszely 1962: 232).
The appearance of the two pieces - having a spiral running used for thinning the clay is clearly recognizable in the
12 Bronsted, on the basis of the rod-shape raw material, supposes that the people of the northern Bronze Age acquired the metals in this fom1 - as it is proved
by the tight relations even from the area of the Carpathian Basin as well - thanks to the local absence of raw materials (Bronsted 1962: 99-100). circular ornamentation made up of sets of lines and recquiring material of the mould.
13 Hampel 1886-96. Further details can be found in Mozsolics 1984; Fekete 1985; Maraz 1989.
1' Szabo 1996.
15 ibidem 20
Hampel 1886-96: CLXXII.T.l
6
1 Zsak 1960. 21 B. Hellebrandt 1989: 99.
17 Hampel 1886-96: CCV.T. 1-4. 22 Mozsolics 1985: 194, T.1-11.
1' Szabo 1993: 188, 11.T. 5, 7; K6szegi 1993: 225-235. 23 Mozsolics 1963: 68-69.
1' Hampel 1886-96: CLXXII.T.l. " Szabo 1995.

268 269
 Szabo, G. & Sz6n6ky, M.
A piece of a mould for casting a larger
sacketed-axe with ornamentation
of circular striations on the sides
The side of the axe, which is aproximately 3.2x4 centimeters
in diameter lies 2.7 centimeters far from the upper side of the
mould. This distance determines the maximal possible length of
the casting gutter and the clinker pit. On the form under the
sides a minor handle can be observed. The width of the heavily
damaged mould, which was originally chiseled to a prismatic
shape is 7.8, its thickness is 5.4 while its incomplete length is
12.2 centimeters. It is made of red sandstone.
The red, fine-grained sandstone is one of the most widely
used types of stone - in all likelihood due to its frequent
domestic occurrences. Among the sandstone moulds the red,
possibly Upper-Permian or Lower Triassic, fine-grained
sandstones are the most frequent. Rocks similar to the
material of the examined samples can be found in the western
parts of the Mecsek Mountains and the Uplands near Lake
Balaton in Hungary. But this type of rock is also well-known
in Northern and Western Europe.
The mould of a sacketed-axe
On the side of the hose traces of 2, while on the hose itself
traces of 3 striations can be seen. The body of the axe itself
under the horizontally running striations is smooth and
undecorated. The length of the molded axe is 7.8 centimeters,
the width of the hose (outer) is2.8 centimeters. The width of
the axe at the lower part of the hose is 2.1 centimeters, the
width of the edge is 4.4 centimeters. The edge and the hose is
separated by one horizontal striation. The length of the casting
tap at the upper part of the axe is 1.2 centimeters. The mould
itself is intact, originally it must have been used for casting
some other object as it is indicated by the uneven rectangular
shape of the mould, and it should have been chiseled
subsequently to gain the mould of the axe. Its length varies
between 10.5 centimeters and 9.5 centimeters, its width is 5.4,
its thickness is 3 .1 centimeters. Its material is Miocene fossil
bearing calcitic tuff, which in all likelihood comes from the
Tokaj Mountains.
A mould for casting needles, closed by
fracture surfaces on each side
The
4 mm wide, 3 mm deep "V " -shaped contorniations
running parallely 0.9 centimeters far from each other on the
casting mould served for casting the sides of the needles. The
minor traces of rubbing running lengthwise parallelly with
each other on the side of the contorniations indicate that they
must have been rubbed or chiseled from the material of the
mould. The color of the surface of the light-gray, fine-grained
sandstone grew reddish in the middle. The heat effect must
have been stronger on the inner side since the discolored layer
is thicker there. The measures of the piece: width
centimeters, height 5.4 centimeters, thickness 2.6 centimeters.
The mould is made of a looser rock; a light-colored,
yellow, thin-bedded sandstone, which must have been
" Indreko 1956: 9-11.
26 lb.
Fig. 12.
27 Horst 1986; Majnaric-Padnzic 1992: 57-63; Yrdoljak 1992: 75-87.
deposited later during the history of the Earth, in the
Miocene or Pliocene eras. Rocks of this age are very
common in the Carpathian Basin but they also occur in many
places all over Europe, thus the origin of this piece can not
be determined.
The stone axe has a very unique stone material coming
from the Alps: garnet gneiss, or retrograde eclogite. The
material of the polished stone also from this locality is a
typically Alpine-type rock which also occurs in Burgenland:
micaceous quarzite.
A piece of a larger casting mould,
which was chiseled and polished
smooth and straight on one side
The inscribed outlines of two objects can be observed
on the smooth side. Unfortunately they are to faint to
determine the objects themselves. The other side of the
mould is loosely adjusted, slightly semi-rounded. The
object must have been 16 centimeters long, 11 centimeters
wide and 6 centimeters thick originally; unfortunately it is
impossible to give the exact measures of the piece, which
suffered severe damages because of the plough. It is made
of the typical fine-grained Cretaceous sandstone occurring
only at territories far from the Carpathian Basin along the
coasts of the Baltic and North Sea, and which has dark
gray color when burnt. The sandstone having a grayish
color when burnt has been separated during the analysis of
the objects coming from the Bolcske locality and it is
considered to be an alien material in the Carpathian Basin,
which was imported from remote places. The moulds of a
number of objects coming from the locality were made of
this stone, and we also found untouched stones of this type
without any carvings or inscriptions. The raw stone block
refers to the fact - just like the shape of the objects used
in the Carpathian Basin in the ready made, major moulds
- that the sandstone had been transported here in forms of
larger blocks and then it was manufactured later
locally.
The so-called cannelura rock which has come to light for
the first time from the previously mentioned locality in
Hungary is pointing towards connections with the n01thern
areas. The object, which might seem to be a simple, rounded
grinding stone for the first sight has slightly concave lower
and upper parts, and on the side there is an indentation
running around, the cannelura after which the object was
named. This object is very often described in the literature as
an ore-stamping hammer,25 this assumption is not true
however, because there are no ore-occurences
metallurgical centres in the nearby areas where this object
appears - such as in the case of the Bolcske locality. Its
general area of occurrence is the region of the northern
Bronze Age26 and Lake Zurich, furthermore we
knowledge of 1-1 pieces from Bolcske, Hungary and Kalnik,
7 Croatia.27 The number of molded products are
significant in the area of occurrence of the cannelura rocks,
thus we might suppose that this special tool was used in the
foundries - for tamping sand forms as it is indicated by the
270
Experimental data to the trade of raw materials in Europe during the Late Bronze Age
heavily compacted structure of one object examined in thin am Velem-St.Veit-Berg,Westungain, ARCHOST 612,
section. The piroxene andesite cannelura rock coming from 30-35.
the Bolcske foundry has a rock material, which is originated Damay, K., 1910, Az uzsavOlgyi bronzkincs, ArchErt 30,
in all likelihood from the Carpathian Basin. However it is not 426-431.
possible yet to tell the exact place of origin, for this purpose Eibner, C., 1982, Kupfererzbergbau in bsterreichs Alpen, in
further comparing analyses are needed. Siidosteuropa zwischen 1600 und 1000 v. Chr., Band 1.,
Hensel B. (ed.), Berlin, 399-408.
Summary Eibner, C., 1993, Zurn Beginn expe1imentalarchaologischer
Untersuchungen einer bronzezeitlichen Kupferver
It can be clearly seen from what has been said earlier, that hiittungsanlage in Muhlbach, Salzburg, Archeologica
the acquisition of the rocks used for bronze manufacturing Austriaca
77, 31-38.
can be connected to three, clearly distinguishable supply Fekete, M.,
1985, Adatok a koravaskori otvosok es
areas. The first region is more or less equal with the area keresked6k tevekenysegehez, ArchErt 112, 68-91.
lasting to the borders of the settlements; this region served as Hampel, J., 1886-96, A bronzkor Magyarhonban I-Ill,
a supply of quaitz sand used for the production of ceramic Budapest.
moulds and the tamped sand forms. The eastern margin of the Horst, F., 1986, Die Jungbronzezeitliche Kannelurastein des
Alps and the mid-mountains of Hungary comprise the outer mitteleuropischen Raums- Werkzeuge fiir die Bronze
border of the second region. This aiea more or less complies verarbeiteung? Helvetia Archeologica17, Heft 67.
with the Transdanubian region of the "umfield" culture and Indreko, R.,1956, Steingerete mit Rille, Stockholm.
whose connections can be traced until Tokaj, the line of the J6sa, A., 1910, Halstatti vagy "nyfri" kultura, MKE 4,
river Tisza, but this does not continue towaids Transylvania. 109-117.
The third supply area points beyond the Alps, streching as fai Kemenczei, T., 1983, A Tatabanya-banhidai bronzlelet,
as the quarries of Northern and Western Europe. ArchErt 110, 61-67.
W ith the help of the results of the experiments carried out Kemenczei, T., 1984, Die Spiitbronzezeit Nordostungarns,
so fai we managed to draw the borders of two regions, which Budapest.
were responsible for the Late Bronze Age metal raw material Koszegi, F., 1988, A Dunantul tortenete a keso bronzkorban,
supply of Transdanubia. (The local one is naturally out of the Budapest.
question, since there are no copper-ore occurences in Koszegi, F., 1993, A Regoly-Veravar keso bronzkori
Transdanubia.) The first one is the Eastern-Alpian region, leletegyiittes tipol6giai es idorendi kerdesei, Wosinsky
which participated in the bronze supply of Transdanubia by M6r Muzeum Evkonyve 18, 225-235.
means of its casting pies, having distinctively low alloy Lazar, J., 1941, A saghegyi I. es II. szamu bronzleletek
component content and having been transported in large ismertetese, Dunantiili Szemle Konyvei, 185.
amounts. We must seek the other, more remote region in all Lazar, J., 1943, A saghegyi 6skori telep bronzmuvessege -
likelihood in the Erzgebirge from where the peculiar ingots Die Bronzeindustrie der urzeitlichen Siedlung am
with higher tin content, and very often having a ring-shape - Sagberg, DuSz,280-287.
the production of which recquired special knowledge - were Majnaiic-Pandzic, N., 1992, Ljevaonica broncanih predmeta
transported to Hungary. The bronze objects northern in their na Kalniku kod Krizevaca, Opusc. Archaeol. 16, 57-73.
on origin and the sandstones with special qualities convenient for Maraz, B., 1989, Az 6skori bronzmuvesseg viragkora a Del
casting, which were found in the Carpathian Basin also Dunantulon, Baranya 198911-2, 7-25.
reinforce the assumptions of the existence of a trade route Miske, K., 1904, Die Bedeutung Velem St. Veits als
pointing beyond the Alps. This also poses the question of prahistorische Gusstatte mit Beriicksichtigung der
international trade and the importance of a Europe-size Antimon-Bronzefrage, AJA 2, 124-138.
Miske, K., 1907, A Velem Szt. Vidi ostelep, Wien.
division of labour, greater than that of the Carpathian Basin
Miske, K., 1908, Die priihistorische Ansiedlung Velem St. Vid,
size besides the question of the bronze supplying raw
materials. Since in this case we can definitely talk about not Wien.
only an international trade meeting the demands of some Miske, K., 1913, Bronzkori typologia II., MKE 7, 8-24.
people in terms of consumer's goods and luxurious Miske, K., 1928, A t6rtenelem el6tti id6k fernkohaszata, TtK,
commodities but a well-organized international trade of 476-480.
or 28
special industrial raw materials at a European level as well. Miske, K., 1929, Bergbau, verhiittung und Metalbearbeitungs
werkzeuge aus Velem - St. Veit (Westungam), WPZ, 81-94.
References Mozsolics, A., 1963, Der Bronzefund von 6palyi, AAH 15,
65-82.
have B. Hellebrandt, M., 1989, A pacini IV. bronzlelet, ComArcHung, Mozsolics, A., 1973, Bronze und Goldfunde des Karpaten
97-117. beckens, Budapest.
very Bronsted, J., 1962, Bronzezeit in Danemark, in Nordische Mozsolics, A., 1984, Ein Beitrag zum metallhandwerk der
Vorzeit II., Neumiinster. ungaiishen Bronzezeit, BRGK 65, 20-72.
Czajlik, Z., 1993, Exploration geolarcheologique du Mont Mozsolics, A., 1985, Bronzefunde aus Ungarn, Budapest.
Szent Yid, Acta Arch Hung
45, 317-347. Otto, H., 1973, Uber die Auswertung der Metallanalysen in
Czajlik, Z., Molnar, F. & Solymos, G. K., 1995, Angaben zu Band l und 2 der Studien zu den Anfangen der
der Spatbronzezeitlichen Metallrohmaterialversorgung Metallurgie, APA 4, 1-9.
28 Tylecote 1987: 18-22.
271
 Szabo, G. & Sz6n6ky, M.

Otto, H. & Witter, W.,

1952, Handbuch der iilte
sten vor Szabo, G., 1996, T he man
geschichtlichen Metallurg ufacture and usage of Late
ie in Mitteleuropa, Leipzig Bronze
Pasztor, G., Szepessy, . Age rings: two new ring
A. & Kekesi, T., 1990, hoards, in Studien
Szinesfemek Metallindustrie im Karpate zur
metallurgiaja, Budape nbecken und den bena
st. ch
Pittioni, R., 1957, Urzeitli barten Regionen, Kovacs, T.
cher Bergbau auf Kupfere (ed.), Budapest, 207-23
rz, Wien. Szabo, G., l 996a, A szolnoki 0.
Szabo, G., 1993, Fem kincslelet sarloirol. A
megmunkalasi nyomok karp at
a Regoly medencei femmuvesseg ona
Veravar kes6 bronzkori llosodasa, Milzeumi Leve
leletegyiittes targyain, Wos lek
insky 75, Szolnok, 45-51.
M6 r Muzeum Evkonyve
18, 169-224.
Szabo, G., 1993a, Uj Szabo, G. & Oszvald, F., 199
adatok a Karpat-medence 6, Kes6 bronzkori kaiikale
es az eszaki letek
bronzkor kapcsolatab Kisdorogrol es Szakalybol,
an, Ein neuer Beitrag Wosinsky M6r Muzeu
iiber die m
Beziehungen des Evkonyve 19, 89-113.
Karpatenbeckens zur
nordishen Szantai, A., 1878, Az osko
Bronzezeit, Tisicum, ri bronzgydrtds hazdnk ter
105-114. iileten,
Szabo, G., 1993b, Reg Nagyvarad.
eszeti kfserletek Regolyb
en, Dunatdj Szegedy, E., 1963, A bron
1611, 70-75. zkor sarloja, Kohdszati
Lapok
Szabo, G., 1994, A 196311, 33-40.
karpat-medencei kes6bron
zkori sisakok Tylecote, R. F., 1987, The
keszftesenek problem early histmy of metallurg
ru egy ujabb lelet alap y in
jan. Europe, London-New York.
Probleme der Herstel
lung Spatbronzezeitlich
en Helme Vastagh, G. & Kiszely, Gy.,
im Karpatenbecken, 1962, Magyarorszag koha
in A k0kort6l a koze szati
pkorig, emlekei, Kohdszati Lapok 1962
L6rinczy, G. (ed.), Sze
ged, 219-227. 15, 231-237.
Szabo, G., 1994-95, V rdoljak, S., 1992, Nalazi kalu
Eszaki bronztargyak - pa s lokaliteta Kalnik - lgris
vagy eszaki ce
technologia a Kar pat- kao promjer matalurske djel
medenceben? ArchErt atnosti kasnog broncanog
121-122, doba u Sjeverozapadnoj Hrva
79-87. tskoj, Opusc. Arch aeol. 16,
Szabo, G., 1995, Ada 75-87.
tok a kes6 bronzkori pen
zforgalom Zsak, V., 1960, A formaontes
kerdesehez, in Tanulmany lenyege es tortenete, Budapes
ok es kozlemenyek, Ujv t.
ary z. Zschokke, K. & Preusche
(ed.), Debrecen-Szoln n, E., 1932, Das urzeitlich
ok, 49-56. e
Be1gbaugebiet von Miih
lbach-Bischofen, Salzburg
,
MU06.

272