11complete Microbial Dynamics in Subgingival Biofilms

Microbial dynamics
in
subgingival biofilms
ISBN/EAN
978-90-75115-58-1
Printing
Printed by Scholma Druk, Bedum, The Netherlands
Vormgeving
M. Velten
Copyright
All rights reserved. No parts of this publication may be reproduced or transmitted in
any form or by any means without the permission of the author and the publisher
holding the copyright of the published articles.
RIJKSUNIVERSITEIT GRONINGEN
Microbial dynamics
in
subgingival biofilms
Proefschrift
ter verkrijging van het doctoraat in de

Medische Wetenschappen
aan de Rijksuniversiteit Groningen
op gezag van de
Rector Magnificus, dr. F Zwarts,
in het openbaar te verdedigen op
woensdag 21 april 2010
om 13.15 uur
door
Vincent Zijnge
geboren op 20 oktober 1976

te Maassluis
Promotores: Prof. dr. F Abbas
Prof. dr. JE Degener
Copromotor: Dr. Ir. HJM Harmsen
Beoordelingscommissie: Prof. dr. AJ van Winkelhoff

Prof. dr. HC van der Mei
Prof. dr. R Gmr
Paranimfen: Ronny Koeling
Stefan Vegter
To Frank the eloquent professor, your ability to demand quality in a friends way and to end a
discussion with laughter was my motivation button to push!
To John, the professor who emphasized the beauty of a thesis that combines basic with clinical
research and who appreciated my humble Goedemorgen Professor! so much.
To Hermie my friend, for your enthusiasm, support and widely applicable lessons in observation.
Publication of this thesis was financially supported by LabOral, Philips Sonicare, Dr.
G.J. van Hoytema Stichting, Nederlandse vereniging voor Microbiologie and
Tandartsenpraktijk De Jong.
Their contribution is greatly appreciated.
/DE2UDO
Beilerstraat 179
9401 PJ Assen
Tel.: 0592-317570
Spoedlijn: 0592-302430
ABN-AMRO: 47.76.96.600
CONTENTS
Chapter 01 General introduction 009
Chapter 02 Denaturing gradient gel electrophoresis analysis 025

to study bacterial community structure in pockets of
periodontitis patients
Chapter 03 Denaturing gradient gel electrophoresis as a 041

diagnostic tool in periodontal microbiology
Chapter 04 Microbial population dynamics of subgingival pockets after 059

mechanical scaling and root planing
Chapter 05 Oral biofilm architecture on natural teeth 079
Chapter 06 The recolonization hypothesis in a full-mouth or quadrant- 099

wise treatment protocol; a blinded, randomised clinical trial
Chapter 07 General discussion 119
Chapter 08 Summary 129
Chapter 09 Samenvatting 135
Chapter 10 Reference list 141

1
General introduction
This chapter is based on:
Strength in numbers; illness causing biofilms
Zijnge V, Abbas F, Degener JE
Nederlands Tijdschrift voor Tandheelkunde (2008) 115: 5-12

GENERAL INTRODUCTION
The oral cavity

The mouth is an accessible and exposed part of the body both personal and
intimate. It is important in verbal as well as visual communication by the tongue,
lips and teeth. As the entry gate for food, the oral cavity is an essential part of the
body where first part of digestion takes place by enzymes from the salivary glands
and partitioning of food by the teeth. Like other parts of the body, tissues of the
oral cavity are subjected to different kinds of diseases. The most common forms
of oral diseases are associated with bacteria. Halitosis for example, is the forma-
tion of odorous compounds by bacteria on the tongue that result in a bad breath.
Caries on the other hand affects the teeth. Bacterial accumulations on the teeth
that metabolize large quantities of refined sugars produce acids. These acids re-
sorb calcium ions and demineralise the tooth, and eventually cause the formation
of cavities. The most common type of oral diseases however, affects the tissues
surrounding the teeth called the periodontium, hence this is referred to as peri-
odontal disease. The periodontium includes the cementum, the periodontal liga-
ment, the alveolar bone and the gingiva (Figure 1.1.).
Health Periodontitis
Probe
Crown
Cemento-enamel
junction
Plaque
Gingiva Bleeding
Pocket
periodontal Connective tissue
ligament
Root
Alveolar bone
Figure 1.1. Schematic representation of the components that form a healthy periodontium (left).
Note the clinical characteristics of gingivitis like plaque accumulations, bleeding, redness and a
swollen gingiva together with increased pocket depth and bone resorption that define periodontitis
(right). Reprinted with permission from (117).
11
CHAPTER 1
Gingivitis
In a healthy situation, the gingiva is firmly attached to the tooth and has a
pale pink, stippled appearance that does not bleed during mastication or tooth
brushing (Figure 1.2.). Nevertheless, there is a continuous challenge of the tis-
sues by bacteria that become attached to the teeth. These bacteria induce an
inflammatory response that results in a flow of neutrophils from the gingival epi-
thelium (Figure 1.2.). In concert with proper oral hygiene measures however, a
clinically healthy gingiva can be maintained. When the bacteria that have adhered
to the tooth surface are left undisturbed, the total bacterial mass increases. This
mass becomes visible as a white or yellowish layer on the teeth, called dental
plaque, and induces a pronounced inflammatory response. In response, more neu-
trophils migrate out of the epithelium and a gingival infiltrate with neutrophils,
lymphocytes, monocytes and macrophages establishes in the connective tissue
(34). This increased inflammatory response induces the proliferation and dilata-
tion of blood vessels, which results clinically in a red and swollen gingiva that
easily bleeds upon probing, called gingivitis. Gingivitis is the inflammation of the
gingiva caused by the accumulation of supragingival plaque and dental calculus,
and is limited to the gingiva. With proper oral hygiene measures gingivitis is re-
versible within 1-2 weeks, leading to a healthy state (97). About 90% of the adult
population is affected by gingivitis (3). When left untreated gingivitis may remain
stable and limited to the gingiva for months or years, though in some patients the
inflammation becomes more active and results in a destructive lesion called peri-
odontitis. Whether an established gingival lesion transforms into a destructive
lesion, depends on the presence of several risk factors.
Risk factors
Risk factors are generally defined as aspects of personal behaviour or life-
style, an environmental exposure or an inborn or inherited characteristic, which,
on the basis of epidemiological evidence, is known to be associated with a health
related condition of a persons live (151). Established risk factors for periodontitis
are smoking and diabetes. Individuals who smoke have a 2.7-7 times higher risk
of developing periodontitis, whereas individuals with diabetes have odds ratios of
2-4.2 to develop periodontitis (38, 152). Scientifically less supported risk factors
are stress (202) and malnutrition (41, 142).
12
Inherited risk factors are syndromes with neutrophil dysfunction like Chediak-
Higashi, Papillon-Lefvre or Down syndrome (39). Less dramatic genetic risk
factors are gene polymorphisms that affect the genetic constitution of a patients
immune system. Polymorphisms in genes coding for IgG, FcRCII, PGE2 and IL-1
are associated with different forms and severity of periodontitis (58, 75)
Risk factors can influence the level of the host inflammatory response to the
bacterial challenge or interfere in the connective tissue metabolism of the host,
and thereby modify the severity and pace of periodontal disease progression.
Smoking for example may have an effect on gingival vascularization and on fibro-
blasts, but also on neutrophil and leukocyte function (127).
Flow of
neutrophils
from the
sulcus *
Figure 1.2. Clinical and schematic representation of a healthy periodontium. Note the absence of
bleeding upon probing and pocket depth and the pale pink stippled appearance of the gingiva. Even
in a healthy situation, there is a continuous flow of neutrophils from the sulcus*. Reprinted with
permission from (117).
Periodontal pathogenesis model.

As shown before, the accumulation of bacterial plaque on the tooth surface
induces an immune response that results in clinical symptoms of inflammation.
The immune response aims to clear the bacteria present on the tooth via the acute
cellular immune response which, during the course of inflammation, shifts to a
predominant humoral immune response. As a side effect however, the inflamma-
tory response also modulates the turnover of the periodontal tissues, shifting the
balance between tissue formation and breakdown towards an increase in tissue
destruction. The destruction of tissue results in the formation of periodontal pock-
13
CHAPTER 1
ets and the loss of bone, which are clinically assessed by pocket depth and tooth
mobility measurements and oral radiographs. The severity of the symptoms may
vary between subjects and is modified by several risk factors. Periodontitis should
therefore be considered as a multi-factorial disease which can be graphically rep-
resented in a non-linear model (Figure 1.3.) (123).
Modelling the pathogenesis of periodontitis provides the opportunity to ap-
preciate the complexity of the disease, to exemplify how the different factors
interact and to phrase relevant research questions. The present thesis focuses on
the bacterial mass involved in periodontitis.
Risk factors
PGE2, IgG, IL-1 Smoking
antibody
Cytokines
prostanoids
PMNs
Connective Clinical signs

Host
of disease
Microbial antigens immuno Tissue and
challenge inflammatory bone initiation
respons metabolism and
progression
LPS
MMP
virulence
factors
Figure 1.3. Periodontal pathogenesis model. Polymorphnuclear leukocyte (PMN), prostaglandin E2

(PGE2), interleukin (IL), matrix metalloproteinase (MMP). Adapted from Page and Kornman (123).
Bacterial mass on the teeth

The oral cavity is a diverse ecosystem, both harsh and attractive to bacteria.
Teeth, palate, tongue and epithelium provide different surfaces for bacteria to
adhere to and exploit the optimal settings for growth in the oral cavity, like humid-
ity, temperature and a regular supply of nutrients (166). The host however aims for
the elimination of the bacteria. The continuous flow of saliva and crevicular fluid,
shedding of epithelium, chewing and tongue movements and antibacterials like
14
agglutinins and immunoglobulins in saliva aim to remove and prevent bacterial accu-
mulations. To overcome clearance by the host, bacteria have developed adherence
mechanisms to remain in the oral cavity and colonize the oral surfaces. Bacteria
adhere in a non-specific way through physical interactions like charge, hydrophobicity
and ionic interactions (16) or by specific adhesion mechanisms. In short, pristine
teeth are readily deposited with salivary proteins and substances that form a pellicle.
The molecules in the pellicle serve as receptors for adhesins on the bacterial cell
surface (157). Through this specific adhesion mechanism, bacteria become attached
to the tooth surface. Listgarten and colleagues (93) revealed with light and electron
microscopy that initial plaque on epoxyresin crowns consisted of pallisading columns
of cocci after one day (Figure 1.4.). Occasionally, isolated branching filaments were
observed. After one week, a large number of filaments were observable on the surface
of the predominantly coccoid plaque. It seemed that the filamentous bacteria invade
the coccoid plaque, thereby replacing it. After three weeks, the predominantly
filamentous plaques did not show any sign of residual coccoid micro colonies. In
addition, the filamentous plaques were frequently covered with a layer of so-called
corncobs, aggregates with a central filamentous microorganism surrounded by coccoid
cells. After two months the plaque that has extended subgingivally, contained a fuzzy
layer of spirochetes and bacterial aggregates resembling test-tube brushes (Figure
1.5.). During plaque development, voids and channels lined with living bacteria are
formed that might serve nutrients to penetrate to the inner parts of the plaque (10,
112, 207). The observations with light and electron microscopy could only identify
the cells based on their morphology and cell wall composition, but not to the species
level. Culture experiments of supragingival plaque scrapings revealed that the most
abundant initial bacterial species that adhere to the tooth surface are Streptococcus
sp. Other species frequently found in initial plaque are Actinomyces sp., Gemella sp.,
Granulicatella sp., Neisseria sp. and Veillonella sp. (35,36, 81,126,146).
The development of subgingival plaque is less well characterized. From light and
electron microscopy observations, it was noted that subgingival plaque resembled
largely mature supragingival plaque. The characteristic difference in subgingival plaque
was the presence of a superficial layer that, closest to the epithelium, was without a
distinct organization. This layer included mainly spirochetes and flagellated concave
bacteria. Within this layer, bacterial structures that resembled test-tube brushes were
observed (94). Also in the composition of the microbial population, subgingival plaque
15
CHAPTER 1
resembles its mature supragingival counterpart (173). In time, the proportion of gram
positive species decreases with a concomitant increase in gram-negative filaments,
motile rods and spirochetes from the Bacteroidetes, Fusobacteria and Spirocheates
phyla. The most striking difference is that the levels of Treponema denticola,
Porphyromonas gingivalis and Tannerella forsythia are elevated and positively associated
with disease status. In clinical studies, the focus is on the putatively associated
pathogens without taking into consideration the presence of the entire population.
From this type of studies, it became clear that P. gingivalis and Aggregatibacter
actinomycetemcomitans are positively associated with periodontal disease and adverse
clinical treatment outcomes (186, 203). The role of these pathogens as members of
a microbial community is largely unknown. Identifying their role in plaque formation
and function in the maintenance of periodontal diseases starts with their localization
within the plaque.
Figure 1.4. One day old supragingival plaque consisting of mainly coccoid cells growing in columns
perpendicular from the crown surface. Reprinted with permission from (93).
16
The localization of most bacteria in mature supragingival plaque or subgingival plaque

is largely unknown, with only preliminary attempts to localize P. gingivalis,
Campylobacter rectus, Actinomyces viscosus, Fusobacterium nucleatum, Eikenella
corrodens and T. denticola in subgingival plaque with immunohistochemical techniques
(74,114,115). A. viscosus and E. corrodens were located predominantly in the tooth-
attached plaque, whereas P. gingivalis and C. rectus were scattered in clumps in the
epithelium associated plaque area. T. denticola and F. nucleatum were predominantly
found in layers on top of the plaque. It is commonly appreciated that the accumulation
of total bacterial mass and maturation of the plaque are the result of growth of the
already adhered bacteria and the adhesion of planktonic cells to the initial colonizers
(co-adhesion).
Figure 1.5. Electron microscopic view of

mature supragingival plaque showing a
predominantly filamentous bacterial
population and the presence of corncobs
(black arrow). Reprinted with permission
from (94).
17
CHAPTER 1
Bacterial growth
Supragingival bacteria rely for their metabolism on nutrients in saliva, which
contains a mixture of amino acids, peptides, proteins and glycoproteins from the
salivary glands and other proteins and glycoproteins from gingival crevicular fluids
(62). In addition, bacteria can metabolize the fast array of dietary nutrients pro-
vided during feeding of the host, especially the fermentable carbohydrates (22).
Sugars are the main source of energy for most oral bacteria, including the
supragingival initial colonizers. These sugars are available as monosaccharides in
saliva, or as polysaccharides encapsulating proteins (glycoproteins). The polysac-
charide side chain can be glycosidated from the protein core by bacterial glycosi-
dases and become available for sugar metabolism. Initial colonizers like
streptococci and actinomyces are able to use these sugars for energy metabolism
and secrete formate, acetate and primarily lactate as the products of metabolism.
These metabolic end products result in a lowering of the pH, which selects for
acid-tolerant species like Streptococcus sp., Actinomyces sp. and Lactobacillus
sp. (78).
Also essential for bacterial growth are nitrogen compounds. The proteins in
the saliva may provide a source for nitrogen, ammonium and amino acids that
bacteria are unable to synthesize themselves. Streptococci for example are equipped
with proteinases and peptidases to provide for these essential nitrogen and amino
acid compounds (26,148). Subgingival bacteria on the other hand, also depend on
proteins as a source for their energy and carbon metabolism. Glycoprotein degra-
dation starts with the cleavage of the sugar polymers from the protein backbone
by proteinases and glycosidases, as shown for the degradation of mucin (199).
Well studied subgingival proteinases are the so-called gingipains of P. gingivalis
(118). These proteases are able to degrade collagen type I and IV, but also de-
grade complement factors C3 and C5 and immunoglobulins IgG, IgA and IgM.
Thereby they decrease the antibacterial activity of PMNs (42,86). Extracellular
produced peptides and amino acids are transferred intracellularly and metabolized
via different pathways. In general, amino acids are decarboxylized or deaminated
with the production of ammonia, hydrogensulfide, carbondioxide, short chain fatty
acids or methyl mercaptan as possible end products of metabolism.
18
Co-adhesion
Co-adhesion of bacteria occurs between proteins (adhesins) on one cell that
recognize a carbohydrate moiety (receptor) on another cell. Adhesins are proteins
present at the cell surface as lipoproteins or as fimbriae-attached proteins (198). Co-
adhesion can occur within and between species, or between bacterial cells and proteins
in the pellet. Adhesins and receptor combinations are best studied in oral streptococci,
but also delineated in Actinomyces, Prevotella sp., Porphyromonas sp., Fusobacteria,
Treponema sp. and other oral bacteria. Pairwise tests of co-adhesion between species
showed that most adhesin-receptor couples are specific. Based on multiple laboratory
co-aggregation experiments, a model of bacterial colonization was proposed by
Kolenbrander and London (79). Initial colonizers recognized salivary pellicle proteins
and co-aggregated with other initial colonizers. F. nucleatum was proposed as a bridging
organism for secondary colonizers like Prevotella sp. and Porphyromonas sp. to become
adhered to the plaque. The cell surface proteins and fimbriae involved in co-adhesion
have also been implicated in human cell invasion and can act as pro inflammatory
mediators (100).
P. gingivalis fimbriae for example are composed of fibrillin monomer subunits
and are initially needed for adherence to epithelial cells, streptococci, actinomyces
and salivary proteins, but also serve as chemotactic compounds and induce the pro-
duction of cytokines (86).
Summarizing, during maturation of the subgingival plaque bacteria grow with the
concomitant production of many metabolic end products such as lactic, butyric and
propionic acids, as well as H2S and nitrogen compounds. These end products of
metabolism have a pro-inflammatory effect on the host tissue. The bacterial proteins
involved in the degradation of (glyco) proteins also degrade periodontal tissues and
components of the host immune system, thereby interfering with the immune response.
Finally, cell wall products like lipopolysaccharides (LPS), fimbriae, peptidoglycans and
lipotechnoic acids together with bacterial toxins form a vast array of inflammatory
mediators that initiate the host inflammatory response (100).
19
CHAPTER 1
Immune response
Bacterial mediators of inflammation encounter the epithelial cell lining as a first
line of defence. This cell lining is composed of keratinocytes. Keratinocytes are
activated by these inflammatory mediators and start secreting pro-inflammatory
cytokines like IL-1/, prostaglandin E2 (PGE2) and matrix metalloproteinases (MMPs)
(180). In response to the inflammatory burden, leukocytes are recruited from the
peripheral blood vessels. Some of these recruits pass the epithelial barrier into the
gingival sulcus and differentiate into PMNs. Thereby, PMNs are the first cells of the
immune system in direct contact with the bacterial plaque. Leukocytes that differentiate
into macrophages remain in the connective tissue. Macrophages become activated
by, for example, bacterial LPS and produce a range of inflammatory and immunological
mediators like IL-1/, IL-6, IL-12, TNF-, PGE2, MMPs and IFN- (120,121). In addition
to the cellular immune response and provoked by activated macrophages, the hu-
moral immune response starts soon after inflammation. This results in increasing
numbers of T and B-lymphocytes producing species-specific antibodies and activation
of the complement system to upsonate bacterial antigens (14, 34, 40).
The immune system is designed to eliminate pathogens that could harm the
host. Clearance of bacteria is sought by specialized cells like PMNs, macrophages
and monocytes that phagocytise and kill bacteria. The process is orchestrated by
inflammatory messengers like cytokines and chemokines. These messengers how-
ever, also deliver a message to other cells present in the gingival epithelium not
involved in immune responses, like osteoblasts, osteoclasts and fibroblasts that
play a role in tissue metabolism.
Periodontal connective tissue and bone metabolism.

Fibroblasts play a major role in the remodelling of the extra cellular matrix
and connective tissue that consists mainly of collagen. In the healthy gingiva,
there is a continuous remodelling of the extra-cellular matrix by collagen formation
and degradation. Collagen degradation is performed by collagenases like matrix
metalloproteins. In the inflamed tissue is an increased production of MMPs by
epithelial cells and macrophages. Moreover, IL-1 promotes the production of MMP
by fibroblasts, whereas PGE2 inhabits its production of collagen (141).
Osteoblasts and osteoclasts intimately regulate the remodelling of alveolar
bone. Osteoblasts mainly produce bone matrix and calcified tissue. Osteoclasts
on the other hand resorb the organic and mineral phases of the bone. IL-1, PGE2 and
20
TNF- have antagonistic effects on osteoblast and osteoclast activity. Osteoblasts

are negatively controlled, whereas osteoclast activity is stimulated by IL-1, PGE2 and
TNF- (159). The cytokines that regulate the immune reaction induce a shift in the
balanced turnover of collagen and bone towards the degradation of periodontal tissue.
With ongoing inflammation there will be a loss of root attached connective tissue and
collagen. This results in the apical down growth of the junctional epithelium and the
formation of a subgingival pocket. This pocket provides a new surface for bacterial
colonization and the formation of subgingival plaque. Once established, subgingival
plaque cannot be removed by patients oral hygiene measures like tooth brushing.
Without professional removal of the subgingival plaque the inflammation continues.
The continuing degradation of collagen and the apical migration of the junctional
epithelium are preceded by resorption of alveolar bone, which can be evaluated on
oral radiographs. This is clinically observed by an increase in pocket depth and mobility
of the teeth and is called periodontitis (Figure 1.6.). Periodontitis affects up to 35% of
the adult population (3, 19, 60).
Plaque
Flow of neutrophils
Gingival infiltrate
Junctional
epithelium
Bone resorption
Figure 1.6. Clinical and schematic representation of periodontitis. General characteristics are bleeding,
increased probing depth, bone resorption and a swollen gingiva. The junctional epithelium migrated
apically from the cemento-enamel junction (dashed line). A gingival infiltrate composed of leukocytes,
monocytes, macrophages and plasmacells has established. Reprinted with permission from (117).
21
CHAPTER 1
Aim of the thesis

As outlined in the periodontitis pathogenesis model, periodontitis is the clinical
result of a cascade of interactions that starts with the formation of subgingival plaque.
Important bacterial processes in subgingival plaque formation are adhesion and growth,
which are reflected in plaque architecture. The same processes are however also
responsible for initiating and maintaining inflammation. Studying these processes is
hampered by the vast amount of different and mostly hard to culture bacteria in the
oral cavity. With culture techniques 509 different bacterial species from sub and
supragingival plaque were identified (105). With the introduction of molecular techniques
like cloning and sequencing the oral bacterial diversity was extended to more than
700 (1, 63, 84, 89, 130). The identified bacterial species are members of 9 different
classes; Firmicutes, Actinobacteria, Bacteroidetes, Fusobacteria, Spirocheates,
Deferribacteres and 2 classes with uncultiviable members; OP11 and TM7. In addition,
Candida sp. have been isolated from periodontal pockets (140) and endodontic infections
(164) of which C. albicans is the most abundant. This large diversity of species colonizes
the subgingival niches by co-adhesion and bacterial growth in a certain pattern result-
ing in a structured microbial community with a largely unknown architecture. To un-
derstand the microbial role in initiating and maintain the inflammation of the periodon-
tal tissues and to implement the bacterial component in the periodontal pathogenesis
model requires detailed information about subgingival plaque formation and its
architecture.
Hence, the aim of the present thesis is four-fold:

1. To develop molecular tools to study oral microbial communities
associated with periodontitis
2. To monitor the formation of subgingival plaque after mechanical
scaling and root planing with the developed molecular tools
3. To localize oral micro-organisms in supra and subgingival plaque
4. To apply this knowledge to provide a rationale for full-mouth or
quadrant wise scaling and rootplaning in clinical periodontology
The introduction of Denaturing gradient gel electrophoresis (DGGE) in micro-

bial ecology by Muyzer (108) provided an useful tool to study complex microbial
populations. DGGE is based on differences in the GC-composition of 16S rRNA
genes or their PCR products. Because of these differences, the fragments of the
22
different species display different migration patterns after electrophoresis on a gel

with a denaturing gradient. Thereby a banding pattern is produced in which each band
represents a single species that can be identified by sequencing. At the start of this
project, DGGE has not been applied to oral microbial communities however. The
introduction of DGGE in oral microbiology is described in the second and third Chapter.
The formation of subgingival plaque after treatment is studied by DGGE analysis of
PCR fragments obtained with universal and group-specific bacterial primers (Chapter
4). Subgingival plaque samples were collected at seven different timepoints after
treatment in a clinical trial comparing two treatment options for initial periodontal
treatment. The distribution of the predominant oral bacteria and the architecture of
subgingival plaque that is the result of plaque formation is visualized in Chapter 5. The
clinical trial of Chapter 4 evaluates whether a single session of whole mouth scaling
and root planing is superior to conventional multiple session quadrant-wise scaling
and root planing. The hypothesis is that that recolonization of already treated pockets
from not yet treated pockets is prevented by a single session of whole mouth scaling
and root planing. Chapter 6 describes the clinical and microbiological results of the
randomized clinical trial to test the recolonization hypothesis. Chapter 7 evaluates
and discuss on the clinical and microbiological results of the clinical trial guided by the
fundamental microbiological knowledge on oral biofilm formation and architecture from
Chapter 4 and 5.
23
2
Denaturing gradient gel
electrophoresis analysis to study
bacterial community structure in
pockets of
periodontitis patients
Zijnge V, Harmsen HJM, van der Rest ME, Degener

JE, Welling GW
Oral Microbiology and Immunology (2003) 18: 59-65

DGGE ANALYSIS OF PERIODONTITIS-RELATED MICROBIOTA
SUMMARY
Bacteria are involved in the onset and progression of periodontitis. A promising molecular
technique, denaturing gradient gel electrophoresis (DGGE), to study microbial population
dynamics in the subgingival pocket is presented. Twentythree samples were taken
from the subgingival pockets of nine patients and six healthy family members. From
four periodontitis patients, 12 samples were evaluated before, 1 day after and 3 months
after treatment. Part of the 16S rRNA gene of all bacteria was amplified by PCR and
separated by DGGE, creating banding patterns representative of the community
structure. Shifts in composition and diversity of the microbial population could be
determined semiquantitatively, and this showed that treatment resulted in a decrease
in the diversity of the population. After 3 months a microbial population 3347%
different from the population before treatment had re-established. Intense bands
representing Exiguobacterium aurantiacum were present in 13 out of 25 samples,
indicating that this species may play a role in periodontal disease.
27
CHAPTER 2
INTRODUCTION
Periodontal diseases refer to inflammatory processes leading to destruction of

the supporting tissues of the teeth and are the result of a mixed microbial infection
(55). According to the specific plaque hypothesis, the inflammatory response in
subgingival tissues is caused by a limited number of bacterial species present in
subgingival plaque (95). Several species are putative periodontopathogens based on
frequency of isolation in lesion sites. Among these are Actinobacillus
actinomycetemcomitans, Porphyromonas gingivalis, Prevotella intermedia, Bacteroi-
des forsythus, Treponema denticola, Fusobacterium nucleatum, Peptostreptococcus
micros, Campylobacter rectus, Eikenella corrodens and Selenomonas sputigena (171).
Efforts have been made to determine the prevalence of these species in periodontal
lesions (9,23,46,47,48,144,145). However, no single bacterial species could be
identified that is uniquely involved in periodontitis. Using 40 species-specific DNA-
DNA hybridization probes to detect oral bacteria, it was shown that subgingival plaque
contains bacterial species in different complexes (171). Socransky et al. (171) observed
five major complexes using cluster analysis. The complex consisting of B. forsythus,
P. gingivalis and T. denticola showed the strongest relationship with clinical features.
Nevertheless, the probes used comprised a limited part of the subgingival population
and only partially took into account the diversity of the subgingival plaque, as over
500 species can be recovered from the oral cavity (84, 130). Moreover, molecular
techniques, for example cloning and sequencing, revealed the presence of yet
uncultivable or difficult to cultivate bacterial species such as Eubacterium species,
Coriobacteriaceae and treponemes in subgingival plaque (34,37,150,176). However,
information about the contribution of these species to the initiation and progression of
periodontitis is limited (37).
Here we present one of the first applications of denaturing gradient gel electro-
phoresis (DGGE) in periodontal research to study the mixed nature of periodontal
disease. This technique takes into account the presence of unidentified and hard to
cultivate species present in subgingival plaque. DGGE was introduced in microbial
ecology a decade ago by Muyzer et al. (108) and has proved to be useful in detecting
and identifying mixed microbial infections from the ocular environment (158).
DGGE facilitates profiling of mixed microbial populations by the separation of amplified

16S rRNA gene fragments of the same length by differences in GC content (110).
28
Separation of 16S rRNA gene fragments on a polyacrylamide gel containing a linearly

increasing gradient of denaturant (urea and formamide) results in a pattern of bands
that corresponds to a number of predominant members of the microbial community
(109). Further population information can be obtained by determining the sequence of
eluted DNA from bands excised from the gel (102).
In the present study, the DGGE technique was used for the analysis of the
microbial population obtained from subgingival plaque samples from patients with
advanced forms of inflammatory periodontal disease. A number of those study sub-
jects were sampled at different times in order to identify the predominant species
before and after treatment, and to study shifts in the microbial population.
MATERIALS AND METHODS
Study subjects
A total of 15 subjects were enrolled in the study. The minimum number of teeth
the patients possessed was 20. Nine out of the 15 subjects were selected from adult
patients with previously untreated advanced periodontitis referred by general
practitioners to the Department of Dentistry, University of Groningen, the Netherlands
for periodontal therapy. The remaining six subjects were periodontally healthy family
members (siblings or children) or spouses of these nine patients. Individuals with any
of the following conditions were excluded from the study: use of systemic antibiotics
in the previous 6 months; requirement for antibiotic premedication; allergy to
metronidazole; blood disorders; liver and kidney disorders; central nervous system
disorders; intake of any medications; pregnancy or lactation. All periodontitis patients
received oral hygiene instruction and full mouth supra-and subgingival scaling for 4
hours. In patients not responding to scaling and root planing, systemic metronidazole
was administered, 250 mg 3 times a day for 1 week. Where necessary, periodontal
surgery was performed. Following active treatment, the patients were scheduled to
receive maintenance therapy every 3 months.
Clinical and radiographic assessments

Probing pocket depth and probing attachment level were measured at six sites
per tooth using a periodontal probe calibrated in millimeters. Plaque index (162), gingival
index (96) and bleeding on probing were also assessed at six sites per tooth. The X-
29
CHAPTER 2
ray status of each patient was recorded. The diagnosis advanced periodontitis was
made if (a) the patients showed periodontal bone loss around at least two single-
rooted teeth per quadrant reaching the middle third of the roots, and (b) these two
teeth showed sites with pocket depths of 6 mm and loss of attachment of 7 mm.
Sample processing
Subgingival plaque samples were taken from all 15 subjects including healthy
relatives. In the nine patients, the deepest site of each quadrant was identified (156).
Four sites showed probing pocket depths of 6 mm and loss of probing attachment of
7 mm. Prior to sampling, supragingival plaque was removed using hand instruments
and a sterile cotton roll was inserted to prevent saliva from disturbing sampling.
Subgingival plaque samples were taken at the selected sites by inserting sterile
endodontic absorbing points (xx fine; Roeko, Ulm, Germany) to the bottom of the
periodontal pocket for 20 s. In the six family members, subgingival plaque samples
were taken at the mesial site of each first molar. The four paper points of each
subject were removed, stored on ice and transported to the laboratory. In order to
obtain some insight into the potential usefulness of the molecular monitoring method
applied, four out of the nine periodontitis patients were sampled at three different
times: at baseline, 1 day after and 3 months after treatment. Subgingival plaque
samples were again taken at the four preselected sites and pooled. Hence, 23 bacterial
samples (17 from patients and six from family members) were available for further
processing.
DNA extraction
DNA was extracted from the paper points using a modification of the phenol/
chloroform extraction method described by Stephen et al. (179). Briefly, a mixture of
glass beads, paper points and 500 l sterile milli-Q water was vortexed twice for 30
s and incubated overnight at 4C. The paper points were removed and 200 l phenol
was added, after which the samples were mechanically disrupted in a Mini-
BeadBeater8TM (BioSpec Products Inc., Bartlesville, OK) with zirconium beads (0.11
mm) twice for 30 s. After disruption, 200 l chloroform/iso-amylalcohol (24: 1 volume/
volume) was added and samples were centrifuged for 5 min at 14,000 g. A second
phenol/chloroform extraction was performed and, after collecting the supernatant,
DNA was precipitated with 500 l isopropanol after standing at -20C for 2 h. After
centrifugation for 15 min at 14,000 g, the supernatant was discarded and the pellet
30
washed in 100 ml 70% alcohol. After further centrifugation for 15 min at 14, 000 g,
the supernatant was removed. The pellet was dissolved in 100 l sterile milli-Q water
and stored at -20C.
PCR amplification
PCR was performed with a Tgradient thermocycler (Whatman Biometra,
Gttingen, Germany). For amplification, the following general bacterial primers were
used (116): F968-GC (5 CGC CCG GGG CGC GCC CCG GGC GGG GCG GGG GCA
CGG GGG GAA CGC GAA GAA CCT TAC 3), containing a GC clamp which makes
it suitable for DGGE, and R1401 (5 CGG TGT GTA CAA GAC CC 3). The mixture
contained 5.0 l reaction buffer (100 mM Tris-HCl, pH 8.3, 500 mM KCl, and 15 mM
MgCl2), 200 M of each dNTP, 35.5 l of water, 200 nmol of each primer, 2.5U
Hotstart Taq polymerase (TaKaRa SHUZO Ltd, Otsu, Japan) and 1.0 l of template
DNA. The temperature profile included an additional denaturing step of 10 min at
96C, followed by 34 cycles of a denaturing step at 96C for 30 s, a primer annealing
step at 56C for 1 min, an ex-tension step at 72C for 1 min and a final extension
step of 72C for 5 min. PCR products were analyzed by electrophoresis on a 2.0%
agarose gel containing 0.5 g/ml ethidium bromide.
DGGE
DGGE of PCR products generated with the F968GC/R1401 primer set was
performed as described by Muyzer et al. (108), with the use of a PhorU system
(Ingeny, Goes, the Netherlands). PCR products were loaded on an 8% (w/v) polyacry-
lamide gel in 0.5xTAE (1xTAE is 0.04 M Tris base, 0.02 M acetic acid and 1.0 mM
EDTA, pH7.5). The denaturing gradient consisted of 30 to 70% denaturant (100%
denaturant equals 7 M Urea and 40% formamide). Gels were poured using a gradient
mixer. A 10 ml stacking gel without denaturant was added on top. Electrophoresis
was performed for 16 h at 120 V and 60C. Gels were stained with silver nitrate
(158).
Analysis of the DGGE profiles

DGGE profiles were analyzed as described by Gillan et al. (49). The bands per
lane are counted as a measure of the microbial diversity, and a coefficient of similarity
(Cs) is calculated to compare the composition of two populations by the following
formula: Cs=2j/(a+b)x100%, in which j is the number of common DGGE bands
31
CHAPTER 2
between two lanes, a is the number of bands in lane a, and b is the number of bands
in lane b. A Cs value of 100% corresponds to two identical DGGE profiles.
Excision and sequence analysis of products

Bands of basic interest (based on intensity, dynamics in sequential samples, and
similar migration to reference pathogens) were excised from the gel and put into cups
containing 100 l sterile milli-Q water and glass beads. After vortexing twice for 30
s, the samples were incubated overnight at 4C. The cups were vortexed to enrich
and purify the bands. A volume of 10 l was used as a template in a universal DGGE-
PCR reaction with the F986GC and R1401 primer set. Products were analyzed on
DGGE gels, and bands at the same position on the gel were excised and processed
again. After another round of PCR, products were checked on an agarose gel and
purified using a multiscreen FB-96 plate (Millipore B.V., Etten-Leur, the Netherlands).
Dideoxy-DNA sequence reactions were performed using a Dynamic ET-Terminator kit
(Amersham Biosciences, Little Chalfort, UK). A MegaBACE 1000 (Amersham
Biosciences) was used for sequence determination.
Phylogenetic analysis
All sequences were aligned against a representative selection of prokaryote
16S rRNA sequences extracted from the Ribosomal Database Project (RDP)
database (102). Distance matrix analyses were performed using a Jukes-Cantor
correction (149) and tree construction was carried out by neighbor-joining using the
ARB software package (98). The phylogenetic associations of all representative se-
quences were determined from 100 bootstrapped replicates using a maximum-likelihood
algorithm. Sequences with 99% identity were considered as a single phylotype.
RESULTS
DGGE profiles
A total of 23 samples from nine patients and six relatives were analyzed using
DGGE banding patterns. DGGE profiles from the 15 subjects contained intense and
faint bands. Although profiles generally differed greatly amongst subjects, several
intense bands were observed at the same position in almost every profile. Another
interesting finding was the remarkable similarity in banding pattern and number of
bands between one patient and their spouse. The similarity was less pronounced
32
between another patient and his brother. Nevertheless, after the patient had been
treated, the profile of his brother had also changed. Patients 1, 2, 3 (Figure 2.1.) and
4 (profile not shown) were analyzed in more detail. DGGE fingerprints of the microbial
population at baseline (BL), 1 day after treatment (P00) and 3 months after treatment
(P03) showed that profiles from the microbial population were highly diverse and
varied in time and between individuals.
Figure 2.1. shows two marker lanes containing PCR products of A. actino-
mycetemcomitans (Aa), P. gingivalis (Pg) and P. intermedia (Pi) and bands at corre-
sponding positions in the gel, for example bands 9, 10 and 11. Bands
migrating at the same position as bands 4, 7 and 8 were present in each lane except
in lane P03 of patient 1 and lane BL of patient 2.
Treatment of the patients resulted in a decrease in the number of bands on P00
(Table 2.1.). The decrease was most pronounced for patients 1 and 2, from 23 to 9
bands and from 39 to 8 bands, respectively. After 3months, the number of bands
increased, for example to 47 for patient 2 and to 24 for patient 4. These changes in
Figure 2.1. PCR-DGGE profiles representing the bacterial diversity

in patients 1, 2 and 3 (P1, P2 and P3) generated from samples
taken before treatment (BL), 1 day after treatment (P00) and 3
months after treatment (P03). P1 did not receive antibiotic
treatment. P2 and P3 were treated with metronidazole. Marker
lanes (M) contain PCR products of A. actinomycetemcomitans
(Aa), P. gingivalis (Pg) and P. intermedia (Pi). The numbered
bands are described in Table 2.3.
33
CHAPTER 2
the number of bands suggest that the microbial population was suppressed by
treatment and that after 3 months re-colonization of the site occurred.
DGGE profiles were also compared using the similarity coefficient (Cs), which
takes into account the total number of bands per lane and the migration position of
the bands, i.e. the number of bands two lanes have in common. Cs values therefore
provide information about the composition of DGGE profiles and shifts in the microbial
population. As shown in Table 2.2., DGGE profiles from all four patients changed at
P00 compared with BL. The change in banding patterns was most striking for patients
1 and 2, as the Cs values were low: 44 and 18, respectively. This observation was
consistent with the greatest reduction in number of bands for these two patients.
After 3 months, DGGE profiles showed that, although there was an increase in the
number of bands, a partially different microflora had colonized the subgingival pocket,
as the similarities between BL and P03 were less than 100% in all four patients.
Although the patterns were different, some bands disappeared after treatment and
reappeared after 3 months.
To identify species associated with the observed changes in the microbial popu-
lation, the most intense bands from the profiles of patient 1 were excised and
sequenced. A phylogenetic tree was constructed to identify the closest relative of
each sequence (Figure 2.2.). The predominant bands of the population before treat-
ment comprised bands 1-4. Analysis of the sequence of the excised DNA of band 1
showed that its closest relative (96% sequence similarity; Table 2.3.) was Filifactor
alocis, formerly known as Fusobacterium alocis, which has previously been isolated
from gingival sulci of patients with gingivitis or periodontitis (66). Sequence 2 was
related (86% sequence similarity) to an uncultured Eubacterium sp. isolate from den-
toalveolar abscesses (193). Sequences of bands 3 and 4 were both related (98%
sequence similarity) to Exiguobacterium aurantiacum, a motile, facultatively anaero-
bic coryneform bacterium with fermentative carbohydrate metabolism. This species
has occasionally been isolated from clinical sources such as wounds and cerebrospinal
fluid (37) but never from periodontal lesions. These relatively intense bands were also
observed at corresponding positions after DGGE analysis of samples from all patients
and three relatives. Therefore, bands 7, 8 (Figure 2.1.) and 12 (not shown) were
excised and their sequences showed them to be related to E. aurantiacum (Figure
2.2.). The sequences of bands 3, 4, 7, 8 and 12 showed more than 99% sequence
identity. Sequences 5 and 6 were contaminated with other sequences, but they were
probably related to C. rectus, which is a suspected periodontopathogen (170). Despite
34
the poor quality of sequences 5 and 6, identification of the bands as C. rectus was
possible as the first 120 bases from the highly variable V6 region of the 16S rDNA
gene were used for analysis. Because they appeared at the same position in the gel
as A. actinomycetemcomitans or P. intermedia in the marker lane (M), bands 9, 10,
11 and 13 were excised and identified. The sequences of bands 10 and 11 positively
confirmed this possibility by showing more than 99% sequence similarity with A.
actinomycetemcomitans. However, the sequences of the DNA in bands 9 and 13
were identified as closely related to Actinomyces israelii and Desulfovibrio fairfieldensis,
respectively.
Table 2.1. Total number of bands in DGGE Table 2.2. Coefficient of similarity (Cs)
analysis. BL, baseline; P00, 1 day after amongst lanes BL, P00 and P03 in DGGE
treatment; P03, 3 months after treatment. analysis.
Sample Total number of bands Coefficient of similarity (Cs) (%)
Patient Patient
1 2 3 4 1 2 3 4
BL 23 39 35 28 BL-P00 44 18 47 51
P00 09 08 27 17 BL-P03 33 39 47 41
P03 37 47 39 24 P00-P03 15 16 56 52
35
CHAPTER 2
B4 oral sequence
B3 oral sequence AJ428516
B7 oral sequence
B8 oral sequence
B12 oral sequence
Exiguobacterium aurantiacum X70316
Exiguobacterium sp.
Bacillus subtilis
100 Streptococcus parasanguinis AF003933
Streptococcus mitis AF003929
Streptococcus oralis AF003932
Streptococcus pneumoniae AF003930
Peptostreptococcus sp. X90471
93 Eubacterium uncultured Eubacterium PUS9170
B2 oral sequence
100 Clostridium homopropionicum X76744
Clostridium novyi X68188
Clostridium piliforme S72349
99 Filifactor villosus X73452
99 Filifactor alocis AJ006962
Eubacterium sulci AJ006963
Actinomyces naeslundii X81062
100 Actinomyces sp. X81063
90 Actinomyces denticolens X80412
100 Actinomyces israelii X82450
Actinobacillus actinomycetemcomitans X90833
Haemophilus actinomycetemcomitans M75036
100 B11 oral sequence
Haemophilus paraphrophilus M75042
97 Actinobacillus pleuropneumoniae AF033060
Escherichia coli
94 Desulfovibrio fairfieldensis U42221
Desulfovibrio gracilis U53464
Fusobacterium nucleatum subsp. nucleatum M58683
100 99 Porphyromonas gingivalis L16492
100 Prevotella intermedia L16468
100 Campylobacter sputorum subsp bubulus L04319
Campylobacter gracilis L04320
Campylobacter showae L06974
Campylobacter rectus L06973
B6 oral sequence
0.10
Figure 2.2. Neighbor-joining tree based on partial 16S rDNA sequences from the clones and
sequences derived from the RDP. This tree was constructed using 379 homologous sequence
positions(10031381 Escherichia coli numbering). The numbers at the nodes of the tree indi-
cate bootstrap values for each node out of 100 bootstrap resamplings (values below 90 are not
shown). B1 to B13 oral sequences refer to bands113 in Table 2.3. and Figure 2.1. The scale
bar corresponds to 0.10 substitutions per nucleotide position.
36
Nucleotide sequence accession numbers

The sequences of the oral rDNA bands obtained from patients 1 and 3 (four
sequences, 379385bp, indicated by an asterisk in Table 2.3.) have been deposited
in the GenBank database under accession numbers AJ428516, AJ428517, AJ428518
and AJ428519.
Table 2.3. Closest relative as determined by comparative sequence analysis, percentage

similarity with this relative, length of the sequence, and accession number of each band
identified in Figure 2.1. Bands are indicated in Figure 2.2. as B1-B13 oral sequence.
% Length of Sequence
Closest relative Bands
similarity sequence accession number
Filifactor alocis 1* 096 385 AJ428517
Uncultured Eubacterium pus 9.170 2 086 -
Exiguobacterium aurantiacum 3*,4,7,8,12 098 379 AJ428516
Campylobacter rectus 5 046 -
Campylobacter rectus 6 055 -
Actinomyces israelii 9* 100 381 AJ428518
Actinobacillus actinomycetemcomitans 10*,11 100 379 AJ428519
Desulfovibrio fairfieldensis 13 090 -
*These bands have been submitted to GenBank.
37
CHAPTER 2
DISCUSSION
Elucidation of whether periodontal disease is the result of plaque overgrowth or

is a specific, albeit chronic infection is hindered by the lack of experiments in which
the transition from gingivitis to periodontitis is documented. The trigger for this
conversion is unknown. The formation, colonization and progression of the pocket
represent an evolving process in which the host immune system, bacteria and their
virulence factors play a delicate game of give and take. As a result of changes in the
environment, for example from aerobic to anaerobic conditions, the microbial population
will shift from mainly Actinomyces and Streptococcus species towards an anaerobic
gramnegative microflora (68, 83). Treatment is aimed at suppressing or eliminating
the characteristic subgingival microflora. This study has shown that treatment does
not result in the complete elimination of bacteria, although DGGE analysis and
sequencing showed that the microbial populations changed upon treatment (Figure
2.1.). Predominant pathogenic species in the population before treatment were
sequence 1 (F. alocis) and sequence 2 (uncultured Eubacterium sp. PUS 9.170). These
sequences have been recovered from subgingival pockets before and could not be
detected 1 day after treatment, as shown in Figure 2.1., lane P00. Nevertheless,
bands at corresponding positions in the gel reappeared after 3 months, indicating that
these pathogenic species had re-established in the population.
Sequences 3 and 4 showed 99% sequence similarity and probably originated
from one organism. Sequence heterogeneities in the 16S rDNA attributable to multiple
gene copies may have resulted in different melting properties in DGGE. This has been
described before for bifidobacterial species (155). Bands 3 and 4 were closely related
to E. aurantiacum and were not eliminated from the population 1 day after treatment
but were suppressed or eliminated after 3 months. This may have been a result of the
presence of dead cells before treatment (P00) that were detected by PCR, or the
microbial population after 3 months may have outcompeted this species. E. aurantiacum
belongs to the Eubacterium group and the presence of very intense, dominant bands
(bands 7, 8 and 12) in 13 of the 25 lanes is in agreement with previous reports
emphasizing the possible role and importance of the Eubacterium group in periodontal
disease (37, 176). Although the role of bacteria belonging to this group in periodontal
disease is unclear, they are abundant in oral infections, but rarely found at healthy
sites (105).
The predominant bands 5 and 6 were related to the putative periodontopatho-
38
gen Campylobacter and appeared in the microbial population after 3 months.

Campylobacter is a microaerophilic species, suggesting that an intermediate
environment was created. Whether this situation will shift towards an anaerobic en-
vironment suitable for anaerobic gram-negative pathogens remains unclear.
The identification of bands 9 and 12 as related to A. israelii and D. fairfieldensis
and not P. intermedia demonstrates the difficulty in identifying species based on their
position in the gel. As shown in this study, the subgingival microbial community is
prone to shifts in composition and diversity. Predominant bands of subgingival microflora
were not related to the bacteria that are commonly associated with periodontitis
(171). The detection of E. aurantiacum and D. fairfieldensis should focus our attention
on previously undetected oral species such as E. aurantiacum and sulfate-reducing
bacteria that have only recently been described as potential indicators for periodontal
disease (88).
Attempts to determine the cause of periodontitis from the bacteria present in
random samples of subgingival plaque does not take into account the dynamic strength
and diversity of the microbial population. As shown in this study, DGGE offers a great
opportunity to study shifts in the microbial composition at a population level, including
identification of shifting species. Further research should be aimed at monitoring the
microbial succession of the oral biofilm, in terms of both species diversity and activity.
Because of the relationship that exists between rRNA and activity of cells, RT-PCR of
rRNA will allow identification of the metabolic activity of the bacterial species present
in the biofilm and thereby improve our knowledge of the species responsible for de-
structive activity.
ACKNOWLEDGMENTS
We thank GC Raangs for his technical assistance and the technicians of the
dental department for taking the samples.
39
3
Denaturing gradient gel
electrophoresis as a diagnostic
tool in periodontal microbiology
Zijnge V, Welling GW, Degener JE,

van Winkelhoff AJ, Abbas F, Harmsen HJM
Journal of Clinical Microbiology (2006) 44: 3628-3633
DGGE AS A DIAGNOSTIC TOOL
SUMMARY
Bacteria play an important role in the initiation and progression of periodontal

diseases and are part of a biofilm, which can contain over 100 different species.
The aim of the present study was to show the potential of denaturing gradient gel
electrophoresis (DGGE) as a tool for the detection of clinically relevant species and
to compare the results of detection by DGGE with those by PCR and culturing.
Hybridization of the bands from the DGGE profiles with species-specific probes
was developed to confirm the band positions in the marker obtained with refer-
ence strains. The sensitivities of DGGE compared to those of cultivation for the
detection of Actinobacillus actinomycetemcomitans, Porphyromonas gingivalis,
Prevotella intermedia, and Tannerella forsythensis were 100, 100, 88, and 100%,
respectively; and the sensitivities of DGGE compared to those of PCR were 100,
90, 88, and 96%, respectively. DGGE as a diagnostic tool could easily be ex-
tended to other species, as shown for Treponema denticola, which could be de-
tected in 48% of the samples. Three different groups of A. actinomycetemcomitans
serotypes could be distinguished by DGGE (i.e., a group comprising serotypes a,
d, e, and f; a group comprising serotype b; and a group comprising serotype c).
Amplicons from P. gingivalis and T. denticola migrated to the same position in the
gel, and P. intermedia produced multiple bands. In the present study we show
that the DGGE profiles represent clinically relevant species which can be detected
by hybridization with species-specific probes. With DGGE, large numbers of samples
can be analyzed for different species simultaneously, and DGGE may be a good
alternative in periodontal microbial diagnostics.
43
CHAPTER 3
INTRODUCTION
Periodontal diseases are infectious inflammatory disorders caused by bacte-

ria that colonize the tooth surface. Upon bacterial plaque accumulation, gingivitis
develops and causes redness, swelling, and gingival bleeding (97). As the dental
plaque biofilm continues to accumulate, different bacterial species may colonize,
develop, and cooperate in the biofilm. This results in a host response that includes
lymphocyte infiltration and the subsequent secretion of cytokines, which may
lead to the destruction of hard and soft periodontal tissues (201). The subgingival
plaque comprises a complex microbiota that mainly consists of gram-negative
anaerobic bacteria (95). The diversity of the subgingival microbiota was exten-
sively explored by Moore and Moore (105), who isolated 509 species from plaque
samples from 300 individuals by cultivation. With molecular techniques such as
cloning and sequencing, this level of diversity was confirmed and unknown
phylotypes were revealed (63,84,130). Socransky et al. (171) related the clinical
parameters of periodontitis, such as bleeding on probing and pocket depth, with
the subgingival microbiota. They proposed different complexes of bacteria which
were related to the severity of periodontitis. The so-called red complex consists of
Porphyromonas gingivalis, Prevotella intermedia, Tannerella forsythensis, and
Treponema denticola. Actinobacillus actinomycetemcomitans is associated with
aggressive forms of periodontitis, such as localized juvenile periodontitis and re-
fractory periodontitis (147,169). Although the subgingival bacterial diversity is
widely appreciated, only a limited number of species have been recognized as
clinically relevant. The complexity of the bacterial community, the presence of
uncultivable or unknown species, and the costly and time-consuming cloning tech-
niques hamper investigation of the relationship between the total microbial com-
munity and disease. As a consequence, little is known about, for example, the
microbial changes that occur in the population during the transition of gingivitis
into periodontitis. The potential of denaturing gradient gel electrophoresis (DGGE)
for the study of total oral microbial populations has been shown previously
(44,165,213). In DGGE, PCR-amplified DNA fragments of the same length but
with different base-pair sequences can be separated. The fragments are loaded on
a polyacrylamide gel containing a linear gradient of denaturants like formamide
and urea. The two strands of DNA are denatured at a certain concentration of
denaturant, depending on the G+C content and the composition of the fragment.
44
Migration is retarded when a fragment reaches its first melting domain. Complete
strand separation is prevented by the addition of a GC-rich fragment to one of the
primers, a so-called GC clamp. When universal bacterial primers are used for PCR-
DGGE, unknown and/or uncultivable species can be detected. PCR-DGGE of com-
plex microbial populations results in a pattern of bands in which each band
represents a different species. DGGE can be used to study microbial complexity
and to monitor population dynamics (109).
DGGE has the potential advantage of detecting multiple species simulta-
neously on a large scale. However, there is no agreement that DGGE profiles are
a representative fingerprint of the population under study (77,108), and it is
uncertain whether clinically relevant species are present in DGGE profiles. Conse-
quently, the aim of the present study was to investigate the potential of DGGE as
a tool for the detection of clinically relevant species and to compare the DGGE
detection results to those obtained by PCR and anaerobic culture.
Sampling protocol
The study subjects were adult patients with chronic periodontitis with
pockets of 6 mm or more showing bleeding on probing. Subgingival plaque samples
from 25 patients were obtained from the deepest pocket in each quadrant of the
dentition with sterile paper points. The samples were pooled in 1.5 ml reduced
transport fluid (183); sent to the Department of Oral Microbiology, ACTA,
Amsterdam, The Netherlands; and processed within 36 h. The samples were
vortexed for 2 min, and 100 l was used for anaerobic culture and 200 l was
used for molecular analysis.
Organisms and culture conditions

A. actinomycetemcomitans serotypes a, b, c, d, e, and f were clinical iso-
lates. P. gingivalis ATCC 33277, Actinomyces neaslundii DSM 43013, Fusobac-
terium magna DSM 20470, Actinomyces israellii DSM 43320, Streptococcus
mutans DSM 20523, Peptostreptococcus micros DSM 20468, Escherichia coli
ATCC 25922, and Fusobacterium nucleatum DSM 20482 were obtained from the
American Type Culture Collection (ATCC strains; Manassas, Va.) or the Deutsche
45
CHAPTER 3
Sammlung von Mikroorganismen und Zellkulturen (DSM strains; Braunschweig,

Germany). The strains from the Deutsche Sammlung von Mikroorganismen und
Zellkulturen or the American Type Culture Collection were cultivated according to
the instructions of the suppliers. A. actinomycetemcomitans was cultured as de-
scribed below.
Cultivation
Aliquots of 0.1 ml from 10-fold serial dilutions were plated onto 5% horse
blood agar plates (no. 2; Oxoid, Basingstoke, United Kingdom) supplemented with
hemin (5 mg/liter) and menadione (1 mg/liter) for the isolation and growth of
obligate anaerobic bacteria and on tryptic soy-serum-bacitracinvancomycin (TSBV)
for the selective isolation and growth of A. actinomyctemcomitans (172). Blood
agar plates were incubated anaerobically in 80% N2, 10% H2, and 10% CO2 for up
to 14 days. TSBV plates were incubated in air supplemented with 5% CO2 for 5
days (178). The total number of CFU was determined and converted to the total
number of CFU/ml. The total number of CFU/ml and the amounts of
A. actinomycetemcomitans, P. gingivalis, P. intermedia, and T. forsythensis as a
percentage of the total number of CFU/ml were determined. The limit of detection
for A. actinomycetemcomitans was 20 cells/ml, and that for the other species
was 104 cells/ml.
DNA extraction
The 200 l samples were incubated for 1 h at 58C with 200 l lysis buffer
(10% sodium dodecyl sulfate [SDS], 0.2 mg/ml proteinase K). Proteinase K was
inactivated by incubation at 80C for 10 min. Subsequently, three cycles of freez-
ing-thawing at -80C for 15 min and 5 min at 80C were performed. For DNA
isolation, 200 l phenol and 200 l chloroform/iso-amylalcohol (24:1:1; vol/vol)
were added to the samples. The samples were centrifuged at 14,000 g for 5 min.
A second phenol-chloroform extraction was performed; and after collection of the
supernatant, the DNA was precipitated with 500 l isopropanol at -20C for 3 h.
After centrifugation at 14,000 g for 15 min, the supernatant was discarded and
the pellet was washed twice in 100 l 70% alcohol. After centrifugation at 14,000
g for 15 min, the supernatant was removed. The pellet was dissolved in 100 l
sterile Milli-Q and stored at -20C.
46
Species-specific PCR
PCR was performed with a T-gradient thermocycler (Whatman Biometra,
Germany) with primers targeting A. actinomycetemcomitans-, P. gingivalis-,
P. intermedia-, or T. forsythensis-specific regions on the 16S rRNA gene (Table
3.1.).
Table 3.1. Primer and probe sequences targeting the 16S rRNA gene used in this study for PCR
amplification and hybridization analysis.
Pr ime r or pr obe Se que nc e s (5' -->3') Re fe r e nc e
Aa 1034 AAA CCC ATC TCT GAG TTC TTC TTC 9
Aa 478 ATG CCA ACT TGA CGT TAA AT 9
Pg1132 ACT GTT AGC AAC TAC CGA TGT 9
Pg729 AGG CAG CTT GCC ATA CTG CG 9
Pf760 TGC TTC AGT GTC AGT TAT ACC T 9
Bf120 GCG TAT GTA ACC TGC CCG CA 9
Pi1032 TTT GTT GGG GAG TAA AGC GGG 9
Pi458 TCA ACA TCT CTG TAT CCT GCG T 9
I-341fGC GC CLAMP-CCT ACG GGI GGC IGA 195
I-533r TIA CCG III CTI CTG GCA C 195
GC c la mp CGC CCG CCG CGC GCG GCG GGC GGG GCG 108
GGG GCA CGG GGG G
Aa 502 AAC GTC AAK TTG GCA TGC This study
PG477 CTG ATC GCC CGT TAT TCC C This study
Pi425 CTT TAC TCC CCA ACA AAA GCAGTT TAC AA 181
Tf440 CGT ATC TCA TTT TAT TCC CCT GTA 181
Td469 CAT GAC TAC CGT CAT CAA AGA AGC 106
47
CHAPTER 3
The primers were designed by Ashimoto et al. (9). The PCR mixture con-
tained 5.0 l reaction buffer (100 mM Tris-HCl, pH 8.3, 500 mM KCl, 15 mM
MgCl2), 4.0 l deoxynucleoside triphosphates (dNTPs; 200 M each dNTP), 35.5
l Milli-Q, 2.0 l (400 nM) of each primer, 0.5 l (2.5 U) Taq, and 1.0 l template.
The temperature profile included an additional denaturation step of 10 min at
96C, followed by 34 cycles of a denaturation step at 96C for 1 min, a primer
annealing step at 61C for 45 s, and an extension step at 72C for 1 min, with a
final extension step of 72C for 5 min. The PCR products were analyzed by
electrophoresis on a 2.0% agarose gel. The gel contained 0.5 g/ml ethidium
bromide. The limit of detection of the PCRs for all four species was less than 50
cells.
PCR-DGGE
PCR amplification of the 16S rRNA gene fragment region at positions ~341
and ~533 (E. coli numbering) was performed on a T-gradient thermocycler
(Whatman Biometra) with universal bacterial primers I-341fGC and I-533r (Table
3.1.) (195). The PCR mixture contained 5.0 l reaction buffer (100 mM Tris-HCl,
pH 8.3, 500 mM KCl, 15 mM MgCl2), 4.0 l dNTPs (200 M each dNTP), 35.75
l Milli-Q, 2.0 l (400 nM) of each primer, 0.25 l (1.25 U) Taq, and 1.0 l
template. The temperature profile included an additional denaturation step of 1
min at 94C, followed by 35 cycles of a denaturation step at 94C for 45 s, a
primer annealing step at 49C for 30 s, an extension step at 72C for 1 min, with
a final extension step of 72C for 5 min. The PCR products were analyzed by
electrophoresis on a 2.0% agarose gel containing 0.5 g/ml ethidium bromide.
DGGE analysis of PCR amplicons

DGGE of the PCR products generated with the I-341fGC/I-533r primer set
was performed as described by Muyzer et al. (110) with the use of a PhorU
system (Ingeny, The Netherlands). The PCR products were loaded on a 6% (wt/
vol) polyacrylamide gel in 0.5xTAE (1xTAE is 0.04 M Tris base, 0.02 M acetic
acid, and 1.0 mM EDTA [pH 7.5]). The denaturing gradient consisted of 30% to
70% denaturant (100% denaturant equals 7 M urea and 40% formamide). The
gels were poured by use of a gradient mixer. A 10 ml stacking gel without dena-
turant was layered on top. Electrophoresis was performed for 16 h at 100 V at
60C. The gels were stained with silver nitrate.
48
Southern blotting of DGGE gels

After DGGE, the DNA from a nonstained gel was transferred to nylon hybrid-
ization membranes (Hybond N+; Amersham International plc) by use of a semidry
electroblotter, according to the manufacturers instructions, with the transfer
medium consisting of 0.1xTAE buffer; and the blot was run at 252 mA for 3 h.
Following transfer, the DNA was simultaneously denatured and covalently cross-
linked to the hybridization membrane by incubation on a pad of 3MM paper
(Whatman International, Kent, United Kingdom) soaked in 0.4 M NaOH for 30
min, followed by neutralization on two pads of 1 M Tris-HCl, pH 7.0, for 2 min
each. The filters were then baked for 2 h at 80C and stored at -20C until further
processing.
Hybridization of blots
The optimal hybridization temperatures for probes Aa502, Pg477, Pi425,
Tf440, and Td469 were calculated with the web-based application OligoAnalyzer
3.0 (http://207.32.43.70/biotools/oligocalc/oligocalc.asp) and were determined
empirically. Tenfold serial dilutions of the PCR amplicons were blotted onto a
nylon membrane and hybridized. The calculated hybridization temperatures were
lower than the empirically determined temperatures. For increased specificity, we
chose to use the empirically determined hybridization temperatures. Prehybridization
and hybridization were carried out in hybridization solution (5XSSC [1XSSC is
0.15 M NaCl plus 0.015 M sodium citrate0.1% sodium lauryl sulfate], 0.02%
[wt/vol] SDS, 0.1% N-lauroylsarcosine) at 42C for probes Aa502, Tf440, and
Td469 or 50C for probes Pg477 and Pi425. At the hybridization temperature,
two stringency washes of 15 min each with 2XSSC0.1% SDS were followed by
two stringency washes of 15 min each with 0.1XSSC0.1% SDS. According to
the manufacturers instructions, the hybridized blots were incubated for 1 h at
room temperature with alkaline phosphatase conjugate in buffer A (0.3 M NaOH,
0.1 M Tris-HCl, pH 7.5). The membranes were washed free of unbound conjugate
with three washes of 10 min each with 0.3% Tween 20 in buffer A. For signal
generation, the membranes were incubated overnight with 1.3 ml enhanced
chemifluorescence substrate (Amersham Biosciences, Little Chalfont, United King-
dom). Fluorescent signals were detected with a PhosphorImager (Molecular Dy-
namics, Sunnyvale, Calif.) and analyzed with image analysis software.
49
CHAPTER 3
RESULTS
Probe design and determination of optimal hybridization conditions

Probes Aa502 and Pg477 have been designed by using the ARB software
package (98) and tested for specificity against reference strains. Both probes
were specific for their target organisms. The optimal hybridization temperatures
were 42C for probes Aa502, Tf440, and Td469 and 50C for probes Pg477 and
Pi425. Probe Aa502 is complementary to a conserved region of the 16S rRNA
where intrahelix secondary base interactions may interfere during hybridization
(13). It is therefore not possible to use probe Aa502 in fluorescent in situ hybrid-
ization experiments. Probe Aa502 hybridized to PCR amplicons of the six
A. actinomycetemcomitans serotypes baked on a nylon membrane but not to
amplicons of the P. gingivalis, P. intermedia,or T. forsythensis strains.
Cultivation
Twenty-five patient samples were analyzed by cultivation. The average total
number of CFU/ml was 2.1x108 (range, 6.0x106 to 2.1x109 CFU/ml; standard
deviation, 4.7x10 8 CFU/ml). Three of the 25 samples were positive for
A. actinomycetemcomitans. A. actinomycetemcomitans contributed 0.009 to 2.0%
of the total number of CFU/ml. Nine of the 25 samples were positive for P. gingivalis.
P. gingivalis contributed 2 to 38% to the total number of CFU/ml. Sixteen of the
25 samples were positive for P. intermedia. P. intermedia contributed 0.4 to 18%
to the total number of CFU/ml. Twenty-three of the 25 samples were positive for
T. forsythensis. T. forsythensis contributed 0.008 to 21% to the total number of
CFU/ml.
Cultivation versus species-specific PCR

DNA extracts from 25 samples were analyzed for the presence of
A. actinomycetemcomitans, P. gingivalis, P. intermedia, and T. forsythensis. The
results are shown in Figure 3.1. and Table 3.2. The three samples that were
positive for A. actinomycetemcomitans by culture were also positive by PCR. An
additional two samples were positive for A. actinomycetemcomitans by PCR. Next
to the nine samples positive for P. gingivalis by cultivation, one additional sample
was positive for P. gingivalis by PCR. For P. intermedia, 13 samples were positive
by both cultivation and PCR, 3 samples were positive by culture but negative by
50
PCR, and 3 samples were positive by PCR and negative by culture. Twenty-four
samples were positive for T. forsythensis by PCR, whereas 23 were positive for
T. forsythensis by culture.
Patient samples
Samples M M 12 14 16 18 20 22 24 M
1 2 3 4 5 6 7 8 910 11 13 15 17 19 21 23 25
Aa Cult. - - - - + - - - + - - - - - + - - - - - - - - - -
PCR - - - - + - - - + + - - - - + - - - - - - - - + -
Pg Cult. - - - + + - - - + - - + - - - + - + - - - + + + -
PCR - - - + + - + - + - - + - - - + - + - - - + + + -
Pi Cult. + - - + + + + + + - - + - + + + - + + + - + + - -
PCR + - - - + + + + + + + - - + + + - + + + - + + - -
Tf Cult. + - + + + + + + + + + + - + + + + + + + + + + + +
PCR + - + + + + + + + + + + + + + + + + + + + + + + +
Tf Hyb.
M + - + + + + + + + + M+ + - + + + + + + + + + + + + M
Pg Hyb.
M - - - + + - - - + - M- + - - - + - + - - - + + + - M
Aa Hyb.
M - + - - + - - - + + M+ - - - + - - - - - - + - + - M
Pi Hyb.
M - - - + + + + + + - M+ + - + + + - + + + + + + - - M
Figure 3.1. Cultivation (Cult.), PCR, and hybridization (Hyb.) results for A. actinomycetemcomitans
(Aa), P. gingivalis (Pg), P. intermedia (Pi), and T. forsythensis (Tf) presented in line. Lanes M,
markers containing a mixture of PCR amplicons of reference species.
51
CHAPTER 3
Patient samples Reference species

Aa
serotypes
1 2 3 4 5 6 7 8 9 10 111213141516171819202122232425 a b c d f Pg Pi Tf
Figure 3.2. DGGE profiles for 25 samples and reference species. Aa,
A. actinomycetemcomitans; Pg, P. gingivalis; Pi, P. intermedia; Tf, T. forsythensis.
Cultivation versus hybridization analysis of DGGE blots

The DGGE profiles for the strains from the 25 patient samples and the refer-
ence strains are shown in Figure 3.2. On average, the profiles for strains from the
patient samples show a high number of bands, and between patients, a variation
in the banding patterns can be observed (Figure 3.2.). The identification of patho-
gens by comparison of their migration patterns with those of reference strains is
therefore difficult. Identification is even more complicated for P. gingivalis and
T. denticola, which migrate to the same position in the gel. Even when a mixture
of the PCR products of P. gingivalis and T. denticola is loaded on the gel, the
fragments migrate to the same position in the gel, resulting in a single band.
52
DNA fragments from A. actinomycetemcomitans serotypes a, d, e, and f

migrate to the same position in the gel, whereas fragments from serotypes b and
c migrate to different positions. The DGGE profiles were transferred to nylon
membranes and analyzed for the presence of A. actinomycetemcomitans,
P. gingivalis, P. intermedia, T. forsythensis, and T. denticola with species-specific
probes. The results are presented in Figure 3.1. and Table 3.2. The three samples
positive for A. actinomycetemcomitans by culture were also positive by DGGE. In
addition, five more samples appeared to be positive by DGGE. Four patients har-
bored serotype c; three patients harbored serotype b; and three patients harbored
serotype a, d, e, or f. Furthermore, two patients harbored a combination of a
serotype b strain with a serotype a, d, e, or f strain. The nine samples positive for
P. gingivalis by culture were positive by DGGE. For P. intermedia, 15 of the 16
culture-positive samples were positive by DGGE. In addition, two other samples
were positive. The 23 samples positive for T. forsythensis by cultivation were
positive by DGGE. Although cultivation of T. denticola was not performed, the
profiles were screened for the presence of T. denticola to show the ease and the
possibility of extension of the set of species that can be detected by DGGE.
Twelve (48%) patients were positive for T. denticola (Table 3.2.).
Table 3.2. Detection results from cultivation, specis-specific PCR, and DGGE for the four pathogens
associated with periodontitis in 25 subgingival plaque samples.
No. of sa mple s with positive

r e sults (se nsitivity)a [%]
Spe c ie s Cultiva tion PCR DGGE
Actinobacillus actinomycetemcomitans 3 (38) 5 (100) 8 (100/100)
Porphyromonas gingivalis 9(100) 10 (100) 9 (10/90)
Prevotella intermedia 16 (88) 16( 88) 17 (94/88)
Tannerella forsythensis 23 (100) 24 (100) 23 (100/96)
Treponema denticola ND ND 12
a
The se nitivity of c ultiva tion wa s c a lc ula te d with DGGE a s the r e fe r e nc e sta nda r d. The se nsitivity
of PCR wa s c a lc ula te d with c ultiva tion a s the r e fe r e nc e sta nda r d. The se nsitivity of DGGE wa s
c a lc ula te d with both c ultiva tion a nd PCR a s the r e fe r e nc e sta nda r ts, a s indic a te d by the two
se nsitivity va lue s, r e spe c tive ly, in pa r e nthe se s. ND, not de te r mine d.
53
CHAPTER 3
DISCUSSION
The present study examined the use of DGGE as a diagnostic tool. Samples
from 25 patients with periodontal disease were analyzed for the detection of
A. actinomycetemcomitans, P. gingivalis, P. intermedia, and T. forsythensis by
cultivation, species-specific PCR, and DGGE. The results showed that there was
good agreement in the results for the detection of A. actinomycetemcomitans,
P. gingivalis, P. intermedia, and T. forsythensis by either cultivation, PCR, or
DGGE. The sensitivity of DGGE for P. gingivalis and T. forsythensis was lower by
use of PCR as a reference than by use of cultivation as a reference. This can be
explained by the lower limit of detection of the species-specific PCR. For
A. actinomycetemcomitans, an additional two samples were positive by species-
specific PCR than by cultivation and five more samples were positive by DGGE
than by cultivation. This may be the result of the lower limit of detection of PCR-
based techniques and the fact that dead cells are also detected by PCR. Interest-
ingly, three samples were PCR negative and DGGE positive for
A. actinomycetemcomitans. This may be due to the higher specificity of probe
Aa502 compared to those of the primers used. Online analysis at the RDPII data-
base revealed 42 positive matches for probe Aa502, compared to only 8 positive
matches for the reverse primer and 15 positive matches for the forward primer.
Except for nine sequences, the available sequences are partial and do not include
the V6-V8 region where the sequence of the A. actinomycetemcomitans reverse
primer used is positioned. Kaplan et al. (72) showed that differences in 16S
rRNA gene sequences could be related to different serotypes of
A. actinomycetemcomitans. Ihalin and Asikainen (65) noted different unique mi-
gration patterns within serotype e strains when they used the V6-V8 region to
study the migration patterns of different serotypes by DGGE. The available data
show that variable regions in the 16S rRNA gene are present between and within
serotypes. These findings may explain the PCR-negative, DGGE-positive results.
Boutaga et al. (17) and Siqueira et al. (163) also used the V6-V8 region for
A. actinomycetemcomitans specific primer design. Those two groups of investi-
gators found five culture-positive, quantitative PCR-negative samples and three
checkerboard DNA-DNA hybridization assay-positive, PCR-negative samples,
respectively. The primers that were designed may not cover some variants or
serotypes, especially serotype e. On the basis of these findings, we conclude that
54
the V6-V8 region is not suitable for A. actinomycetemcomitans specific primer or

probe design until complete 16S rRNA gene sequences covering all six serotypes
are available. Probe Aa502 was specific for A. actinomycetemcomitans, and hy-
bridization of DGGE profiles generated with primer set I-341fGC/I-533r with probe
Aa502 could distinguish between serotypes a, d, e, and f and serotype b or c.
According to Yang et al. (210) and Paju et al. (125), serotype b is the predominant
serotype in periodontitis, endocarditis, and bacteremia; serotype c is predominant
in periodontally healthy subjects; and serotypes d and e should be considered
rare.
The culture-positive, PCR-negative results for P. intermedia may be due to
the discriminating capacity of PCR between P. intermedia and P. nigrescens, which
cannot be obtained with standard culture techniques, resulting in false-positive
results (50). This resulted in low sensitivities for DGGE and PCR. When PCR was
used as the reference, the sensitivity of DGGE decreased to 88% for P. intermedia.
This may be due to the specificity of probe Pi425, the lower detection limit of
PCR, and the presence of multiple bands for P. intermedia in a DGGE profile.
Multiple bands can be caused by microvariations introduced during PCR (175), the
application of degenerated primers, and the presence of four open reading frames
for the 16S rRNA gene (The Institute of Genomic Research [www.tigr.org]). The
presence of multiple bands complicates the interpretation of the profile. Screening
for T. denticola shows the possibility of the extension of detection by DGGE to
fastidious or noncultivable bacteria. Differences in hybridization temperatures of-
fer the possibility of detection of P. gingivalis and T. denticola during subsequent
hybridization sessions. By hybridization with the bands from the DGGE profiles,
T. denticola was detected in 12 (48%) samples. This finding is in agreement with
those of a previous report (209), showing a T. denticola prevalence of 40 to 50%
in subgingival samples.
DGGE has mostly been used to study population dynamics and bacterial
diversity and to monitor bacterial colonization and succession (110). Besides the
benefits, DGGE has potential pitfalls. First, only bacterial populations making up
more than 1% of the total community can be detected by DGGE (109). In the
present study we demonstrated that clinically relevant species are present and
can be detected from their DGGE profiles, even when they comprise less than 1%
of the cultivable population. Second, amplified fragments from different species
might migrate to the same location in the gel (77) or multiple bands are observed
55
CHAPTER 3
from a single species. Subgingival diversity measurements are also biased by

multiple bands from single species (A. actinomycetemcomitans and P. intermedia)
and by fragments from different species that migrate to the same position in the
gel (P. gingivalis and T. denticola). These limitations of DGGE can be overcome by
the application of speciesspecific probes during different hybridization sessions.
Detailed information about species that produce multiple bands or the migration of
fragments to similar locations will provide more insight into species diversity and
can be used to refine statistical analyses of DGGE profiles. In conclusion, the
present study shows that the results of DGGE and hybridization with species-
specific probes correlate with those of cultivation and PCR for the detection of
clinically relevant periodontal pathogens. DGGE outcompetes cultivation and PCR
in its sensitivity for the detection of A. actinomycetemcomitans. DGGE offers the
opportunity to detect multiple species simultaneously and to distinguish between
A. actinomycetemcomitans serotypes and can easily be extended to other species
of interest. Moreover, the use of DGGE and hybridization offers the opportunity to
study the presence of these pathogens in relation to the presence of other
species. Therefore, DGGE may be the next alternative in clinical microbiological
diagnostics.
ACKNOWLEDGMENTS
We thank Erwin Raangs for technical assistance and the technicians from the
Oral Microbiology Department at ACTA for culturing the reference strains.
56
4
Microbial population dynamics
of subgingival pockets
after mechanical scaling and
root planing
Zijnge V, Degener JE, Abbas F, Harmsen HJM

MICROBIAL POPULATION DYNAMICS
SUMMARY
To study the population dynamics in the total bacterial population and in the
Actinobacteria, Firmicutes and Cytophaga- Flavobacterium-Bacteriodes (CFB) popu-
lations after full-mouth scaling and root planning (FM-SRP) or multiple-session
scaling and root planning (MS-SRP) in a three-months post-treatment period.
25 subjects were randomly assigned to FM-SRP or MS-SRP groups. At baseline,
immediately after treatment, after 1, 2, 7, 14 and 90 days, paper point samples
from a single periodontal pocket were collected for microbiological analysis by
denaturing gradient gel electrophoresis of PCR amplicons obtained with universal
and group-specific primers sets. At baseline and after three months probing pocket
depth (PPD), plaque index (PlI) and bleeding on probing (BoP) were recorded.
At baseline the populations are skewed, with a few species (Tannerella forsythia,
CFB-cluster 36.7, Streptococcus sp., Actinomyces israelii and Actinomyces
odontolyticus) present in almost every patient and the majority of species being
present in a limited number of samples. SRP does not result in the complete
eradication of bacteria but induces a change in the populations. The Actinobacteria
and Firmicutes populations return to baseline population composition after three
months whereas the CFB-population differs from baseline. There are no significant
differences between the two treatment modalities with respect to the microbial
composition. Pockets 4 mm have a CFB population more different from baseline
than pockets >4 mm.
SRP only results in a change in the composition of bacterial populations. This
change is temporarily for Actinobacteria and Firmicutes and may last for at least
three months for the CFB population. Pocket depth after three months seems
to be more important than treatment option in establishing a CFB population dif-
ferent from baseline. Clinically successfully treated pockets ( 4 mm) showed a
significantly more different CFB population compared to baseline.
61
CHAPTER 4
INTRODUCTION
Periodontal diseases are inflammatory diseases that result in the ulceration

of epithelial lining of the tooth facing part of the gingival tissue, loss of attachment
of connective tissue, bone loss and eventually loss of teeth. The subgingival bac-
terial population associated with periodontitis resides below the gum line in the
so-called subgingival plaque and is characterized by predominantly gram-negative
bacteria from the genera of the Fusobacteria, Spirochetes and Bacteroidetes.
Moreover, Porphyromonas gingivalis, Tannerella forsythia and Aggregatibacter
actinomycetemcomitans are strongly associated with periodontal disease (172).
These bacteria are organized in a biofilm (Chapter 5) (94). Cleaning of the root
surface by mechanical scaling and rootplaning (SRP) together with oral hygiene
instructions is the method of choice for a cause related and effective therapy in
periodontal diseases (24). The aim of SRP is to remove hard deposits from the
root surface and to remove the subgingival biofilm. Clinically, SRP results in re-
duction in pocket depth and gain of clinical attachment (12,24) and a correspond-
ing healthy periodontium without inflammation. Although reduction or even ces-
sation of inflammation can be achieved, little is known about the effects of SRP on
the microbial population.
SRP results in a significant decrease in the amount of colony forming units
(CFU) immediately after treatment (132,167,205). However, the total CFU might
still be over 105 cfu/ ml (142). Three months after SRP a decrease but not the
elimination of selected pathogens can be observed (27). Decreases in the numbers of
P. gingivalis (56), P. intermedia (113), T. forsythia (56), A. actinomycetemcomitans (104)
and T. denticola (56) have been related to clinical improvements, whereas Haffajee et
al. (56) noted that clinical improvements were only accompanied by moderate changes
in the subgingival microbiota. In addition, Darby et al. (30) did not find a link between
a decrease in these organisms and clinical outcome at all. The absence of a clear link
between clinical outcome and the change in the detection of pathogens after SRP
might be explained by the time of sampling after SRP. Most of the results in these
studies were based on data obtained a significant time after treatment, leaving the
bacteria enough time for new plaque formation. Studies on the formation of plaque on
pristine tooth surfaces show that within two weeks the population already becomes
dominated by gram negative rods, filaments and spirochetes (162). Compared to plaque
formation on pristine tooth surfaces, relatively little is known with regard to the changes
62
in the subgingival bacterial population in the first week after SRP. Consequently, the
aim of the present investigation was to study the effects of SRP on all bacteria as
well as Actinobacteria, Firmicutes and members Cytophaga-Flavobacterium-Bacteriodes
phylum (CFB) by denaturing gradient gel electrophoresis (DGGE) immediately and with
time up to three months post-treatment.
Patient and sampling site selection

Samples from 25 patients implemented in a randomized clinical trial pre-
sented previously (Chapter 6) have been used in the present study. In short, a
single pocket with PPD 6 mm on a single rooted tooth in the upper right quadrant
of each patient was selected. Microbiological samples from this specific tooth in
the test quadrant were collected at seven timepoints in the test quadrant: before
treatment (P), immediately after SRP (I), 1 day (A), 2 days (B), 1 week (C), 2
weeks (D) and three months (G) after treatment. Twelve patients were treated
according the full-mouth SRP (FM-SRP) protocol and thirteen to the multiple-ses-
sion SRP (MS-SRP) protocol. After removal of supragingival plaque and the isola-
tion of the site with cotton rolls, sampling was performed with a single sterile
paperpoint (ROEKO, size M) which was left in place for 20 s. Samples were
collected in coded screw-cap tubes and transported to the laboratory and stored
at -20C until further processing.
Organisms and culture conditions

A. actinomycetemcomitans (ATCC 29523), P. gingivalis (ATCC 33277),
Actinomyces neaslundii (DSM 43013), Actinomyces israellii (DSM 43320), Acti-
nomyces odontolyticus ATCC 17929, Streptococcus sanguis (ATCC 10566), Strep-
tococcus oralis (ATCC 35037) Streptococcus mutans (DSM 20523), Fusobacte-
rium nucleatum (DSM 20482), Lactobacillus fermentum (ATCC 14931), Bacteroi-
des fragilis (DSM2151), Atopobium parvulum (DSM20469), Veillonella parvula
(ATCC 10790), Bifidobacterium dentium (ATCC 27678), T. forsythensis (ATCC
43037), Prevotella intermedia (ATCC 25611), Rothia dentocariosa (DSM 43761),
Lactobacillus casei (ATCC27092), Lactobacillus jensenii (DSM 20557), Prevotella
nigrescens (DSMZ 13386), Staphylococcus epidermidis (clinical isolate), Staphylo-
63
CHAPTER 4
coccus warneri (clinical isolate), Bacillus subtilis (clinical isolate) and T. denticola
(DSM 14222) were obtained from the American Type Culture Collection (ATCC,
Rockville, Md.) or the Deutsche Sammlung von Mikroorganismen und Zellkulturen
(DSMZ, Braunschweig, Germany). DSMZ or ATCC strains were cultivated accord-
ing to the instructions of the suppliers All other strains were cultivated in anoxic
peptone-yeast extract-glucose medium under anaerobic conditions at 37C or in
the case of facultative anaerobes on brain heart infusion agar (Oxoid, Basingstoke,
United Kingdom).
DNA extraction
DNA was extracted according to the extraction protocol of Zijnge et al. (214)
In short, 200 l of demineralized H20 and 4 glass beads were added to the tubes
with the paper points. After homogenizing thoroughly for 5 s using a vortex, three
cycles of freeze-thawing at -80C for 15 min and 5 min at -80C were performed.
Subsequently, the samples were incubated for 1 hour at 37C with 10 l lysozyme
(40 mg/ml), followed by an incubation for 1 hour at 58C with 100 l lysis buffer
(10% SDS, 0.2 mg/ml proteinase K). For DNA isolation 200 l phenol and 200 l
chloroform/iso-amylalcohol (24:1 v/v) were added to the samples and homog-
enized. The samples were centrifuged for 5 min at 14,000 g. A second phenol/
chloroform/iso-amylalcohol extraction was performed on the aqueous phase and
centrifugation, DNA was precipitated from the aqueous phase with 1/10 v/v 3M
sodium acetate (pH 5.2) and 2.5* v/v 96% ethanol at -20C overnight. After
centrifugation for 15 min at 14,000 g, the supernatant was discarded and the
pellet washed twice with 100 l 70% alcohol. After centrifugation for 15 min at
14,000 g, the supernatant was removed. The pellet was dissolved in 50 l sterile
TE buffer and stored at -20C.
PCR-DGGE
PCR was performed on a T-gradient thermocycler with a universal bacterial
primer set and group-specific primer sets for the Firmicutes, Actinobacteria and
CFB cluster (Table 4.1.). The PCR mixture of 50 l contained 10 mM Tris-HCl, pH
8.3, 50 mM KCl, 1.5 mM MgCl2, 250 M of each dNTP, 35.75 l Milli-Q, 200 nM
of each primer, 0.625 U Taq (TaKaRa SHUZO Ltd, Otsu, Japan) (1.25 U Taq for
64
Table 4.1. Primer sets used in this study
Se que nc e De na tur ing

Ta r ge t Round Pr ime r se ts Pr ime r 5'-->3' gr a die nt Re fe r e nc e
(a c r yla mide )
CFB-c luste r 1 CFB555f/ CFB555f CCG GAW TYA TTG 30%-60%

CFB968r GGT TTA AAG GG (8%) (111)
CFB968r GGT AAG GTT CCT

CGC GTA (111)
2 CFB555f-GC/ U907r -GC CCG TCA ATT CMT (108)

U907r TTG AGT TT
Fir mic ute s 1 Fir m350f/ Fir m350f GGC AGC AGT RGG 40%-55% (111)
Fir m814r GAA TCT TC (6%)
Fir m814r ACA CYT AGY ACT (111)

CAT CGT TT
2 U518f-GC/ U518f-GC CCA GCA GCC GCG (108)

U785r GTA AT
U785r CTA CCA GGG TTC (90)

TAA TCC
Ac tinoba c te r ia 1 ACT235f/ ACT235f GCC CGC GGC CTG 40-60% (8%) (177)
ACT238f/ TTA GCT
ACT878r
ACT238f GGG TAG CCG GCC (177)

TGA GAG GG
ACT878r CCG TAC TCC CCA (177)

GGC GGG
2 U518f-GC/ U518f-GC CCA GCA GCC GCG (108)

U785r GTA AT
U785r ACT CTA CCA GGG (90)

TAT CTA AkC C
Unive r sa l 1 U341f-GC/ U341f-GC CCT ACG GGA GGC 30%-70% (195)

e uba c te r ia l U533r AGC AG (6%)
U533r ATT ACC GCG GCT (195)

GCT GG
Atta c he d to GC-c la mp CGC CCG CCG CGC (195)

the 5'-e nd of GCG GCG GGC GGG
the for wa r d GCG GGG GCA CGG
pr ime r GGG G
65
CHAPTER 4
the Firmicutes) and 1.0 l template. The temperature profile included hot-start
denaturing step of 2 min at 94C, followed by 30 cycles of a denaturing step at 94C
for 60 s, a primer annealing step at 59C for 60 s, an extension step at 72C for 1
min and a final extension step of 72C for 5 min. For the nested PCR, the same PCR
mixture was used, with 0.625 U Taq for each primer set. The temperature profile for
the universal primer set included a hot-start denaturing step of 1 min at 94C, followed
by 34 cycles of a denaturing step at 94C for 45 s, a primer annealing step at 59C
for 30 s, an extension step at 72C for 1 min and a final extension step of 72C for
5 min. PCR products were analyzed by electrophoresis on a 2.0% agarose gel containing
0.5 g/ml ethidium bromide.
DGGE analysis of PCR amplicons

DGGE of generated PCR products was performed as described previously
(109), with the use of a PhorU system (Ingeny, The Netherlands). PCR products
were loaded on a 6% polyacrylamide gel (8% for the CFB PCR products) in 0.5xTAE
(1xTAE is 0.04 M Tris base, 0.02 M acetic acid and 1.0 mM EDTA [pH 7.5]). The
denaturing gradients were 30%-70% for the universal, 30%-60% for the CFB-
cluster, 40%-55% for the Firmicutes and 40%-60% for the Actinobacteria (100%
denaturant equals 7 M Urea and 40% formamide). Gels were poured using a
gradient mixer. A 10 ml stacking gel without denaturant was layered on top.
Electrophoresis was performed for 16 h at 100 V at 60C. Gels were stained with
silver nitrate (153).
Analysis of the DGGE profiles

Band assignment was performed manually and subsequent identification of
band classes by GELCOMPAR II software package (Applied maths, Belgium) with
the Jaccard coefficient using optimized search criteria (0% optimization, 30-50%
position tolerance). The dataset was dichotomized and analyzed in Excel. The
bands per lane are counted as a measure for the microbial diversity and a
coefficient of similarity (Cs) is calculated to compare the composition of two
populations by the following formula (49):
Cs=2j/(a+b)*100%
In which j is the number of common DGGE bands between two lanes, a is the
number of bands in lane a, and b the number of bands in lane b. A Cs value of
100% corresponds to two identical DGGE profiles. Differences between groups
66
were tested at the p<0.05 level with the non-parametric Mann-Whitney test.
Bandclasses are categorized into seven categories (Figure 4.1.). Absent all the
time bands that are absent all the time in a patient; Positive all the time bands that
are positive all the time in that patient; Recolonization bands that are present at
baseline, disappear during the study and appear at least after three months;
Colonization bands that are not present at baseline but appear until three months;
Disappear bands present at baseline but absent at three months; Bands absent at
baseline and after three months but are present at least at two consecutive time
points during the study Intermediate colonization and bands that could not be
categorized Other.
Universal CFB-cluster Actinobacteria Firmicutes

M M M M M M M M
P I A B C DG P I A B C DG P I A B C DG P I A B C DG
T. forsythia 1
A. israelii
Streptococcus sp.
P. gingivalis/ 2
T. denticola T. forsythia
F. nucleatum S. sanguis
A. actinomycetemcomitans
A. naeslundii B. fragilis S. oralis
S. mutans P. gingivalis
V. parvula L. jensenii
L. fragmentum
Staphylococcus sp.
L. casei
A. parvulum L. casei
S. mutans
P. nigrescens 3
R. dentocariosa 4
P. intermedia B. subtilis
5
B. dentium
A. odontolyticus
Figure 4.1. DGGE fingerprints of the Universal, CFB-cluster, Actinobacteria and Firmicutes
bacterial populations as obtained with the specific primer sets. (M) Marker, (P) before treatment,
(I) immediately, (A) 1 day, (B) 2 days, (C) 1 week, (D) 2 weeks and (G) three months after
treatment. The different responses of species to treatment is categorized in (1) Positive all the
time, (2) Disappear, (3) Colonization, (4) Intermediate colonization and (5) Recolonization.
67
CHAPTER 4
RESULTS
The short-term effect of SRP on the subgingival microbial population is studied

by analyzing paperpoint samples from a single pocket at seven different timepoints
after therapy. Patient characteristics, study design and microbiological sampling is
described by Zijnge et al. (Chapter 6).
DGGE profiles for four different bacterial groups, that is all bacteria, the CFB-
cluster of the Bacteroidetes, the Firmicutes and the Actinobacteria, were used to
provide in depth analyses of the population dynamics after SRP. Next to each
DGGE profile of a patient, a marker with relevant species was loaded onto the gel
(Figure 4.1.). This facilitated the identification of species, compensated for gel
irregularities and to normalize the patient samples from different gels into a con-
sensus profile. The frequency distribution of bands in the bandclasses was skewed.
A limited number of band classes is present in a high number of samples whereas
the majority of band classes are present in a limited number of samples. The use
of median values is therefore considered more appropriate and shows that treat-
ment does not result in a difference in the number of bands at any time point after
treatment (Table 4.2.).
Cs-values between the species composition in the baseline samples and in
the follow-up samples show a reduction in the similarity. Also between subse-
quent time points the population changed, up to three months (Table 4.3.). To
obtain more detailed information on population dynamics, the band classes are
ordered by the frequency distribution of the bands (Figure 4.2.-4.4.). Bands present
in 50% (30% for Firmicutes) of the samples at any time point or bands that
changed more than 30% in frequency, were categorized into seven different cat-
egories (Table 4.4.). There were three striking findings. First, before treatment
only five bands are present in almost all patients (T. forsythia, CFB-cluster 36.7,
Streptococcus sp., A. israelii and A. odontolyticus). Whereas after three months
only Streptococcus sp., A. israelii, A. odontolyticus and Rothia dentocariosa are
present in almost all patients. These prominent species are affected by treatment
but recolonize the pocket afterwards. The prominent bands in the CFB profiles do
not return to baseline values and not a single band could be observed to be present
in more than 15 samples after three months. Second, CFB bands 46.8, 47.4 and
49.6, Actinobacteria bands Act 62.3, Act 54.2, Act 63.1 and Act 61.3 and
R. dentocariosa, are not frequently detected at baseline, but become more preva-
68
lent after SRP. Third, three months after SRP the shape of the Figures 4.2.-4.4. is
comparable to baseline for the Firmicutes and Actinobacteria, although there are ad-
ditional bands after three months detected in higher frequencies. For the CFB how-
ever, the frequency distribution levels off, the shape of the graph flattens, with no
particular band being present in more than 15 samples.
To see whether treatment modality or clinical outcome is related to changes
in the population, the data was organized accordingly. FM-SRP result in a signifi-
cant less similar CFB population compared to baseline than Q-SRP at time point C
and for the Actinobacteria at timepoint I (Table 4.5.). Clinically successfully treated
pockets resulting in probing pocket depths 4 mm differ significantly more from
baseline CFB-cluster population composition at time point D and G than pockets
with clinical outcome >4 mm. The same accounts for time point I for the univer-
sal primer set (Table 4.6.).
Figure 4.2. Frequency distribution of bands in the band classes of the Cytophaga-
Flavobacterium-Bacteriodes phylum (CFB) at baseline and after three months in a group of 25
patients.
69
Baseline
Baseline
Figure 4.3. Frequency distribution of bands in the band classes of the Firmicutes at baseline
months
months
Three
Three
Figure 4.4. Frequency distribution of bands in the band classes of the Actinobacteria at
2.5
8.8 ac t:75.1
Firm:2 ac t:77.5
8.3
Firm:2 ac t:18.7
Firm:2
5.0 ac t:77.9
5.6 ac t:68.4
Firm:4 ac t:44.9
7.8 ac t:69.9
Firm:3
0.7 ac t:1.5
Firm:3 ac t:4.8
.5
Firm:9 ac t:3.2
Firm:7
.3 ac t:2.9
.0 ac t:89.7
Firm:2 ac t:75.3
8.6 ac t:58.3
Firm:1
5.9 ac t:51.3
Firm:1 ac t:6.7
2.3
Firm:1 ac t:94.7
6.6 ac t:2.1
Firm:7 ac t:61.4
s ei
L. c a ac t:22.5
Firm:5
3.4 ac t:11.7
1.7 ac t:8ntium
Firmicutes frequency distribution
Firm:5 B. de70.7
6.5
baseline and after three months in a group of 25 patients.

Firm:8 ac t: 8.4
Actinobacteria frequency distribution

4.8 ac t:66.4
Firm:5 ac t:85.0
btilis
B. s u ac t:89.3
Firm:3
3.0 ac t:83.1
Band classes
3.2 ac t:31.3
Firm:6 ac t:13.0
Band classes
1.2 ac t:48.1
Firm:1
and after three months in a group of 25 patients.

7.1 ac t:33.1
Firm:2 ac t:25.5
5.3
Firm:3 ac t:21.2
Firm:2
0.4 ac t:37.2
.2 ac t:52.3
Firm:6 ac t:66.8
4.0 ac t:33.7
Firm:1
6.1 ac t:60.5
Firm:3 ac t:54.1
7.3
Firm:5 ac t:37.1
0.3 ac t:23.3
Firm:1 ac t:8.2
4.1
Firm:3 ac t:72.0
.3
Firm:8 ntum ac t:56.3
gme ac t:58.7
L. fra ac t:29.5
1.4 ac t:60.7
Firm:6 i
s en ac t:60.7
L. jen ac t:46.2
8.4
Firm:4 ac t:66.2
Firm:2
2.6 ac t:45.1
7.1 ac t:4raelii
Firm:3 A . is42.1
7.2 ac t: 7.4
Firm:4
7.6 s s p. ac t:47.7
Firm:4 oc c u ac t:8.8
hy loc ac t:25.7
Stap
Firm:2
9.8 ac t:3 9.3
9.4 ac t:34.5
Firm:3 s ac t:44.2
tan ac t:58.6
S. mu .
1.1 ac t:5obium s ps a
Firm:2 A top ntoc ario
3.8 .
Firm:4 oc c us s p R. de 3.1
CHAPTER 4
us
toc ac t:6ontoly tic
Strep
A . odraelii
A . is
25
20
15
10
25
20
15
10
0
5
25
20
15
10
25
20
15
10
0
5
70
Frequency Frequency
Table 4.2. The median number of bands at baseline and at different time points after treatment,
the total number of bandclasses and the skewness of the frequency distribution of each band of
the profile in the total number of samples. (P) before treatment, (I) immediately, (A) 1 day, (B)
2 days, (C) 1 week, (D) 2 weeks and (G) three months after treatment. Results are obtained
with the universal (UNI), Cytophaga- Flavobacterium-Bacteriodes (CFB), Firmicutes (FIRM) or
Actinobacteria (ACT) specific primer sets.
P I A B C D G ba nd Sk e wne ss
c la sse s
UNI 20 21 17 17 17 17 20 134 1.63
CFB 15 14 14 14 13 14 13 109 2.02
FIRM 5 5 6 6 6 6 6 47 2.91
ACT 8 8 10 10 7 8 8 68 2.55
Table 4.3. The median Cs-value between different timepoints and baseline and the median Cs-
value between subsequent timepoints for the four primer sets tested. (P) before treatment, (I)
immediately, (A) 1 day, (B) 2 days, (C) 1 week, (D) 2 weeks and (G) three months after
treatment. Results are obtained with the universal (UNI), Cytophaga- Flavobacterium-Bacteriodes
(CFB), Firmicutes (FIRM) or Actinobacteria (ACT) specific primer sets.
Media n Cs-va lue between ba seline Media n Cs-va lue between subsequent
a nd a ny timepoint timepoints
P-I P-A P-B P-C P-D P-G I-A A-B B-C C-D D-G
UNI 50.0 35.7 29.3 34.0 34.5 41.5 46.5 57.1 48.0 47.4 50.0
CFB 55.8 39.1 30.3 27.6 32.4 33.3 52.6 51.6 41.4 35.7 41.2
FIRM 61.5 54.5 53.3 50.0 50.0 50.0 57.1 66.7 66.7 66.7 66.7
ACT 52.2 44.4 40.0 35.3 38.1 37.0 57.1 60.0 54.5 57.1 54.5
71
CHAPTER 4
Table 4.4. The number of fingerprints positive for a bandclass at baseline and after three months.
The time line dynamics are categorized as absent all the time, positive all the time, recolonization
(positive at baseline and after three months, but negative at any timepoint in between), colonization
(negative at baseline and positive thereafter), disappear (positive at baseline but negative after
three months), other (without a discriminative pattern) and intermediate colonization (negative at
baseline and after three months, but at least successive timepoint positive) and the distribution of
all fingerprints (25) over the bandclasses is presented. Results are obtained with the Cytophaga-
Flavobacterium-Bacteriodes (CFB), Firmicutes (Firm) or Actinobacteria (Act) specific primer sets.
Ba se- a fter Absent Positive Recolon- Coloni- disa ppea r Inter media te Other
line thr ee a ll the a ll the iz a tion z a tion coloniz a tion
months time time
Ba ndcla sses
T. forsythia 24 12 0 6 5 1 13 0 0
P. gingivalis 12 9 8 3 4 2 5 1 2
CFB-cluster :36.7 21 10 1 2 8 0 11 0 3
CFB-cluster :38.7 14 6 2 0 3 3 11 3 3
CFB-cluster :46.8 1 11 3 0 1 10 0 0 11
CFB-cluster :47.4 4 12 4 0 4 8 0 0 9
CFB-cluster :49.6 8 7 8 1 3 3 4 2 4
CFB-cluster :53.5 11 4 5 0 4 0 7 2 7
Streptococcus sp. 24 24 0 16 7 1 1 0 0
Fir m: 21.1 8 5 11 1 2 2 5 3 1
Fir m: 39.4 7 8 6 0 3 5 4 2 5
Fir m: 43.8 12 16 2 4 5 7 3 3 1
Fir m: 47.2 4 8 11 0 2 6 2 1 3
Fir m: 47.6 5 9 7 1 2 6 2 4 3
Fir m: 48.4 4 11 7 2 1 8 1 4 2
Fir m: 61.4 3 10 8 1 1 8 1 3 3
A. israelii 21 18 1 6 10 2 5 0 1
A. odontolyticus 20 20 0 13 4 3 3 1 1
R. dentocariosa 9 20 0 7 1 12 1 2 2
a ct: 54.2 8 12 1 1 3 8 3 6 3
a ct: 58.6 8 13 3 2 4 7 2 2 5
a ct: 61.3 1 9 8 0 0 9 1 4 3
a ct: 62.3 2 6 6 0 1 5 1 9 3
72
Table 4.5. The effect of FM-SRP and Q-SRP on the similarity in the composition of the microbial
population at different timepoints compared to baseline for the four primer sets tested. (P) before
treatment, (I) immediately, (A) 1 day, (B) 2 days, (C) 1 week, (D) 2 weeks and (G) three months
after treatment. Given are median values. Results are obtained with the universal (UNI), Cytophaga-
Flavobacterium-Bacteriodes (CFB), Firmicutes (FIRM) or Actinobacteria (ACT) specific primer sets.
P-I P-A P-B P-C P-D P-G
UNI FM-SRP 51.2 27.7 28.1 32.7 29.8 39.4
Q-SRP 50.0 48.6 29.3 37.3 36.4 42.3
CFB FM-SRP 58.3 35.9 20.5 17.1 30.6 28.3

]*
Q-SRP 55.8 52.6 32.0 37.5 36.4 37.0
FIRM FM-SRP 58.0 43.7 52.3 51.7 46.4 51.7
Q-SRP 66.7 60.0 53.3 44.4 50.0 44.4
ACT FM-SRP 55.2 25.4 35.0 27.9 30.1 32.5

]*
Q-SRP 47.6 50.0 40.0 38.5 53.3 40.0
* p<0.05
Table 4.6. The difference between clinical outcome (4 mm or >4 mm) on the similarity in the
composition of the microbial population at different timepoints compared to baseline for the four
primer sets tested. (P) before treatment, (I) immediately, (A) 1 day, (B) 2 days, (C) 1 week, (D) 2
weeks and (G) three months after treatment. Given are median values. Results are obtained with
the universal (UNI), Cytophaga- Flavobacterium-Bacteriodes (CFB), Firmicutes (FIRM) or Actinobacteria
(ACT) specific primer sets.
P-I P-A P-B P-C P-D P-G
UNI 4 mm 40.7 26.3 25.6 27.3 30.4 29.6
>4 mm 63.6
]* 50.6 30.3 39.4 35.4 50.9
CFB 4 mm 46.7 35.3 21.1 21.1 26.1 23.1

]* ]*
>4 mm 58.0 50.5 31.8 35.4 39.0 40.5
FIRM 4 mm 66.7 61.5 54.5 57.1 50.0 53.3
>4 mm 59.3 51.7 50.0 50.0 50.0 44.4
ACT 4 mm 40.7 40.0 40.0 28.6 28.6 40.0
>4 mm 52.8 45.6 40.0 39.2 44.5 34.0
* p<0.05
73
CHAPTER 4
DISCUSSION
The aim of the present study was to analyze the effect of periodontal treat-
ment, that is SRP, on the subgingival microbial population with DGGE. This tech-
nique has been introduced in oral microbiology (213) and benefits from the fact
that species comprising more than 1% of the total population can be detected
with universal primers (109). However, preferential amplification, gel heterogene-
ity and background staining may complicate gel analyses, especially the compari-
son between gels. Therefore markers were constructed to facilitate gel-gel
comparisons and to identify species. To circumvent quantitative artifacts due to
sampling, extraction or PCR differences between samples, gels were qualitatively
analyzed. Especially fingerprints obtained with a nested-PCR approach may not be
suitable for quantitative analyses. The microbial diversity in subgingival pockets
result in general in 20%-50% similarity between lanes from different subjects and
complicates statistical and pattern recognition analysis with universal bacterial
primers (89). In the present approach group-specific DGGE primer sets were used
to limit the risk of bands that contain multiple species. Moreover, by zooming in
on the population, its dynamics could be monitored in greater detail.
In the present study the universal, CFB, Firmicutes and Actinobacteria primer
sets detected 139, 109, 47 and 68 band classes representing different species,
respectively. Although the species diversity was large, their frequency distribution
was skewed, that is, a few species are present in virtually all samples and most
species are detected in only a limited number of samples. This is in agreement
with previous findings showing that 8.5% of the species account for >50% of
the microbiota (173).
After SRP, the detection frequencies of Streptococcus sp. A. israelii and
A. odontolyticus were only temporarily reduced. These species from the Firmicutes
and Actinobacteria are considered primary colonizers (79), have developed spe-
cialized adherence mechanisms (198) and are tightly attached to the tooth sur-
face. Moreover, they are adapted to colonize pristine tooth tissues which may
explain their rapid recolonization and the temporarily effect of SRP.
In the CFB population at baseline, only T. forsythia and CFB 36.7 were
present in almost every sample. After SRP, the frequency distribution became
more even and not a single species could be detected in more than 15 samples.
As has been hypothesized, some CFB species should be considered as colonizers
74
of already established biofilms. With a new biofilm to be established, different CFB

species may occupy the same niche in different pockets. Thereby not a single species
was able to colonize more that 30% of the pockets. An interesting observation in this
is the increased detection frequency of bands CFB 46.8 and 47.4 and the decreased
detection frequency of T. forsythia, P. gingivalis and CFB 36.7 after SRP. It can be
hypothesized that during the formation of a new biofilm, the first two species compete
with T. forsythia, P. gingivalis or CFB 36.7 to occupy the same niche.
The present study shows that clinical success, as defined by a pocket depth 4
mm, was accomplished with a CFB population that was significantly more different
from baseline than the CFB population in pockets >4 mm. The difference became
significant after three weeks, which corroborates previous data where significant
reduction in the pocket depth was correlated with a decrease in
P. gingivalis after two weeks (205). This raises the question how SRP itself
contributes to periodontal healing and the accompanied change in the CFB popu-
lation. SRP reduces the bacterial load (142), induces an immune response (28)
and this study shows that SRP disturbs the composition of the subgingival biofilm
population. It has been shown that genetic and environmental differences be-
tween individuals determine the efficacy of the immune response. Superimposed
on both the microbiological and immunological component, it has recently been
shown that the expression patterns of genes in gingival tissues is correlated with
certain bacterial species (128). Gingival healing may therefore be the result of the
complex interaction between these three. Once pocket depths have been reduced
to 4 mm, oral hygiene measures may prevent the maturation of biofilm formation
and thereby the colonization of CFB species. It seems therefore more likely that a
reduced pocket depth results in a CFB population less similar to baseline than vice
versa.
This study for the first time monitored the effect of SRP on the dynamics of
the subgingival population at different time points immediately after treatment and
shows that different microbial groups respond differently to SRP. In conclusion,
SRP does not result in the complete eradication of species but rather provokes
changes in the composition of the bacterial population. Firmicutes and Actinobacteria
population dynamics are comparable with initial biofilm formation on pristine tooth
surfaces, with the intermediate rise and decline of species and the return to baseline
population composition within three months. Therefore, no differences between
treatment modality or pocket depth was observed for these groups. SRP induces a
75
CHAPTER 4
change in the CFB population that lasts up to three months. This change was
significantly stronger for pockets 4 mm indicating that not the treatment
modality itself but the accompanied healing result determines the microbiological out-
come of SRP.
ACKNOWLEDGEMENTS
We thank Brigitte Dijkhuizen en Marjella Lans for skillfully running and ana-
lyzing numerous DGGE gels.
76
5
Oral biofilm architecture on
natural teeth
Zijnge V, van Leeuwen MBM, Degener JE,

Abbas F, Thurnheer T, Gmr R, Harmsen HJM
PLoS One (2010) 5: e9321.

ORAL BIOFILMS
SUMMARY
Periodontitis and caries are infectious diseases of the oral cavity in which oral
biofilms play a causative role. Moreover, oral biofilms are widely studied as model
systems for bacterial adhesion, biofilm development and biofilm resistance to an-
tibiotics, due to their widespread presence and accessibility. Despite descriptions
of initial plaque formation on the tooth surface, studies on mature plaque and
plaque structure below the gum are limited to landmark studies from the seven-
ties, without appreciating the breadth of microbial diversity in the plaque.
We used fluorescent in situ hybridization to localize in vivo the most abundant
species from different phyla and species associated with periodontitis on seven
embedded teeth obtained from four different subjects.
The data showed convincingly the dominance of Actinomyces sp., Tannerella
forsythia, Fusobacterium nucleatum, Spirochaetes and Synergistetes in subgingi-
val plaque. The latter proved to be new with a possibly important role in
host-pathogen interaction due to its localization in close proximity to immune
cells. The present study identified for the first time in vivo that Lactobacillus sp.
are the central cells of bacterial aggregates in subgingival plaque and that Strepto-
coccus sp. and the yeast Candida albicans form corncob structures in supragingival
plaque. Finally, periodontal pathogens colonize already formed biofilms and form
micro-colonies therein. These in vivo observations on oral biofilms provide a clear
vision on biofilm architecture and the spatial distribution of predominant species.
81
CHAPTER 5
INTRODUCTION
Oral microbial biofilms are three-dimensional structured bacterial communi-

ties (207) attached to a solid surface like the enamel of the teeth, the surface of
the root or dental implants (172) and are embedded in an exo-polysaccharide
matrix (139). Oral biofilms are exemplary and served as a model system for bac-
terial adhesion (16,20) and antibiotic resistance (212).
The appreciation of the complex nature of oral biofilms was highlighted
decades ago by the work of Listgarten and co-workers who described the archi-
tecture of biofilms by light and electron microscopy on epoxy resin crowns and
extracted teeth (93,94). Supragingivally, on the enamel, they observed the forma-
tion of columnar micro-colonies with their long axis perpendicular to the crown
surface. Gram-positive cocci dominated these columns and occasionally, some
isolated branching filaments were found after one day of growth. After one week
filaments appeared on top of the columns. After three weeks, the biofilm was
predominantly filamentous without any sign of cocci left. Filaments seemed to
have colonized and subsequently replaced the predominantly coccoid population.
A loose layer of so-called corncobs covered the three-week-old biofilm. Corncobs
were thought to be bacterial aggregates with a central filamentous cell surrounded
by cocci attached to it. After two months, the general features of the biofilm
resembled those found at the three weeks time point. Most noticeably was the
gingival area, where a fuzzy layer of spirochetes covered the biofilm. This fuzzy
layer contained bacterial aggregates resembling test-tube brushes. There were
rough and fine types of these brushes. In a study examining biofilm structure at
varying degrees of periodontal health, the gingivitis and periodontitis associated
biofilms resembled largely the two months old plaque on epoxy resin crowns.
Filamentous bacteria were predominant in the biofilm. Between the adhered biofilm
and the soft tissue of the pocket, a layer without a well-defined extracellular
matrix was observed. This layer consisted of spirochetes, flagellated bacteria and
test-tube brushes (94). The major hindrance of these electron microscopy studies
was the inability to identify the species in the biofilm, corncobs or test-tube brushes.
Using fluorescent in situ hybridization (FISH), it was shown for the first time
in vivo that initial biofilm formation was the result of co aggregation and adhesion
between Streptococcus spp. and Actinomyces spp. (126). In a later study with
82
ORAL BIOFILMS
the same technique, it was shown in vivo, that after seven days the proportion of
streptococci decreased and the proportion of Fusobacterium nucleatum increased
(2). Subgingival biofilms formed on expanded polytetrafluoroethylene carriers that
had been inserted into the depth of periodontal pockets have been studied with
FISH with only two probes, one with specificity for a large group of oral tre-
ponemes and the other recognizing all oral bacteria (196). The bacterial diversity
in the oral cavity is estimated to be more than 700 different species and phylotypes,
belonging to nine phyla; Deferribacteres, Spirochaetes, Fusobacteria, Actinobacteria,
Firmicutes, Bacteroidetes, Proteobacteria and two phyla without cultiviable mem-
bers; OP11 and TM7, which is summarized in Figure 5.1. Little is known about
the spatial distribution of these taxa in oral biofilms. The aim of the present study
therefore was to reveal the in vivo architecture of supra and subgingival plaque
with a panel of 16S or 18S rRNA targeted FISH-probes covering the most impor-
tant groups of oral microorganisms, and to provide an essential step from oral
microbial diversity to oral biofilm function.
Probename
Other
Lactobacillales
Streptococcaceae Strep493
Lactobacillaceae
LAB759
Firmicutes
Bacillales
Gram Acidaminococcaceae Selenomonas sp. Sel1469

positive Erysipelothrichaceae
Mycoplasmataceae
Clostridiales Parvimonas micra

Mmicros1435
Corynebacteriaceae
Actinomycetaceae
ACT218
Actinobacteria Bifidobacteriaceae
Other
Actinomycetales
Coriobacteriaceae
Alpha
Proteo Beta
bacteria
Gamma Aggregatibacter sp. Aa829
Delta
Epsilon Campylobacter sp. Camp655
TM7
Fnav1254
Figure 5.1. Phylogenetic tree representing oral
Fusobacteria Fusobacteriaceae F. naviforme Fus664
F. nucleatum Fnuc133c microbial diversity. The tree is based on
>1500 sequences derived from oral-cavity
Prevotellaceae P.P. nigrescens
intermedia Pi425
Pnig657 Prev394 studies and shows the schematic coverage
Gram
Pendo740 CFB935 of the diversity by our probe set. The
negative P. endodontalis
Porphyromonadaceae Tannerella sp. Tfor440, Tfor127, branching of the tree was simplified for clarity.
Bacteroidetes P. gingivalis
Tfor997, Tfor582 The boxes represent groups of bacteria. The
Other Bacteriodales Pg477
vertical size of the box reflect the number of
Flavobacteriaceae Capnocytophaga sp. Capno371 sequences and the angular side of the genetic
Td469 diversity. The blue boxes indicate the part
Spirochaetes Spirochaetaceae T.T. denticola Spiro1400
medium
TrepG1 that is covered by the species or sub-group-
Synergistetes
specific probes and the red box indicate
Synergistes group A
SynA1409 genus-specific probes.
83
CHAPTER 5
Sample collection and handling

Ten teeth from four patients were used in this study. The patients were
referred to the Dept. of Oral Surgery and Periodontology for extraction of their
remaining teeth and the fabrication of complete dentures. Teeth were diagnosed
with advanced generalized periodontitis based on pocket depth recordings of >6
mm and x-rays indicating more than 30% bone loss. Subjects had not taken
antibiotics within the last three months and did not suffer from systemic diseases.
An experienced dentist carefully extracted the teeth without the use of elevators,
not to disturb the subgingival plaque. Immediately after extraction, the teeth were
placed in 3% (wt/vol) paraformaldehyde (PFA) in phosphate-buffered saline (PBS)
(8 g of NaCl, 0.2 g of KCl, 1.44 g of Na2HPO4 and 0.24 g of KH2PO4 per liter; pH
7.2) and fixed at 4C for 16 h. Fixed teeth were dehydrated in 50%, 60%, 70%,
80%, 90% and 100% (vol/vol) ethanol-PBS in subsequent sessions of 1 hour.
Teeth were either stored in 60% (vol/vol) ethanol-PBS at -20C until further use
or processed immediately.
Sample processing
Fixed and dyhydrated teeth were carefully embedded in Technovit 8100
(Heraeus Kultzer GmbH) at 4oC. The embedded tissue was either cut transversal
or a combination of longitudinal and transversal (50/50) in cross-sections of 1 mm
with a water-cooled rotary saw. The embedded cross-sections were decalcified
with a 17% ethylene-diamine-tetraacetic acid decalcifying solution (pH 7.0), which
was renewed regularly during the course of decalcification, varying in duration
from 16 to 22 days depending on the size of the specimens. Regular x-ray analy-
sis confirmed completion of decalcification. Decalcified cross-sections were re-
embedded in Technovit 8100 and stored at 4oC. Sections of two micron were
obtained with a Tungsten carbide knife in a rotary microtome (Reichart-Jung) and
stretched on water. Stretched sections were mounted to polysine precoated glass
slides (Thermo Scientific) for FISH analysis.
84
ORAL BIOFILMS
FISH analysis
Oligonucleotide probes, labeled at the 5- and 3 end with fluorescein (FITC)
or at the 5- end with Cy3 were purchased from Eurogentec (Eurogentec, Maastricht,
the Netherlands). A set of 29 FISH probes, specific at the domain or group level
were used together with species-specific probes (Table 5.1.). The target bacteria
of probe LAB759 needed pre-treatment with Labmix (25 mM Tris-HCl pH 7.5, 10
mM EDTA, 585 mM sucrose, 5 mM CaCl2, 0.3 mg/ml sodiumtaurocholate, 0.1
mg/ml lipase and 2 mg/ml lysozyme) for 1 h at 37C. To enable probe penetra-
tion, other gram-positive targets needed lysozyme pre-treatment for 15 min at room
temperature with lysozyme buffer (2 mg/ml lysozyme, 100 mM Tris-HCl, pH 8.0) as
indicated in Table 5.1. Standard FISH procedures were followed with a hybridization
time of three hours and formamide concentration and hybridization temperature (46oC
or 50oC) according to the references (Table 5.1.), with the aim of achieving optimal
stringency and specificity. The biofilms were examined using a Leica DM RXA
microscope (Leica Mikroskopie). Filters were set to 500-540 nm for FITC and 570-
630 nm for Cy3. Images were obtained using 63 x (numeric aperture 1.0) oil immersion
objectives. Color micrographs were taken with a digital Canon EOS400 Camera,
transferred to an HP personal computer and processed using Photoshop 6.0 (Adobe)
without any qualitative changes to the raw images.
85
CHAPTER 5
Table 5.1. Oligonucleotide probe sequences, their targets and the hybridization conditions used in
this study. New probes developed in the present study have been designed with the ARB software
package (46) and tested against a panel of reference strains for specificity (ACT218, Aa829,
LAB759, Sel1469 and Fnav1254) or tested on subgingival plaque samples at increasing formamide
concentrations to define assay conditions for maximum stringency and optimal specificity (TrepG1,
Pendo740 and SynA1409). Probe LAB759 showed cross-reactivity with Eikenella corrodens and
not identified cocci. In the present study, only rods gave a positive signal with probe LAB759.
Ta r get Pr obe L a bel Sequenc e Tm Pr etr ea tment For ma mide Hyb. Refer ence
na me 5'-->3' (oC) (%) Temp.
(oC)
most Ba c te r ia EUB338 FITC/Cy3 GCT GCC TCC 55 No 0-50 50 (4)

CGT AGG AGT
Euka r ya EUK502 FITC ACC AGA CTT 52 No 15-45 50 (4)

GCC CTC C
GCC AAG GCT

Candida albicans CAAL Cy3 TAT ACT CGC 51 No 30 50 (73)
T
most GTT AGC CGT

Streptococcus STR493 FITC CCC TTT CTG 53 15 min 37 C 0 50 (43)
spp. a nd some G lysis buffe r
Lactococcus spp.
Lactobacillus sp., CTA CCC ATR

Ruminococcaceae LAB759 Cy3 CTT TCG AGC 59 60 min 37 C 35 46 This study
sp. a nd C la bmix
Pediococcus sp.
Parvimonas micra Mmic r os FITC GCC GCC GAT 64 No 0 50 (200)

1435 CTA ACC GCA
Selenomonas sp. CCA GTC ACC

but not S. Se l1469 Cy3 TTC CCC ACC 58 No 30-50 46 This study
sputige na
Synergistetes SynA Cy3 ACA CCC GGC 62 No 40-50 46 This study

gr oup A 1409 TCG GGT GGT
Actinomyces sp. ACT218 FITC CGA GCC CAT 57 15 min 37 C 0 50 This study
CCC CCA CCA lysis buffe r
most CTT GTA GTT

Fusobacterium sp. Fus664 FITC CCG CYT ACC 52 No 40 46 (51)
TC
F. naviforme, F. Fna v CTT CAC AGC

nucleatum subsp. 1254 FITC TTT GCG ACT 58 No 30 46 This study
fusiforme C
F. nucleatum, F. Fnuc GTT GTC CCT

periodonticum 133c FITC ANC TGT GAG 46 No 30 46 (51)
GC
subgr oup of the SPIRO CTC GGA TGG

Spirochaetaceae 1400 FITC TGT GAC GGG 60 No ND 50 (29)
CG
T. medium a nd GAT TCC ACC

Tr e pG1 Cy3 CCT ACA CTT 58 No 20-50 46 This study
T. denticola
CAT GAC TAC

T. denticola Td469 FITC CGT CAT CAA 56 No ND 50 (106)
AGA AGC
86
ORAL BIOFILMS
Table 5.1. (continued)
Ta r get Pr obena me L a be l Sequenc e Tm Pr etr ea tment For ma mide Hyb. Refer ence
5'-->3' (oC) (%) Temp.
(oC)
A. GGG CTA AAC

actinomycetem- Aa 829 FITC CCC AAT CCC 53 No ND 50 This study
comitans
Campylobacter Ca mp655 FITC CAT CTG CCT 57 No 30 46 (52)

sp. CTC CCT YAC
Cytophaga- CCA CAT GTT

Flavobacterium- CFB935 Cy3 CCT CCG CTT 54 No >40 50 (29)
Bacteroides GT
c luste r
Bacteroidaceae CCA ATG TGG

a nd BAC303 Cy3 GGG ACC TT 49 No 0 50 (103)
Prevotellaceae
Prevotella sp. Pr e v394 FITC GCA CGC TAC 56 No 25 46 (35)

TTG GCT GG
CTT TAC TCC

P. intermedia Pi425 FITC CCA ACA AAA 57 No 20 46 (181)
GCA GTT TAC
AA
TCC GCC TGC

P. nigrescens Pnig657 Cy3 GCT GCG TGT 64 No >40 46 (50)
A
GCG GAC TTA

T. forsythia Tfor 582 Cy3 ACA GCC CAC 64 No 40 46 (215)
CT
CGT ATC TCA

T. forsythia Tfor 440 Cy3 TTT TAT TCC 52 No 20 46 (181)
CCT GTA
CTC TGT TGC

T. forsythia Tfor 127 Cy3 GGG CAG GTT 65 No 40 46 (215)
AC
T. forsythia Tfor 997 Cy3 TCA CTC TCC 56 No 40 46 (215)

GTC GTC TAC
CAA TAC TCG

P. gingivalis Pg477 FITC TAT CGC CCG 56 No 20 46 (181)
TTA TTC
P. endodontalis Pe ndo Cy3 CAG TGT CAG 58 No 30-40 46 This study

740 ACG GAG CCT
Capnocytophaga Ca pno FITC TCA GTC TTC 54 No 0 50 (71)

ge nus 371 CGA CCA TTG
87
CHAPTER 5
RESULTS
From 10 examined teeth, seven showed a positive signal after hybridization

with fluorescently labeled probes. Macroscopic analysis of Gram-stained sections
revealed the localization of the plaque in relation to the cemento-enamel junction
and gingival tissue. A phylogenetic tree based on approximately 1500 nearly com-
plete (>1300 bp) sequences was constructed. Sequences were derived from
molecular studies of oral microbial diversity and a manual search through the
SILVA database (133). The coverage of the applied probes is represented in
Figure 5.1. It shows that a representative part of the oral microbial diversity is
covered.
Subgingival biofilm architecture

The localization of the most abundant subgingival bacteria is summarized in
Figure 5.2. Panel A shows a typical subgingival biofilm with increasing fluorescent
intensity from the tooth side towards the epithelium side. Based on differences in
bacterial morphologies and fluorescence intensities, four different layers were dis-
tinguished. The first layer of the biofilm is composed of cells displaying little
fluorescence relative to cells in the top of the biofilm. Of all the probes tested, only
Actinomyces sp. gave a positive signal in this layer. The intermediate layer is
composed of many spindle-shaped cells of which F. nucleatum, T. forsythia and
possibly other Tannerella sp. positive with probe Tfor127 are visible as the red/
yellow band of bacteria in panels E and F of Figure 5.2. The top layer of the biofilm
and part of the intermediate layer contain mainly bacteria belonging to the
Cytophaga-Flavobacterium-Bacteroides cluster (CFB-cluster) as detected with probe
CFB935 and shown in panel D. CFB935 positive cells are filamentous, rod-shaped
or even coccoid. Samples double stained with CFB935 and Tannerella-specific
probes showed that most filamentous bacteria are Tannerella sp., while many of
the rod-shaped bacteria are Prevotella sp. and Bacteroidetes species as detected
with the group-specific probes PREV392 and BAC303, respectively. Besides the
presence of bacteria from the CFB-cluster, large cigar-like bacteria were in the top
layer. These cells belong to the Synergistetes group A of bacteria and form a
palisade-like lining. They were in close contact to eukaryotic cells resembling
polymorphonuclear leukocytes (PMNs) according to the presence of polymorph
nuclei (panel C). Outside the biofilm, a fourth layer without clear organization was
88
ORAL BIOFILMS
observed. Spirochaetes were primary localized in the fourth layer where they are the
most dominant species. Bacterial aggregates, called rough and fine test-tube brushes
were detected between the Spirochaetes (Panel B and Figure 5.5.).
Supragingival biofilm architecture

Supragingival biofilms are more heterogeneous in architecture compared to
subgingival biofilms. In general, two different layers could be observed. The basal
layer adheres to the tooth surface and four different biofilm types were observed
(Figure 5.3.). First, a biofilm composed of only rod shaped Actinomyces cells
perpendicularly orientated to the tooth surface (panel D). The second type is a
mixture of Actinomyces sp. and chains of cocci, not identified as streptococci,
perpendicularly orientated to the tooth surface (panel E). The third type shows a
biofilm with filamentous bacteria, streptococci and yeasts, where streptococci
form a distinct colony around yeast cells (panel F). The fourth type is a biofilm
composed of mainly streptococci growing in close proximity to Lactobacillus sp.
that are orientated perpendicularly to the tooth surface (panel G).
The second layer can be found on top of any biofilm type of the basal layer.
Streptococcus sp. can be present as heterogeneously scattered cells through the
second layer of the biofilm without any apparent organization (panel A3), or they
can be aligned on top of the second biofilm layer as a thin coat (panel A1). In
addition, they colonize cracks in the biofilm (panel A2). Also, there is a heteroge-
neous scattering of bacterial cells belonging to the CFB-cluster (panel B). Finally,
Lactobacillus sp. that are orientated away from the tooth surface are surrounded
by cells with different morphologies (panel C).
Subgingival localization of periodontal pathogens

The localization of presumptive periodontal pathogens in the subgingival biofilm
is shown in Figure 5.4. Most of the periodontal pathogens belong to the gram-
negative group of bacteria united in the CFB-cluster like P. gingivalis, P. intermedia,
P. endodontalis or P. nigrescens. Most CFB-cluster cells are evenly distributed in
the top and intermediate layer of the biofilm. Prevotella sp. however, colonize the
biofilm in micro-colonies (panel A) which sometimes are located on top of the
biofilm, but, as is shown for P. intermedia, also reside within the top layer
(panel E). P. gingivalis and Porphyromonas endodontalis appear mainly as micro-
colonies within the top layer (panel C and D). Parvimonas micra, an example of a
89
CHAPTER 5
gram-positive species that is associated with periodontitis, is also found in micro-

colonies in the top layer (panel B). Apparently, the microorganisms considered
pathogens are mostly present in micro-colonies in the top layer and in the fourth
layer of the subgingival biofilm or can be part of bacterial aggregates.
Bacterial aggregates or structures in dental plaque

Aggregates of microorganisms have been detected in both sub and supra
gingival plaque (Figure 5.5.). In line with previous reports, different aggregate
morphologies were observed in the fourth layer of subgingival plaque. Filaments
from the CFB-cluster, morphologically like T. forsythia, and F. nucleatum are ar-
ranged perpendicularly around lactobacilli, forming fine test-tube brushes (panel
A-C). There have also been observations of test-tube brushes composed of a
complex mixture of cells with T. forsythia, Campylobacter sp., P. micra, Fusobac-
teria and Synergistetes group A, among others. Synergistetes cells may also form
aggregates exclusively with themselves (panel D and E). In supragingival plaque,
corncob structures consist of streptococci adhering to a central axis of yeast cells
or hyphae.
90
ORAL BIOFILMS
Figure 5.2. Localization of the most abundant species in subgingival biofilms. (A) Overview of
the subgingival biofilm with Actinomyces sp. (green bacteria), bacteria (red) and eukaryotic
cells (large green cells on top). (B) Spirochaetes (yellow) outside the biofilm. (C) Detail of
Synergistetes (yellow) in the top layer in close proximity to eukaryotic cells (green). (D) CFB
cluster (yellow) in the top and intermediate layer. (E) F. nucleatum in the intermediate layer. (F)
Tannerella sp. (yellow) in the intermediate layer. Each panel is double-stained with probe
EUB338 labeled with FITC or Cy3. The yellow color results from the simultaneous staning with
FITC and Cy3 labeled probes. Bars are 10 m.
91
CHAPTER 5
Figure 5.3. Localization of the most abundant species in supragingival biofilms. Streptococcus
sp. (yellow) form a thin band on top of the biofilm (A1), almost engulfing in the biofilm (A2) or
present as small cells scattered through the top layer of the biofilm (A3). (B) Cells from the
CFB cluster of bacteria in the top layer of the biofilm, without defined structure. (C) Lactobacillus
sp. (red) forming long strings through the top layer. (D) Actinomyces sp. (yellow) plaque
attached to the tooth. (E) Actinomyces sp. (green) and cocci forming initial plaque.(F) Multispecies
initial plaque composed of Streptococcus sp. (yellow), yeast cells (green) and bacteria unidentified
(red). (G) Streptococcus sp. (green) and Lactobacillus sp. (red) forming initial plaque. Black
holes might be channels through the biofilm. Panels A, B, C, E, F are double stained with probe
EUB338 labeled with FITC or Cy3. Bars are 10 m.
92
ORAL BIOFILMS
Figure 5.4. Localization of species associated with periodontitis. (A) Overview of the subgingival
biofilm with CFB-cluster species (red) and Prevotella sp. (yellow). Since Prevotella sp. are part of
the CFB cluster of bacteria, cells appear in yellow. (B) Top of the biofilm with a micro-colony of P.
micra (yellow). (C) Micro-colonies of P. gingivalis (yellow) in the top layer. (D) Micro-colonies of P.
endodontalis (yellow) in the top layer. (E) Micro-colonies of P. intermedia in the top layer. Panels B,
C, D and E are double stained with probe EUB338 labeled with FITC or Cy3. Bars are 10 m.
93
CHAPTER 5
Figure 5.5. Bacterial aggregates in oral plaque. (A) Transversal view of a test-tube brush found
in subgingival plaque composed of filamentous cells from the CFB cluster. (B) Tannerella sp.
(yellow) in a test-tube brush. (C) Longitudinal view of a test-tube brush with Lactobacillus sp.
(red rods) as central structures. F. nucleatum (green) and CFB-cluster filaments radiating from
the central structures. (D) Longitudinal and transversal view of a test-tube brush stained with
the eubacterial probe. (E) Transversal view of the test-tube brush in panel D, composed of
Synergistetes group A species. (F) Transversal view of Streptococcus sp. (green) aggregation
around a central cell (not stained) in supragingival plaque. (G) Transversal view of supragingival
plaque with Streptococcus sp. (green cocci) and Candida albicans (green hyphae) in the top
layer of the biofilm and forming corn cob structures growing outwards. Bars are 10 m.
94
ORAL BIOFILMS
DISCUSSION
The aim of the present study was to unravel tooth attached biofilm architec-
ture. For the first time, bacteria in these biofilms are identified and localized in vivo
using FISH. The results present new insights into the architecture of tooth-at-
tached biofilms and visualize the interaction of the biofilm with the human immune
system. FISH offers the opportunity to obtain positional information of bacteria in
intact biofilms, its application overcomes the limits of culturability and can rela-
tively easily be extended to new identified species and phylotypes. Synergistetes
sp. for example, only recently gained attention (59) but may account for 3-11% of
the bacterial population (189). In addition, they form a palisade-like lining along
the outer length of the biofilm and were in direct contact with host immune cells
suggesting an important role in host-biofilm interactions.
In our current experimental design, group-level probes and species-specific
probes were applied to efficiently identify cells that might be of interest due to
their location in the biofilm, this was seen with Lactobacillus sp. as the central
axis of test-tube brushes and streptococci and Candida as species that form corn-
cobs in supragingival plaque.
Understanding the role of microorganisms in oral diseases needs a unifying
concept incorporating biofilm diversity, structure and function. A first oral biofilm
model was based on co-aggregation experiments (79). The model presents a final
composition of the biofilm, without taking into consideration the spatio-temporal
dynamics of biofilm formation. The figures of the present study are composed of
consistent observations from hundreds of thin sections from seven different teeth
of four different persons. Each observation provides only a snap shot of plaque
architecture without quantitative measurements or dynamic time lap observations.
Combining multiple observations of supra- and subgingival biofilms reflects to
some degree the dynamics of biofilm formation, which leads us to the following
view of plaque formation.
Initial plaque formation starts with the deposition of a salivary pellicle on the
tooth surface. Planktonic cells or aggregates of cells adhere to this pellicle via
specialized adhesins on the bacterial cell surface that recognize pellicle proteins
(211) and by non-specific physico-chemical interactions (20). These phenomena
may result in a scattered pattern of bacterial deposits (35,126) composed of initial
colonizers like Actinomyces sp., Streptococcus sp., Lactobacillus sp. and Candida sp.
95
CHAPTER 5
(36, 57, 92) and is reflected in the different biofilm types of the first layer of supra
gingival plaque (Figure 5.3.). Maturation of the biofilm proceeds via co-aggregation of
planktonic bacteria to the already adhered biofilm (81) and bacterial growth, as has
been shown for Streptococcus sanguis (85). The second layer may be the result of
both processes. The presence of either Streptococcus sp. or bacteria from the CFB-
cluster in the second layer of Figure 5.3. may reflect a crucial transition in supragingival
plaque from a predominantly gram-positive saccharolytic plaque to a gram-negative
proteolytic plaque that might be the result of the availability of nutrients e.g. dietary
sugars or proteins from saliva and crevicular fluids. It was noticed that after three
weeks, undisturbed supragingival plaque morphologically resembled subgingival plaque
(93). In our observations of subgingival plaque, the fluorescent intensity of the bacterial
cells stained with the eubacterial probe increased from the tooth side towards the
epithelium. This reflects differences in physiological activity of the cells (107). In the
basal layer of Figure 5.2., only Actinomyces sp. showed positive of all the probes
tested. The unidentified cells may belong to new species for which no probes have
been developed. Another explanation might be that the basal layer constitutes previous
stages of the biofilm that have become secluded from nutrients and contain dead or
physiologically inactive cells with lower fluorescent intensity as has been shown in
vitro (10,112). Of the initial colonizers, only Actinomyces sp. might survive, maybe
due to their capacity to store intracellular glycogen (184) or their capacity to scavenge
on biofilm material like extracellular polymeric substances and on compounds from
dead bacterial cells. These are the first in vivo observations of graduated differences
in the physiological activity of cells within the biofilm, and support the idea that bacterial
growth is an important determent of oral biofilm development (54).
In the intermediate layer, T. forsythia may benefit from its close proximity to
dead cells in the basal layer. These may serve as a source of exogenous N-acetyl-
muramic acid, a bacterial cell wall sugar on which T. forsythia is dependent (208).
In the presence of F. nucleatum, T. forsythia synergistically forms robust biofilms
via cell-cell contacts in vitro (160) as is reflected in their prominent and abundant
co-localization of both species along the entire length of the biofilm. The presence
of F. nucleatum in the intermediate layer, as proposed by Kolenbrander and Lon-
don (79), is confirmed for the first time in vivo in the present study. These struc-
tural observations on the dominance of Actinomyces sp., Fusobacteria and
T. forsythia are supported by dot-blot analysis of subgingival plaque (173). In con-
trast, P. gingivalis, P. intermedia, P. endodontalis and P. micra are mainly located in
96
ORAL BIOFILMS
the top layer of the biofilm in micro-colonies (114,115). The presence of micro-colonies
proposes a distinction between species that are structurally present, probably forming
the framework of the biofilm, and transient species that can colonize the already
established biofilm forming micro-colonies.
Summarizing, the present study on oral biofilms links early studies on biofilm
structure and recent molecular insights in oral bacterial diversity. This resulted in
important new observations on oral biofilms, in architecture and in dynamics.
First, the species that form test-tube brushes and corncobs are identified for the
first time in vivo. Second, the localization of T. forsythia in the intermediate layer
of oral biofilms should be incorporated in the biofilm model, as well as a fourth
layer of unattached plaque consisting of mainly Spirochaetes. Third, the observa-
tion of bacteria that are either structural members of the subgingival biofilm, e.g.
Actinomyces, Fusobacteria, Tannerella sp., or species that colonize an already
formed biofilm, e.g. P. intermedia, P. gingivalis and P. micra. Fourth, the biofilm
model based on co-aggregation should include bacterial growth and appreciate
the dynamics of biofilm maturation. Finally, the finding of a palisade lining of
Synergistetes sp. in the close proximity to host defence cells suggests a major
role in host biofilm interactions. These results provide an oral biofilm model and
show that in vivo observations on biofilm architecture are an essential link be-
tween molecular diversity and bacterial function in relation to oral diseases.
ACKNOWLEDGEMENTS
We thank Helga Lthi-Schaller for laboratory assistance and Rudi Tonk for
the microscope set-up. Linda Wildeboer-Veloo is gratefully acknowledged for vali-
dation of probe ACT218.
97
6
The recolonization hypothesis
in a full-mouth or quadrant-
wise treatment protocol; a
blinded, randomised clinical trial
Zijnge V, Meijer HF, Lie MA, Tromp JAH,

Degener JE, Harmsen HJM, Abbas F
Accepted for publication in the

Journal of Clinical Periodontology
FM-SRP VS MS-SRP PERIODONTAL TREATMENT OUTCOME
SUMMARY
To test recolonization of periodontal lesions after full-mouth SRP (FM-SRP) or

multiple session-SRP (MS-SRP) in a randomized clinical trial and whether FM-SRP
and MS-SRP result in different clinical outcomes.
39 subjects were randomly assigned to FM-SRP or MS-SRP groups. At baseline
and after 3 months probing pocket depth (PPD), plaque index (PlI) and bleeding on
probing (BoP) were recorded. At baseline, immediately after treatment, after 1, 2,
7, 14 and 90 days, paper point samples from a single site from the maxillary right
quadrant were collected for microbiological analysis of 5 putative pathogens by
PCR.
FM-SRP and MS-SRP resulted in significant reductions in PPD, BoP and PlI and the
overall detection frequencies of the 5 species after 3 months without significant
differences between treatments. Compared to MS-SRP, FM-SRP resulted in less
recolonization of the 5 species, significantly for Treponema denticola, in the tested
sites.
FM-SRP and MS-SRP result in overall clinically and microbiologically comparable
outcomes where recolonization of periodontal lesions may be better prevented by
FM-SRP.
101
CHAPTER 6
INTRODUCTION
Periodontitis is an infectious, chronic and multifactorial inflammatory disease

that affects the tooth-supporting tissues. Severe periodontitis can ultimately re-
sult in tooth loss. Bacteria associated with periodontal diseases are mainly Gram-
negative species belonging to the phyla of the Bacteroidetes, Fusobacteria and
Spirochetes (173). Besides the microbiological component, risk factors associated
with the disease include behavioral factors such as stress and smoking as well as
genetic traits (76,188). Non-surgical mechanical scaling and root planing (SRP)
aims to reduce the total bacterial load and to remove periodontal pathogens from
the subgingival area. Quadrant-wise SRP (Q-SRP) is usually performed in 4 or
more subsequent sessions with weekly intervals. Together with oral hygiene in-
structions, SRP is the treatment of choice for an effective cause-related periodon-
tal therapy (24). Improved clinical periodontal conditions have been associated
with reduction of the total supra- and subgingival bacterial load including spiro-
chetes and Capnocytophaga species (167), the percentage of sites positive for
Prevotella intermedia, Tannerella forsythia and Treponema denticola (30) and a
prolonged suppression of Aggregatibacter actinomycetemcomitans, Porphyromonas
gingivalis and P. intermedia (161). Van der Velden et al. (192) and van Winkelhoff
et al. (204) showed that periodontal pathogens could also be detected on the
dorsum of the tongue and the oral mucosa. Together with the suggested translo-
cation of bacteria from one site in the oral cavity to another, it was hypothesized
that in between the subsequent sessions of Q-SRP, previously treated quadrants
could be reinfected by bacteria from not yet treated quadrants (53,135,137).
Based on this reinfection hypothesis, the full-mouth disinfection protocol
(FMD) was introduced by Quirynen et al. (134) and included full mouth SRP (FM-
SRP) within 24 hours. Furthermore, additional disinfection was sought by tongue
brushing with chlorhexidine gel (1%), rinsing with chlorhexidine 0.2% twice daily
and subgingival irrigation with 1% chlorhexidine gel.
The clinical outcome of the traditional Q-SRP and FM-SRP or FMD has been
compared in several studies ( 6,69,82,134,138,182,197). Recently, a meta-analysis
by Eberhard et al. (39) showed only differences in the weighted mean differences
(WMD) between FMD and Q-SRP of 0.53 mm for PPD and 0.33 mm for clinical
attachment level (CAL) in favour of FMD. When comparing FMD with FM-SRP the
WMD for CAL amounted 0.74 mm in favour of FM-SRP. The included studies
102
differed however in study design i.e. FMD or FM-SRP vs Q-SRP, included both smokers
and non-smokers (6,69,138,197). Only the studies performed by Koshy et al. (82),
Wennstrm et al. (197) and Jerve-Storm et al. (69) showed a low risk of bias based
on randomization, allocation concealment, blinding and completeness of follow up (39).
Finally, only the studies of Wennstrm et al. (197) and Jerve-Storm et al. (69) were
powered to detect predefined statistical differences in treatment outcomes. The
presented literature shows that, within the limitations of the studies, FMD and FM-
SRP and Q-SRP show minor differences in clinical treatment outcome. However,
outcome of clinical trials do not prove nor deny the hypothesis of reinfection of treated
periodontal pockets by bacteria. In the study of Quirynen et al. (134), a significant
better reduction in the number of pathogens was observed in the FMD group 1 month
after treatment. Other authors have not been able to show additional microbiological
effects of FM-SRP over Q-SRP alone (5,70,82) nor with the addition of povidone
iodine (82) or with subgingival irrigation with chlorhexidine gel, tongue brushing with
chlorhexidine gel for 1 min and post-treatment rinsing daily with chlorhexidine (182)
by PCR. In addition, RT-PCR analysis revealed no microbiological differences between
the different treatment modalities after 1 day, and 1, 2, 4, 8, 12, or 24 weeks (70).
However, microbiological samples from different pockets were pooled and/or taken
months after treatment (5,15,82,134,182). The aim of the present study is therefore
to test recolonization of periodontal lesions after FM-SRP or multiple session-SRP
(MS-SRP) in a randomized clinical trial and test whether FM-SRP and MS-SRP result in
different clinical outcomes.
Experimental design and patient selection

The patients in this study were referred to a private clinic for periodontology
in Groningen. After recording probing pocket depth (PPD), bleeding on probing
(BoP), levels of supragingival plaque, presence of furcation lesions and medical
history of the patient, an external examiner (VZ) selected 44 patients who where
eligible and fit the inclusion criteria. Patients diagnosed with chronic periodontitis,
aged 25-75 years and with more than 16 teeth and more than 10% of the sites
with PPD 6 mm were candidates for inclusion. Patients were not admitted to the
study if any of the following criteria were present: (1) smokers and former smokers
103
CHAPTER 6
who stopped less than 5 years ago, (2) use of local or systemic antibiotics 3 months
prior to the study, (3) removable partial dentures, (4) pregnancy or lactation, (5) presence
of systemic diseases requiring drug therapy (6) periodontal treatment within the past
5 years. Patients participated in the study based on informed consent. The patients
were stratified for the two trained and experienced (8 years) oral hygienists who
performed the treatment. The clinical protocol and the time points for microbiological
sampling are shown in Figure 6.1.
The hygienists were instructed to start periodontal treatment in the maxillary
right quadrant (test-quadrant), in order to obtain the highest level of operator
blinding and prevention of an operator bias. When the treatment was finished, a
second independent person informed them whether they had to continue the treat-
ment in the other quadrants (FM-SRP) or continue treatment in another session
(MS-SRP), based on a computer generated randomization table. After 3 months
the patients were examined by a periodontist. All study personnel was blinded to
treatment assignment for the duration of the study. The research protocol was
approved by the Ethical Committee of the University Medical Center Groningen.
Baseline examination
44 patients assed for
eligibility
5 excluded (refused to
participate)
Enrollment
Stratification for oral

MS-SRP hygienist
FM-SRP
39 randomly allocated
n=20 n=19
First quadrant SRP Full-Mouth SRP
OH-instruction OH-instruction
Sampling before and After Sampling before and After
n=20 n=19
1 day sampling 1 day sampling
n=20 n=19
2 day sampling 2 day sampling
n=20 n=19
1 week 1 week
SRP, OH-instruction, OH-instruction,
sampling sampling
n=20 n=19
2 weeks 2 weeks
SRP, OH- instruction SRP, OH- instruction
sampling sampling
Figure 6.1. Flowchart of the study outline. Of
n=20 n=18 the 44 eligible patients, 5 refused to participate.
3 months re-examination 3 months re-examination One of the 39 enrolled patients decided to exit
sampling
termination of the study
sampling from the study before the re-examination session.
termination of the study
This patient was enrolled to the FM-SRP group.
104
TREATMENT
FM-SRP
The patients that were assigned to the FM-SRP protocol received a full mouth
subgingival debridement with manual periodontal curettes (Hu-Friedy Manufactur-
ing Co., Chicago, IL, USA) in a 3 hours single session. Treatment was performed
under local anesthesia on patients request. Patients received standard oral hy-
giene instructions including tooth brushing and inter-dental plaque control by
inter-dental brushes. 1, 2, 7 and 14 days after treatment patients returned to the
clinic for microbiological sampling. At day seven and fourteen the oral hygiene
instructions were reinforced.
MS-SRP
The patients assigned to the MS-SRP protocol received subgingival debride-
ment with manual periodontal curettes (Hu-Friedy Manufacturing Co., Chicago,
IL, USA) in 3 sessions of 1 hour at 1 week intervals according to the protocol of
the clinic. Treatment was performed under local anesthesia on patients request.
The first quadrant was always treated in the first session. The rest of the dentition
was divided in 2 equal portions and treated in the 2 consecutive sessions. 1 and 2
days after the first treatment patients returned to the clinic for microbiological sampling.
At each treatment session, microbiological samples were collected and patients
received standard oral hygiene instructions including tooth brushing and inter-dental
plaque control by inter-dental brushes.
Clinical measurements
Before treatment and 3 months (3.5 months for the test-quadrant in the MS-
SRP group) after completion of the treatment, clinical parameters were assessed
by a blinded examiner. Probing pocket depth (PPD) to the nearest millimeter was
assessed at 6 sites per tooth with a manual probe (PCP-UNC 12, Hu-Friedy Manu-
facturing Co., Chicago, IL, USA), bleeding on probing (BoP) (191) and plaque
index (PlI) (162) were recorded. According to the practice protocol, pockets mea-
suring <3 mm were considered healthy and not recorded.
105
CHAPTER 6
Microbiological sampling
In each quadrant a single pocket with PPD 6 mm on a single rooted tooth was
selected by the external examiner. Microbiological samples from this specific tooth in
the test-quadrant were collected at 7 timepoints in the test-quadrant: before treatment,
immediately after SRP, 1 day, 2 days, 1 week, 2 weeks and 3 months after treatment.
The other quadrants were sampled before treatment, immediately after treatment
and after 3 months. After removal of supragingival plaque and the isolation of the site
with cotton rolls, sampling was performed with a single sterile paperpoint (ROEKO,
size M) which was left in place for 20 s. Samples were collected in coded screw-cap
tubes and transported to the laboratory and stored at -200C until further processing.
DNA extraction
DNA was extracted according to the extraction protocol of Zijnge et al. (214)
with minor modifications. 200 l of demineralized H20 and 4 glass beads were
added to the tubes with the paper points. After homogenizing thoroughly for 5 s
using a vortex, 3 cycles of freeze-thawing at -80C for 15 min and 5 min at 80C
were performed. Subsequently, the samples were incubated for 1 hour at 37C
with 10 l lysozyme (40 mg/ml), followed by an incubation for 1 hour at 58C
with 100 l lysis buffer (10% SDS, 0.2 mg/ml proteinase K). Proteinase K was
inactivated by incubation at 80C for 10 min. For DNA isolation 200 l phenol and
200 l chloroform/iso-amylalcohol (24:1 v/v) were added to the samples. The
samples were centrifuged for 5 min at 14,000 g. A second phenol/chloroform/iso-
amylalcohol extraction was performed on the aqueous phase and centrifugation,
DNA was precipitated from the aqueous phase with 1/10 v/v 3M sodium acetate
(pH 5.2) and 2.5 times v/v 96% ethanol at 20C overnight. After centrifugation
for 15 min at 14,000 g, the supernatant was discarded and the pellet washed
twice with 100 ml 70% alcohol. After centrifugation for 15 min at 14,000 g, the
supernatant was removed. The pellet was dissolved in 50 ml sterile TE buffer and
stored at 20C.
Species-specific PCR
PCR for the detection of P. gingivalis (Pg), A. actinomycetemcomitans (Aa),
T. forsythia (Tf) and T. denticola (Td) was performed according to Zijnge et al.
(214). For the detection of F. nucleatum (Fn) the primers Fn607-
GCGCGTCTAGGTGGTTATGTAA and Fn1060-CTGTCTTTAGGTTTCCCCGAAG
106
were developed using the ARB software package (98). These primers were optimized
and tested for sensitivity and specificity with strain F. nucleatum ATCC 25586 and
against a panel of reference strains with the PCR protocol by Zijnge et al. (214) for
species-specific PCR. For the PCR reactions, the limit of detection was 50 cells.
Statistical analysis
The clinical hypothesis to test is whether FM-SRP and MS-SRP results in
different reductions in PPD. The primary response variable is therefore probing
pocket depth (PPD). According to Wennstrm et al. (197) 20 patients in each
treatment group were required based on an expected mean difference in PPD
between groups of 0.5 mm and a common standard deviation of 0.6 mm. During
the course of the study, a meta-analysis by Eberhard et al. (39) prcised the
expected mean difference in PPD between the two treatment groups to 0.53 mm.
With a common standard deviation of 0.6 mm, the error predefined to 0.05 and
the -error to 0.2, a power analysis for a two tailed t-test for independent means
revealed that in each group 22 patients were required. In all tests the patient was
set as the experimental unit. Change in BoP and PlI was defined as the percentage
of sites that were positive at baseline and negative for respectively bleeding and
visible plaque after 3 months. The percentage of healthy pockets is defined as the
percentage of the pockets for which PPD 5 mm at baseline were reduced to PPD
3 mm after 3 months.
Within group changes in PPD between baseline and after 3 months were
tested with a paired two tailed t-test. Differences in PPD between FM-SRP and
MS-SRP were tested with a two tailed t-test for independent means. Pockets
measuring less than 3 mm after 3 months were set to 3 mm to be able to calculate
an average PPD.
Within group differences in BoP and PlI between baseline and after 3 months
were tested with the non parametric Wilcoxon test while differences between FM-
SRP and MS-SRP were tested with the non parametric Mann-Whitney test.
Within group changes for the detection the 5 species between baseline and
after 3 months were tested by the non parametric McNemar test while differences
between FM-SRP and MS-SRP were tested with the non parametric Mann-Whitney
test.
Timeline bacterial results of the test-quadrant pocket were categorized into
predefined categories. Success was defined as when a pocket was positive for a
107
CHAPTER 6
species at baseline and continuously became negative for that species after treatment
until the end of the study. Failure was defined as when a pocket was positive for
that a species at every timepoint. Recolonization was defined as when a positive
pocket that became negative for a species and showed positive thereafter in the
course of the study. Neutral was defined as pockets that were negative for a
species and remained negative during the study. Only pockets with baseline values
that could possibly result in Success, Failure or Recolonization were considered
for statistical analysis. Differences in category distribution between FM-SRP and MS-
SRP were tested for by the 2-test except when expected counts were less than 5
where Fishers exact test was used. The level of significance was set to p<0.05.
The SPSS 15.0 software package (SPSS Inc., Chicago, IL, USA) was used for
data handling and statistical testing.
Table 6.1. Demographic and baseline characteristics of the patients
Pa tient FM-SRP Q-SRP
No. of subjects 18 20
Age (yea r s) 47 9 54 10.2
No. of ma le: fema le 10:8 12:8
No. of teeth 27.5 1.5 27.2 1.9
108
RESULTS
Study descriptives
Between September 2007 and December 2008, 44 patients were recruited that
fulfilled the inclusion criteria. Of the patients who attended the baseline examination
5 refrained to participate and 1 person, originally assigned to the FM-SRP group,
dropped out 10 weeks after treatment for financial reasons. In total, 38 patients
completed follow up of the study. This resulted in a power of 0.75, which is the
probability that this study rejected a false hypothesis. Demographic characteristics
are summarized in Table 6.1. There were no significant differences between FM-SRP
and MS-SRP groups for baseline values of PPD, BoP and PlI in the whole mouth.
There was only a significant difference in PPD of deep pockets in the test-quadrant at
baseline (Table 6.2.). There were no reports of adverse events or severe side effects
of both treatments.
Clinical effects of treatment

The results of the test-quadrant and whole mouth analyses showed no signifi-
cant clinical differences within each treatment group (data not shown), and whole
mouth results were used for hypothesis testing. In general, both FM-SRP and MS-SRP
resulted in significant reductions in PPD compared to baseline values. There were no
significant differences in PPD reduction between FM-SRP and MS-SRP (Table 6.3.).
This result was confirmed by the absence of a significant difference between FM-
SRP and MS-SRP with respect to the percentage of pockets initially measuring 5 mm
and which were reduced to 3 mm and considered healthy or remained 5 mm after 3
months. FM-SRP and MS-SRP showed significant improvements after 3 months in
BoP and PlI, without significant differences between FM-SRP and MS-SRP (Table
6.3.).
Microbiological effects of treatment

Microbiological observations in the test-quadrant showed that FM-SRP and
MS-SRP resulted in significant reductions in the number of pockets positive for
T. denticola and T. forsythia compared to baseline. No significant reductions in
A. actinomycetemcomitans, P. gingivalis and F. nucleatum were observed after
treatment. When samples from all 4 quadrants were analyzed, there was also a
significant reduction in the number of pockets positive for P. gingivalis at the end
109
Table 6.2. Probing pocket depth results in the test-quadrant for moderate (4-6 mm) and deep pockets (7 mm), the percentage of
obtained healthy pockets (PPD3 mm) and pockets that remain deep (PPD 5 mm) after 3 months and bleeding on probing (BoP) and
plaque index (PlI) results (mean SD).
Test Rela tive cha nge
3 months Cha nge ba seline-3-months Pockets initia l 5 mm
Qua dr a nt ba seline-3-months
Moder a te Deep Moder a te Deep (he a lthy)
PPD 5 mm BoP (%) PlI (%)
4-6 mm 7 mm 4-6 mm 7 mm PPD 3 mm
FM-SRP 3.80 0.55 6.25 1.32 1.18 0.38* 1.59 0.84* 37.1 17.0 51.8 21.0 42.9 26.7* 71.8 19.1*
Q-SRP 3.71 0.49 5.78 1.04 1.27 0.32* 1.69 0.76* 33.021.0 46.0 22.0 43.5 17.1* 59.9 29.1*
*Significa nt cha nge fr om ba seline (p< 0.05)
Table 6.3. Probing pocket depth results in the whole mouth for moderate (4-6 mm) and deep pockets (7 mm), the percentage of
obtained healthy pockets (PPD3 mm) and pockets that remain deep (PPD 5 mm) after 3 months and bleeding on probing (BoP) and
plaque index (PlI) results (mean SD).
Whole Rela tive cha nge
3 months Cha nge ba seline-3-months Pockets initia l 5 mm
Mouth ba seline-3-months
Moder a te Deep Moder a te Deep (he a lthy)
PPD 5 mm BoP (%) PlI (%)
4-6 mm 7 mm 4-6 mm 7 mm PPD 3 mm
FM-SRP 3.70 0.46 7.07 1.31 1.12 0.39* 1.74 1.15* 31.8 15.0 50.5 15.6 46.8 22.1* 61.2 17.2*
Q-SRP 3.64 0.36 6.54 0.71 1.18 0.29* 2.07 0.78* 32.5 15.0 48.2 18.0 49.4 15.7* 64.1 22.3*
*Significa nt cha nge fr om ba seline (p< 0.05)
CHAPTER 6
110
of the study. Between the treatment protocols there were no significant differences
in the reduction of the number of pockets positive for A. actinomycetemcomitans,
P. gingivalis, T. denticola, F. nucleatum and T. forsythia after 3 months (Table 6.4.).
Changes in the frequency of detection of T. denticola, F. nucleatum and
T. forsythia in the pockets of the test-quadrant are represented on a timeline in
Figure 6.2. Mechanical treatment itself had a limited effect on elimination of
T. denticola, F. nucleatum or T. forsythia and was comparable between treatment
modalities. In the course of the first week after treatment a continuing reduction
in the percentage of positive pockets could be observed without additional me-
chanical intervention. This reduction was more pronounced in the FM-SRP treat-
ment group. After the second and third session of SRP, the percentage of pockets
positive in the MS-SRP continued to reduce. At the end of the observation period,
only minor differences were observed between both treatment groups.
Table 6.4. Treatment results in the test-quadrant (18 or 20 pockets) and between brackets all
4 quadrants (72 or 80 pockets) for the presence of A. actinomycetemcomitans, P. gingivalis,
T. denticola, F. nucleatum and T. forsythia in the FM-SRP (N=18) and MS-SRP (N=20) group after
3 months and the distribution of the species in the tested pockets over the different categories.
FM-SRP Number of pockets positive for species Category distribution

(# pockets)
Before After Decrease Succes Failure Recolonization Neutral
A. actinomycetemcomitans 02(6) 01(6) 01(0) 01 0 0001 16
P. gingivalis 09(36) 04(22) 05(14*) 05 2 0003 08
T. denticola 16(62) 03(20) 13*(42*) 13 1 0002 02
F. nucleatum 18(71) 16(69) 02(2) 02 9 0007 00
T. forsythia 17(65) 07(37) 10*(28*) 11 4 0003 00
MS-SRP
A. actinomycetemcomitans 02(9) 03(6) -1(3) 1 00 0004 15
P. gingivalis 10(40) 06(25) 4(15*) 4 03 0005 08
T. denticola 14(63) 07(22) 7*(41*) 8 01 0008 03
F. nucleatum 20(80) 20(78) 0(2) 0 17 0003 00
T. forsythia 19(76) 12(44) 7*(32*) 7 04 0009 00
* Significant decrease from baseline (p<0.05)

Significant difference between FM-SRP and MS-SRP (p<0.05)
111
CHAPTER 6
The frequencies of detection provide an average view instead of showing the

effect of SRP on a specific species in a specified pocket. Therefore, the microbiologi-
cal results of the pockets in the test-quadrant were categorized into 4 groups defined
as success, failure, recolonization and neutral (Table 6.4.).
Although all 5 species responded more favorably to FM-SRP, only a trend in
success between FM-SRP and MS-SRP was observed for T. forsythia (p=0.095).
For F. nucleatum the category failure was significantly higher (p=0.02) in the MS-
SRP group compared to the FM-SRP group. A significant difference in recolonization
between FM-SRP and MS-SRP was found for T. denticola (p=0.043) and a trend
(p=0.061) for T. forsythia.
The detection of F. nucleatum, T. forsythia and T. denticola after SRP

Percentage of pockets positive
100%
80%
60%
40% Fn FM-SRP
Fn MS-SRP
Tf FM-SRP
20% Tf MS-SRP
Td FM-SRP
Td MS-SRP
0%
Baseline After SRP 1 day 2 days 1 week 2 weeks 3 months
Time
Figure 6.2. The percentage of tested pockets in the test-quadrant that were positive for F.
nucleatum, T. forsythia and T. denticola at baseline and at different timepoints after FM-SRP or
MS-SRP.
112
DISCUSSION
The hypothesis formulated by Quirynen et al. (134) was that reinfection of a

disinfected area might challenge periodontal treatment outcome. Periodontitis is
considered a multifactorial disease in which a highly diverse microbial population is
considered causative (122). It has however not been possible to identify a single
bacterial species that fulfil the postulates of Koch for true pathogens. Moreover,
microbiological detection methods have an inherent detection limit and therefore cannot
be used to show true absence of a species. However, it might not be important to
detect true absence of periodontal pathogens as they can also be found in healthy
individuals (209). Furthermore, plaque is a biofilm in which multiple species cooperate.
When plaque matures the number of gram negative species increase. In some patients
this may lead to the development of periodontitis, in others not. So even in the presence
of so-called periodontal pathogens, a susceptible host is needed for periodontitis to
develop, as presented by the pathogenesis model in Page and Kornman (122). Since
the term infection also implies a host response, we consider the term recolonization
more appropriate to study bacterial (re) appearance.
The aim of the present study was to test recolonization of periodontal lesions
after FM-SRP or multiple session-SRP (MS-SRP) in a randomized clinical trial and
test whether FM-SRP and MS-SRP result in different clinical outcomes. The set-
ting of this study was a private clinic for periodontology requiring compromises on
trial design. The protocol of the clinic demanded for example a 3 session SRP
protocol and did not include the registration of pockets <3 mm and clinical at-
tachment level. We believed that a 3 session SRP protocol was still suitable for
testing the recolonization hypothesis since in this setting there were remaining
quadrants that could serve as a reservoir for periodontal pathogens. Clinical at-
tachment levels are prone to measurement errors, especially in inflamed periodon-
tal tissues (190). Probing pocket depth was therefore regarded as the appropriate
measure for short term periodontal treatment outcome. This study was designed
as a randomized clinical trial according to the guidelines set by the Consort group
(25) for blinding of the oral hygienists, randomization concealment, completeness
of follow up and an a priori power analysis to determine sample size. Blinding of
the oral hygienists who performed the scaling and root planing was sought by
designing the upper right quadrant as the test-quadrant. Moreover, in the present
study patients were stratified for the oral hygienists, thereby reducing eventual intra
113
CHAPTER 6
operator differences that might have biased the clinical outcomes. Analysis of the
test-quadrant results and the whole mouth clinical data revealed no statistical
differences and whole mouth data was therefore used for hypothesis testing. With
the inclusion of 18 (FM-SRP) and 20 (MS-SRP) instead of the 22 required subjects in
each group, this study reached a power of 0.75 of drawing the correct conclusion
when the null-hypothesis that FM-SRP and MS-SRP result in equal reductions in PPD
would be rejected.
For microbiological measurements a single pocket in the test-quadrant was
selected to monitor recolonization, since from a microbiological point of view the
pocket is the ecological determinant. However, sampling multiple pockets from
the test-quadrant would have increased the strength of the analysis. This was
however beyond our logistical capabilities.
In general, both FM-SRP and MS-SRP resulted in significant reductions in
PPD compared to baseline values. The reductions in PPD in the MS-SRP group
were comparable to meta-analysis results from the studies of Cobb et al. (24),
Badersten et al. (11) and Badersten et al. (12). FM-SRP resulted in slightly less
reductions in PPD with 1.12 mm in initial moderate and 1.74 mm and initial deep
pockets. That FM-SRP result in less, however not significantly, differences in the
reductions in PPD has also been observed by Apatzidou et al. (6), Koshy et al. (82)
and Jerve-Storm et al. (69), but not by others (134,182,197).
After three months, there were no significant differences between FM-SRP
and MS-SRP in the overall reduction of sites positive for P. gingivalis, T. denticola,
and T. forsythia. Considering the sampled pockets in the test-quadrant however,
FM-SRP was more successful in eliminating the five species tested, although not
significantly. There are two possible explanations for this observation. First,
recolonization occurred more often in the MS-SRP group as compared to the FM-
SRP group and was significant for T. denticola (Table 6.4.). This may be the result
of a lower reduction in PlI in the test-quadrant of the MS-group. In the presence of
high post-treatment plaque levels, periodontal pathogens may reach pre-treatment
levels in three weeks (143). The second explanation might be that although imme-
diately after the initial session of SRP in the FM-SRP and MS-SRP group only a
limited reduction in the sites positive for T. denticola, F. nucleatum and T. for-
sythia was detected, an ongoing reduction in positive sites could be observed up
to 1 and 2 weeks, without additional SRP of that quadrant. For FM-SRP this was
more pronounced and is possible due to an immunological effect on the bacteria in the
114
biofilm. We speculate that a single session FM-SRP provokes a quantitatively more

pronounced acute immune response as compared to MS-SRP. This quantitative
difference in the immune response may explain the stronger reduction in the detection
frequencies of the pathogens by FM-SRP found in this study. Interestingly, the
subsequent sessions of SRP in the MS-SRP group resulted in an ongoing reduction in
the detection frequencies in the test-quadrant without additional SRP in that quadrant,
resulting in the absence of significant differences between the two groups after 3
months. This resembles the Schwartzman reaction or the vaccine effect (124,136).
Apatzidou and Kinane (7) and Wang et al. (194) on the other hand showed that both
treatment modalities did not result in increased levels of IgG to P. gingivalis, T. denticola,
P. intermedia, T. forsythia or A. actinomycetemcomitans during the active phase of
treatment but with increased avidity.
FM-SRP shows significantly less recolonization of T. denticola in the sampled
pocket of the test-quadrant but did not result in a significant difference in the
overall detection frequency of the five pathogens after three months as compared
to MS-SRP. In contrast, MS-SRP seems to result in slightly better, but not signifi-
cant, clinical treatment outcomes as compared to FM-SRP. Reflecting on this, the
periodontitis pathogenesis model is helpful (122). From this model it becomes
clear that the clinical features of periodontitis are the result of the interaction of
the bacterial component, host immune responses and periodontal tissue metabo-
lism. The mere presence or absence of a single species as a determinant for
clinical success or failure might therefore be regarded as a simplification of the
complexity of the disease. further studies on this topic are strongly recommended
to include short time and site specific immunological parameters of both the in-
nate and humoral immune response in addition to microbiological parameters.
In conclusion, the present study shows that FM-SRP and MS-SRP do not
result in different clinical outcomes for PPD, BoP and PlI and the overall detection
frequencies of 5 periodontal pathogens after 3 months. Confirmatory to the
recolonization hypothesis, FM-SRP shows less recolonization as compared to MS-
SRP. This argument however should be used with care to support a treatment
modality since both result in equally good and acceptable clinical outcomes. Both
treatment modalities can be considered for initial non-surgical periodontal treat-
ment according to patients needs and preferences, operator skills, practice set-
tings and cost-effectiveness (87,154) and will result in anticipated clinical outcomes.
115
CHAPTER 6
ACKNOWLEDGEMENTS
We sincerely would like to express our gratitude to Prof. Dr. AJ van Winkelhoff
for critically reviewing the manuscript, the oral hygienists Jolanda van der Vaart and
Trynke de Jong for their clinical experience and sampling efforts, to Kitty Smit for
patient management and to Stefan Vegter for critical discussions on statistical analyses
of periodontal data.
116
7
General discussion
GENERAL DISCUSSION
GENERAL DISCUSSION
In the introduction of this thesis a periodontal pathogenesis model was

described, outlining the different steps from microbial colonization of the tooth
surface to the initiation and maintaining of the inflammation of the periodontal
tissues. Modern molecular biological techniques as denaturing gradient gel elec-
trophoresis (DGGE) and fluorescent in situ hybridization (FISH) can potentially
provide more detailed information about subgingival plaque formation and its ar-
chitecture related to the bacterial component of periodontal pathogenesis. The
aims of the thesis were therefore (i) to develop molecular tools to study oral
microbial communities, (ii) to monitor the formation of subgingival plaque after
mechanical scaling and root planing (SRP), (iii) to localize oral bacteria in supra
and subgingival plaque and (iv) to apply this knowledge to provide a rationale for
full-mouth or multiple-session SRP in clinical periodontology. In the following dis-
cussion, the developed molecular techniques to study complex microbial commu-
nities are evaluated. The results are used to interpret the effect of SRP on the
microbial population and the clinical outcomes.
METHODOLOGICAL CONSIDERATIONS
Molecular techniques
At the start of this thesis, DGGE was a promising DNA based technique to
detect the composition of a bacterial population without the presumptive inclu-
sion/exclusion of bacterial groups. In comparison with the dot-blot checkerboard
analysis (171), DGGE might be more sensitive and unbiased for unknown species.
Checkerboard analyses on the other hand showed to be easier to handle and
interpret and more convenient for large scale analyses and comparisons. During
the course of this thesis technological improvements resulted in a micro-array
specific to about 300 different species in the oral cavity. This Human Oral Microbe
Identification Microarray (HOMIM) has a detection limit of 104 cells. Although this
promising technique becomes available for large scale applications in the future,
there might still be unidentified species present, which are absent on the chip and
therefore not detected. With DGGE, also unidentified and unknown species can be
detected. Moreover, DGGE can be refined to species or groups of species that are
121
CHAPTER 7
of interest. Which technique to opt for is a matter of availability, economics and most
importantly, the research questions to be answered. In fact, dot-blot checkerboard,
DGGE and micro-arrays are screening techniques to identify interesting topics and to
generate research questions. We introduced DGGE in oral microbiology and showed
its applicability to study shifts in the microbial population after therapeutic interfer-
ences and the possibility to identify bands, as exemplified for Exiguobacterium
aurantiacum (Chapter 2 and 3). These results led us to expand the study design and
monitor the effect of SRP on the microbial population in greater detail in a larger
population of patients (Chapter 4) .
Periodontal study design

With the statements of the Consort group (www.consort-statement.org),
clear guidelines for clinical trials are presented. These include blinding of the
examiners, randomization concealment, completeness of follow up, and an a priori
power analysis to determine sample size. In periodontal research, the primary
treatment outcome in a power analysis would preferably be tooth mortality. Due
to its rare incidence and multiple confounders, tooth mortality is often replaced by
the surrogate treatment outcome probing pocket depth (PPD) (39). However, there
is limited data available on how clinical parameters like PPD and clinical attach-
ment level (CAL) are related to tooth mortality (61). Therefore, assumptions are
required to execute an a priori power analysis. The question arising is for example,
what difference in PPD reductions between treatments is considered clinically relevant?
As a reference, trained examiners can probe pocket depths with measurement errors
varying from less then 0.5 mm (8) to 1.2 mm (101). Furthermore, meta-analysis
data show that the average reduction achieved by SRP alone is 0.03 mm for
pockets with an initial depth of 1-3 mm, 1.29 mm for pockets initially measuring
4-6 mm and 2.16 mm for pockets of 7 mm (12,24). Consequently, there is
roughly an additional reduction of 1-2 mm mean PPD left for further improvements
considering healthy pockets ranging up to 4 mm. These additional improvements in
PPD reductions should come from deep residual pockets, which are mainly found
around multi rooted teeth and are notorious for responding poorly to therapy (187).
Taken these considerations together, the room for clinical improvements in PPD re-
duction additional to the effect of SRP is limited. Further studies testing new or modified
treatment modalities for periodontitis require therefore large sample sizes to reach
statistical significance and should adhere to the CONSORT group statements. They
122
GENERAL DISCUSSION
are therefore better designed as tests for equality or are aiming at the improvement
of other parameters like time of treatment, patient compliance, the reduction of side
effects or costs of treatment.
MICROBIOLOGICAL CONSIDERATIONS
Subgingival plaque is a biofilm

Already in the seventies it was recognized that oral plaque, nowadays called
a biofilm, either supra or subgingival is a well-organized entity (93,94). Single or
dual species in vitro studies have shown that biofilms posses several characteris-
tic features, that is, a sequential formation of a biofilm structure (81), a spatial
organization of bacteria (93), metabolic interactions (18,67), intra- and inter spe-
cies communication (80) and co-adhesion (20). Oral biofilms can habit more than
30 different species from a total of more than 700 genotypes possibly found in
the oral cavity (1,63,84,105,130). The sequential formation of a supragingival
biofilm on a pristine tooth surface is documented to the species level from the first
hours up to 1 week in vivo (35,36,57,92). Thereafter, the information is limited to
morphological observations of the biofilm and the gramstain nature of bacterial
cells (85,93). A biofilm model based on co-aggregation experiments and studies
on the composition of plaques associated with gingivitis or periodontitis (79,173)
provide an idea about mature biofilm organization. Comparison of our observa-
tions with the biofilm model of Kolenbrander (79) shows remarkable similarities in
the presence of the different layers that are dominated by a certain group of
bacteria (Chapter 5). There are however also differences to the model. A first
major difference is the presence of T. forsythia in the same layer as F. nucleatum,
suggesting a bridging role enhancing the colonization of the biofilm by other spe-
cies. This may implicate that the colonization of T. forsythia in the biofilm marks
the transition from a mainly gram-positive biofilm to a biofilm dominated by gram-
negative bacteria and explains why T. forsythia is found as one of the red complex
species (173). This hypothesis needs further investigation. A second important
observation in our study is the localization of P. gingivalis, P. intermedia and
P. micra in micro-colonies in the top layer of the biofilm. As secondary colonizers
they colonize an already established biofilm and form micro-colonies. This raises
the question whether these so-called periodontal pathogens play a role in the
123
CHAPTER 7
initiation of periodontitis or are more related to the progression and severity of disease.
The third observation is the presence of Synergistes sp. in direct contact to host
immune cells at the top of the biofilm. This finding clearly shows the power of in vivo
observations and stimulates further research elucidating the role of Synergistes sp.
in host-pathogen interactions.
To gain more insight in the development of subgingival plaque after SRP, the
population dynamics were studied with DGGE and species-specific PCR. The for-
mation of a new subgingival biofilm after SRP resembles the use of building mate-
rial of ruined cities after another ancient war. The presence of remaining debris
impede clear sequential biofilm formation after SRP. Nevertheless, Actinobacteria
and Firmicutes were shown to be affected by SRP only to a limited extend and
quickly returned to the baseline population composition, thereby mimicking the
formation of initial biofilms on pristine tooth surfaces (36,57,174). The Cytophaga-
Flavobacteria-Bacteroides (CFB) and Spirochaetes bacterial populations however
underwent a change in the composition of the population compared to baseline,
which lasted up to three months.
Our observations on the architecture of subgingival biofilms and its forma-
tion after SRP together with the initial colonization studies corroborate Listgartens
interesting observation of 3 weeks old supragingival plaque that resembles the
structure of subgingival plaque. This could imply that there is a continuance in
biofilm formation and that it would be more correct to name plaques according to
their state of development, rather than to their localization or pathogenic origin.
CLINICAL CONSIDERATIONS
The most common form of periodontal therapy is SRP, aiming for the re-
moval of subgingival calculus, contaminated root cementum and dentin (119), a
reduction of the bacterial load and the elimination of periodontal pathogens (185)
by hand or power driven instruments. It is remarkable that the outlined goals of
SRP are comprehensively evaluated by clinical parameters while studied to a lim-
ited extend by the actual measurements of calculus and bacterial removal by SRP.
The possible effects of SRP on the subgingival bacterial population are three-fold:
124
GENERAL DISCUSSION
i) a quantitative decrease in the total bacterial load in the subgingival pocket (143) ii)
the reduction in the presence of specific periodontal pathogens (185) and (iii) the
mechanical disturbance of the biofilm and its equilibrium with the host.
The studies presented in Chapter 4 and 6 clearly show that SRP itself has a
limited effect in eliminating bacteria. In the weeks following therapy, we however
noticed a reduction in the detection frequency of specific pathogens. This could
be a wash-out effect from dead bacteria. Dead bacteria can be detected by mo-
lecular techniques immediately after SRP. In the course of several days these
bacteria are washed away from the pocket by the continues flow of sulcular fluid.
Another possible explanation is that SRP disturbs the biofilm organization and its
equilibrium with the host. One of the aims of that organization is the protection
against the host immune response. It is for example, striking to see Synergistes
sp. aligned like palisades facing the host immune cells, both in a steady state of
war (Chapter 5). Mechanical disruption of this equilibrium by SRP changes the
battlefield between host and pathogen and additionally may upregulate an immune
response. It has indeed been shown that during SRP, bacteria and their toxins like LPS
are forced into the circulation and provoke an immune response (91,129). Moreover,
the circulating levels of TNF- and IL-6 increase after SRP (64) and the homeostatic
system increases markedly (28). On the other hand, no increased levels of IgG to P.
gingivalis, T. denticola, P. intermedia, T. forsythia or A. actinomycetemcomitans during
the active phase of treatment were detected, although their avidity had increased
(7,194). It seems therefore reasonable to rephrase the biological aims of periodontal
therapy into a reduction of the bacterial load, the destruction of the subgingival biofilm
and the induction of an immune response by the host. Interesting in this, is the finding
that SRP in three quadrants has a beneficial effect on untreated periodontally affected
teeth in the fourth quadrant (131), possibly through a systemical immunological re-
sponse.
With these observations in mind, the successful therapeutic approach of a
single full-mouth 45 minute session of only subgingival debridement (32) and the
finding that subgingival plaque is successfully removed with micro brushes (21)
indicate that less drastic, painful and time consuming treatment modalities than
standard multiple-session SRP can be applied to achieve the biological targets of initial
periodontal therapy.
125
CHAPTER 7
CONCLUDING REMARKS
Periodontal diseases are multi-factorial diseases in a complex host. The peri-

odontitis pathogenesis model presented in Chapter 1 describes the interactions
between the different factors (122) and provide a basis for the design of research
hypotheses. Quirynen et al. hypothesized that recolonization of periodontal patho-
gens could be prevented by a FM-SRP protocol and the prevention of recolonization
is hypothesized to improve clinical outcomes (134). With the aforementioned con-
siderations in mind we can evaluate this reinfection hypothesis, that is actually
made up of two parts. Since clinical outcomes can not be proof for the prevention
of reinfection (206), it is essential to study the immediate effects of SRP on the
subgingival bacteria. We show that SRP itself is limited in eliminating bacteria
(Chapter 4 and 6) and that the formation of a new biofilm after SRP is a complex
sequential process in which the periodontal pathogens colonize an already estab-
lished biofilm (Chapter 5). Moreover, DGGE data show that only a difference in
pocketdepth after three months, but not FM-SRP or MS-SRP, results in a signifi-
cantly more different CFB population as compared to baseline. The only significant
difference between FM-SRP and MS-SRP was a difference in recolonization by
T. denticola (Chapter 6). The second part of the hypothesis links the prevention of
recolonization to improved clinical outcomes. However, according to the patho-
genesis model, also the host inflammatory response and the tissue and bone metabolism
determine the clinical signs of periodontitis, next to the microbiological component
(Chapter 1). Our study and others indeed suggest that SRP may have a stimulating
effect on the immune response, whereas others start to explore the interaction between
bacteria and connective tissue metabolism (128). By directly linking recolonization to
clinical signs, the reinfection hypothesis thus simplifies periodontal pathogenesis.
Based on these findings we hypothesize that mechanical periodontal treatment
has a disturbing effect on the subgingival plaque and an inducing effect on the host
immune response. The concerted action of these two results in clinical healing and
the reduction of subgingival niches. Without subgingival niches, biofilms can not mature
in the presence of good oral hygiene measures and typical periodontal pathogens are
prevented to colonize the biofilm. In the present thesis we present the applicability of
molecular tools to study biofilm formation and to test our hypothesis. Further research
should focus on a better understanding of a single factor or the interaction between
the factors presented in the pathogenesis model. For example, studies should be done
126
GENERAL DISCUSSION
on the later stages of oral biofilm formation and on the role of Synergistes sp. in the
interaction between biofilm and host. We additionally propose further studies to test
alternative treatment modalities designed to reduce the bacterial load, disrupt the
subgingival biofilm and induce an immune response, with reduced disturbing side effects
within a limited amount of time to further improve periodontal therapy.
127
8
Summary
SUMMARY
SUMMARY
Periodontal diseases are the most common presentation of oral pathology

and affect the tooth supporting tissues, including the cementum, the periodontal
ligament, the alveolar bone and the gingival lining. Severe forms of periodontitis
affect 10-15% of the adult population and result in the loss of teeth when left
untreated. The aetiology of periodontitis is complex and is the result of bacterial
accumulations on the tooth surface, compromising host factors like gene-poly-
morphisms or medical disorders like diabetes and modified by life style factors
such as smoking. A model that describes how the different factors involved in
periodontal pathogenesis interact is described in Chapter 1. Periodontitis starts
with the accumulation of bacteria on the tooth surface where they form biofilms.
To study the role of these biofilms in periodontitis, molecular techniques are de-
veloped and optimized for oral bacteria. In Chapter 2 Denaturing Gradient Gel
Electrophoresis (DGGE) is introduced in oral microbiology. DGGE fingerprints of
complex microbial communities are used to study shifts in the population after
treatment and Exiguobacterium aurantiacum was identified in 13 out of 25 samples.
It was possible to detect the most relevant periodontal pathogens in DGGE pro-
files to a level comparable with culturing and species-specific PCR (Chapter 3).
These promising findings proved the applicability of DGGE in oral microbiology
and made us expand the experimental setup to study the microbiological effects
of scaling and root planing (SRP) in a randomized clinical trial in which full-mouth
SRP (FM-SRP) and multiple-session SRP (MS-SRP) are compared. The microbio-
logical effects of SRP are monitored by taking samples before treatment, immedi-
ately after, after 1, 2, 7, 14 and 90 days and are described in Chapter 4. DGGE
analysis of the subgingival microbial population from preselected pockets revealed
that SRP is limited in the elimination of bacteria but induces a transient change in
the Actinobacteria and Firmicutes population structure, which returns to baseline
population structures after three months. At baseline these populations are skewed
with a few species present in almost every patient (Streptococcus sp., A. israelii
and A. odontolyticus) and most species being present in a limited number of
samples. After three months, additional species also become prevalent, including
Rothia dentocariosa. In the Cytophaga-Flavobacteria-Bacteroides cluster (CFB)
population, Tannerella forsythia and an unidentified band are present in almost
every patient. After SRP, the composition of the CFB-cluster population does not
131
CHAPTER 8
return to baseline values and not a single species is detected in more than 15 patients.
Moreover, pockets 4 mm at three months have a CFB population that is significantly
more different from baseline than in pockets >4 mm. There was no difference observed
for Actinobacteria and Firmicutes and not when comparing FM-SRP with MS-SRP.
This leads us to conclude that SRP only results in a change in the composition of
bacterial populations. This change is temporarily for Actinobacteria and Firmicutes
and may last for at least three months for the CFB population. Pocket depth after
three months seems to be more important than treatment option in establishing a CFB
population different from baseline. To be able to discuss these findings, a better
understanding of the architecture of subgingival biofilms was needed. In Chapter 5
we provide the first in vivo visual localization of different species in subgingival plaque.
With fluorescently labeled species-specific probes the most important subgingival
bacteria are localized in the subgingival plaque on seven extracted teeth. The data
shows convincingly the dominance of Actinomyces sp., T. forsythia, Fusobacterium
nucleatum, Spirochaetes and Synergistetes in different layers in the subgingival plaque.
This observation supports a previous hypothetical model of oral biofilms. Synergistes
is a recently identified member of subgingival plaque with a possibly important role in
host-pathogen interaction due to its localization in close proximity to immune cells.
Moreover, Lactobacillus sp. are identified as the central cells of bacterial aggregates
in subgingival plaque, whereas Streptococcus sp. and the yeast Candida albicans
form corncob structures in supragingival plaque. Finally, periodontal pathogens colonize
already formed biofilms and form micro-colonies therein. These in vivo observations
on oral biofilms provide a clear vision on biofilm architecture and the spatial distribution
of predominant species.
In Chapter 6 it is shown that FM-SRP and MS-SRP result in significant im-
provements in probing pocket depth (PPD), plaque index (PlI), bleeding on probing
(BoP) and reduction in the general detection frequency of 5 periodontal pathogens
after three months, but without a significant difference between both treatments.
Analysis of selected pockets in a test quadrant revealed that FM-SRP results in
significant less recolonization of Treponema denticola compared to MS-SRP. An
additional finding was that the detection frequencies of T. forsythia and T. denticola
continued to decrease up to one week after treatment, without additional treat-
ment. This observation lead us to suggest that SRP also induces an immune
response. The elimination of bacteria might therefore be the concerted action of
mechanical therapy and the induced immune system of the host. In Chapter 7 an
132
SUMMARY
attempt was made to evaluate the microbiological and clinical experimental results
and to provide a rationale for the mechanisms of mechanical periodontal therapy.
It is concluded that clinical hypothesis testing without adhering to CONSORT-
group statements is erroneous. These statements are formulated to improve the
reporting of clinical trails. Moreover, better treatment options should be defined
as less time consuming, less side effects or less expensive instead of aiming for
more reduction in pocket depth. Based on our microbiological findings we hypoth-
esize that mechanical periodontal treatment has preliminary a disturbing effect on
the subgingival biofilm and a stimulating effect on the host immune response. To
determine the exact sequences and mechanisms of biofilm formation and its inter-
action with the host, further experiments are needed, for which we present the
molecular tools. These goals can be combined in a clinical trial that is designed to
reduce the bacterial load, disrupt the subgingival biofilm and upregulate an im-
mune response in a treatment modality with reduced disturbing side effects within
a limited amount of time to further improve periodontal therapy.
133
9
Samenvatting
SAMENVATTING
SAMENVATTING
Parodontale ziekten hebben betrekking op de tand ondersteunende weefsels,

waaronder het cementum, het parodontale ligament, het alveolaire bot en het
tandvlees. 10-15% van de volwassen bevolking lijdt aan de ernstige vormen van
parodontitis, wat op termijn leidt tot het verlies van tanden als patinten niet
behandeld worden. De etiologie van parodontitis is het gevolg van de groei van
bacterin in de plaque op het tandoppervlak, specifieke gastheer factoren zoals
gen-polymorfismen of medische aandoeningen zoals diabetes. Daarnaast spelen
life-style factoren zoals roken en stress een rol. Een model dat beschrijft hoe de
verschillende factoren die betrokken zijn bij het ontstaan van parodontitis wordt
beschreven in Chapter 1. Parodontitis begint met de ophoping van bacterin op
het tandoppervlak waar ze biofilms vormen. Voor het bestuderen van de rol van
bacterin en biofilms, zijn moleculaire technieken ontwikkeld en geoptimaliseerd
voor toepassing in parodontitis. In Chapter 2 is Denaturing Gradient Gel Electro-
phoresis (DGGE) gentroduceerd in de orale microbiologie. Met DGGE wordt een
genetische streepjescode van complexe microbile gemeenschappen gemaakt.
Hiermee kunnen verschuivingen in de microbile populatie bestudeerd, en nieuwe
soorten gedentificeerd worden. Zo werd bijvoorbeeld Exiguobacterium aurantiacum
in 13 van de 25 subgingivale plaque samples gevonden. Daarnaast is aangetoond
dat de meest relevante parodontale pathogene bacterin in DGGE profielen
aangetoond kunnen worden tot een niveau dat vergelijkbaar is met kweken en
soort-specifieke PCR (Chapter 3). De experimentele opstelling is vervolgens
uitgebreid om de microbiologische effecten van scaling en rootplaning (SRP) te
onderzoeken in een gerandomiseerde klinische trial naar twee behandelmethodes,
full-mouth scaling en rootplanning (FM-SRP) en multiple-session scaling en
rootplaning (MS-SRP). Voor het onderzoek naar de microbiologische effecten van SRP
zijn vr de behandeling, onmiddellijk na, na 1, 2, 7, 14 en na 90 dagen subgingivale
plaque samples verzameld (Chapter 4). De analyse van de DGGE profielen van de
subgingivale microbile populatie toonde aan dat SRP slechts leidt tot een beperkte
verwijdering van de bacterin. SRP leidt tot een tijdelijke verschuiving in de samenstelling
van de Actinobacteria en Firmicutes populaties. Na drie maanden is de structuur van
de populaties echter vergelijkbaar met de uitgangssituatie. Voor de behandeling is de
structuur van de populaties scheef verdeeld. Er zijn een paar soorten die in bijna elke
137
CHAPTER 9
patint aangetroffen worden (Streptococcus sp., A. odontolyticus en A. israelii), terwijl

de meeste soorten slechts in een paar patinten aangetroffen worden. Na drie maanden
zijn er een paar soorten die ook in bijna alle patinten aangetroffen worden, waaronder
Rothia dentocariosa. In het Cytophaga-Flavobacteria Bacteroides cluster (CFB), zijn
Tannerella forsythia en een niet gedentificeerde band aanwezig in bijna elke patint.
Na SRP treedt een blijvende verandering in de structuur van de CFB-cluster populatie
op, die niet terugkeert naar de uitgangswaarden, waarbij geen enkele soort in meer
dan 15 patinten wordt aangetroffen. Bovendien, pockets die na drie maanden 4 mm
diep zijn hebben een CFB populatie die significant meer verschillend is ten opzichte
van de uitgangswaarde dan diepe pockets (>4 mm). Dit verschil is niet waargenomen
voor Actinobacteria en Firmicutes en niet bij de vergelijking tussen FM-SRP en MS-
SRP. Hieruit concluderen wij dat SRP resulteert in een verandering in de samenstelling
van de bacterile populaties. Deze verandering is tijdelijk voor Actinobacteria en
Firmicutes en duurt ten minste drie maanden voor de CFB populatie. Pocketdiepte na
drie maanden lijkt belangrijker te zijn dan de behandel optie voor het verkrijgen van een
CFB populatie die significant verschillend is ten opzichte van de uitgangswaarde. Om
deze bevindingen nader te kunnen interpreteren was een beter begrip van de
architectuur van subgingivale biofilms nodig. In Chapter 5 tonen wij de eerste zichtbare
in vivo lokalisatie van de verschillende soorten bacterin in subgingivale plaque. Met
fluorescent gelabelde soort-specifieke probes zijn de belangrijkste subgingivale bacterin
gelokaliseerd in de subgingivale plaque van zeven gextraheerde tanden. Uit de gegevens
blijkt overtuigend de dominantie van Actinomyces sp., Tannerella Forsythia, Fusobac-
terium nucleatum, Spirochaeta en Synergistetes in verschillende lagen van de
subgingivale plaque. Deze waarneming ondersteunt een eerder hypothetisch model
waarin de lokalisatie van bacterin in orale biofilms beschreven wordt. Daarnaast is
Synergistes gedentificeerd als lid van de subgingivale plaque met een mogelijk
belangrijke rol in gastheer-pathogeen interactie door zijn lokalisatie in de nabijheid van
immuun cellen. Bovendien zijn Lactobacillus sp. gedentificeerd als de centrale cellen
van bacterile aggregaten in subgingivale plaque, terwijl Streptococcus sp. en de gist
Candida albicans maskolf structuren vormen in supragingivale plaque. Tenslotte,
parodontale pathogenen koloniseren reeds gevormde biofilms in de vorm van micro-
kolonies. Deze in vivo waarnemen van orale biofilms bieden een duidelijk beeld van de
architectuur van orale biofilms en de ruimtelijke verdeling van de belangrijkste soorten.
138
SAMENVATTING
In Chapter 6 wordt aangetoond dat FM-SRP en MS-SRP beide resulteren in

significante verbeteringen in de pocketdiepte, plaque index, bloedingsneiging na
sonderen en een verlaging van de detectiefrequentie van 5 parodontale pathogenen na
drie maanden. Er is geen verschil tussen de beide behandelingen aangetoond. Analyse
van geselecteerde pockets in het testkwadrant toont aan dat FM-SRP resulteert in
aanzienlijk minder rekolonisatie van Treponema denticola vergeleken met MS-SRP.
Een bijkomende bevinding was dat de detectiefrequenties van T. denticola en
T. forsythia tot een week na de behandeling blijven dalen, zonder tussentijdse
interventies in die pocket. Deze observatie suggereert dat SRP ook een immuunrespons
induceert, waarbij de overgebleven bacterin door het afweersysteem verwijderd
worden. De eliminatie van bacterin kan dus worden beschouwd als de gezamenlijke
actie van mechanische therapie en het immuunsysteem van de gastheer. In Chapter 7
zijn de microbiologische en klinische resultaten gevalueerd en is geprobeerd om het
werkingsmechanisme van mechanische parodontale therapie te beschrijven.
Geconcludeerd wordt dat het voor het testen van een klinische onderzoekshypothese
van belang is om de CONSORT-groep richtlijnen te volgen. Deze richtlijnen zijn
geformuleerd ter verbetering van de rapportage van klinische onderzoek. Bovendien
kunnen nieuwe of modificaties van behandeling opties beter gedefinieerd worden als
minder tijdrovend, met minder bijwerkingen of tegen lagere kosten, in plaats van het
streven naar meer vermindering van de pocket diepte. Op basis van onze
microbiologische bevindingen veronderstellen we dat mechanische parodontale
behandeling voornamelijk een verstorende invloed op de subgingivale biofilm en een
stimulerend effect op het afweersysteem van de gastheer heeft. Voor vervolg
onderzoek naar de exacte volgorde en de mechanismen van biofilmvorming en de
interactie met de gastheer zijn in deze studie de moleculaire tools beschreven. Dit
onderzoek kan worden gecombineerd met een klinische studie die is ontworpen om de
hoeveelheid bacterin te verminderen, de subgingivale biofilm te verstoren en de
afweerreactie van de gastheer te stimuleren, waarbij het aantal bijwerkingen
verminderd is en de behandeling in een beperkte tijd uitgevoerd kan worden ter
verbetering van parodontale therapie.
139
10
Reference list
CHAPTER 10
REFERENCE LIST
001. Aas JA, Paster BJ, Stokes LN, Olsen I, Dewhirst FE (2005) Defining the normal
bacterial flora of the oral cavity. J Clin Microbiol 43: 5721-5732.
002. Al-Ahmad A, Wunder A, Auschill TM, Follo M, Braun G et al. (2007) The in vivo
dynamics of Streptococcus spp., Actinomyces naeslundii, Fusobacterium nucleatum
and Veillonella spp. in dental plaque biofilm as analysed by five-colour multiplex
fluorescence in situ hybridization. J Med Microbiol 56: 681-687.
003. Albandar JM, Kingman A (1999) Gingival recession, gingival bleeding, and dental
calculus in adults 30 years of age and older in the United States, 1988-1994. J
Periodontol 70: 30-43.
004. Amann R, Binder BJ, Olson RJ, Chisholm SW, Devereux R et al. (1990) Combination
of 16S rRNA-targeted oligonucleotide probes with flow cytometry for analyzing mixed
microbial populations. Appl Environ Microbiol 56: 1919-1925.
005. Apatzidou DA, Riggio MP, Kinane DF (2004) Quadrant root planing versus same-day
full-mouth root planing. II. Microbiological findings. J Clin Periodontol 31: 141-148.
006. Apatzidou DA, Kinane DF (2004) Quadrant root planing versus same-day full-mouth
root planing. I. Clinical findings. J Clin Periodontol 31: 132-140.
007. Apatzidou DA, Kinane DF (2004) Quadrant root planing versus same-day full-mouth
root planing. J Clin Periodontol 31: 152-159.
008. Araujo MW, Hovey KM, Benedek JR, Grossi SG, Dorn J et al. (2003) Reproducibility
of probing depth measurement using a constant-force electronic probe: analysis of
inter- and intraexaminer variability. J Periodontol 74: 1736-1740.
009. Ashimoto A, Chen C, Bakker I, Slots J (1996) Polymerase chain reaction detection of
8 putative periodontal pathogens in subgingival plaque of gingivitis and advanced
periodontitis lesions. Oral Microbiol Immunol 11: 266-273.
010. Auschill TM, Arweiler NB, Netuschil L, Brecx M, Reich E et al. (2001) Spatial
distribution of vital and dead microorganisms in dental biofilms. Arch Oral Biol 46:
471-476.
011. Badersten A, Nilveus R, Egelberg J (1981) Effect of nonsurgical periodontal therapy. I.
Moderately advanced periodontitis. J Clin Periodontol 8: 57-72.
012. Badersten A, Nilveus R, Egelberg J (1984) Effect of nonsurgical periodontal therapy.
II. Severely advanced periodontitis. J Clin Periodontol 11: 63-76.
013. Behrens S, Rhland C, Inacio J, Huber H, Fonseca A et al. (2003) In situ accessibility
of small-subunit rRNA of members of the domains Bacteria, Archaea, and Eucarya to
Cy3-labeled oligonucleotide probes. Appl Environ Microbiol 69: 1748-1758.
014. Berglundh T, Donati M (2005) Aspects of adaptive host response in periodontitis. J
143
CHAPTER 10
Clin Periodontol 32 Suppl 6: 87-107.

015. Bollen CM, Mongardini C, Papaioannou W, Steenberghe van D, Quirynen M (1998)
The effect of a one-stage full-mouth disinfection on different intra-oral niches. Clinical
and microbiological observations. J Clin Periodontol 25: 56-66.
016. Bos R, Mei van der HC, Busscher HJ (1999) Physico-chemistry of initial microbial
adhesive interactionsits mechanisms and methods for study. FEMS Microbiol Rev
23: 179-230.
017. Boutaga K, Winkelhoff van AJ, Vandenbroucke-Grauls CM, Savelkoul PH (2005)
Periodontal pathogens: a quantitative comparison of anaerobic culture and real-time
PCR. FEMS Immunol Med Microbiol 45: 191-199.
018. Bradshaw DJ, Homer KA, Marsh PD, Beighton D (1994) Metabolic cooperation in oral
microbial communities during growth on mucin. Microbiology 140 (Pt 12): 3407-
3412.
019. Burt B (2005) Position paper: epidemiology of periodontal diseases. J Periodontol 76:
1406-1419.
020. Busscher HJ, Mei van der HC (1997) Physico-chemical interactions in initial microbial
adhesion and relevance for biofilm formation. Adv Dent Res 11: 24-32.
021. Carey HM, Daly CG (2001) Subgingival debridement of root surfaces with a micro-
brush: macroscopic and ultrastructural assessment. J Clin Periodontol 28: 820-827.
022. Carlsson J (1997) Bacterial metabolism in dental biofilms. Adv Dent Res 11: 75-80.
023. Choi BK, Park SH, Yoo YJ, Choi SH, Chai JK et al. (2000) Detection of major
putative periodontopathogens in Korean advanced adult periodontitis patients using a
nucleic acid-based approach. J Periodontol 71: 1387-1394.
024. Cobb CM (1996) Non-surgical pocket therapy: mechanical. Ann Periodontol 1: 443-
490.
025. CONSORT (2001) statement website. HTTP://consort-statement org.
026. Cowman RA, Baron SS (1993) Comparison of aminopeptidase activities in four
strains of mutans group oral streptococci. Infect Immun 61: 182-186.
027. Cugini MA, Haffajee AD, Smith C, Kent RL, Jr., Socransky SS (2000) The effect of
scaling and root planing on the clinical and microbiological parameters of periodontal
diseases: 12-month results. J Clin Periodontol 27: 30-36.
028. DAiuto F, Parkar M, Tonetti MS (2007) Acute effects of periodontal therapy on bio-
markers of vascular health. J Clin Periodontol 34: 124-129.
029. Daly K, Shirazi-Beechey SP (2003) Design and evaluation of group-specific
oligonucleotide probes for quantitative analysis of intestinal ecosystems: their
144
REFERENCE LIST
application to assessment of equine colonic microflora. FEMS Microbiol Ecol 44: 243-
252.
030. Darby IB, Mooney J, Kinane DF (2001) Changes in subgingival microflora and humoral
immune response following periodontal therapy. J Clin Periodontol 28: 796-805.
031. Darby M (2003) Can we successfully maintain risk patients? Int J Dent Hyg 1: 9-15.
032. Del Peloso RE, Bittencourt S, Sallum EA, Nociti FH, Jr., Goncalves RB et al. (2008)
Periodontal debridement as a therapeutic approach for severe chronic periodontitis: a
clinical, microbiological and immunological study. J Clin Periodontol 35: 789-798.
033. Dennison DK, Dyke van TE (1997) The acute inflammatory response and the role of
phagocytic cells in periodontal health and disease. Periodontol 2000 14: 54-78.
034. Dewhirst FE, Paster BJ, Tzellas N, Coleman B, Downes J et al. (2001)
Characterization of novel human oral isolates and cloned 16S rDNA sequences that
fall in the family Coriobacteriaceae: description of olsenella gen. nov., reclassification
of Lactobacillus uli as Olsenella uli comb. nov. and description of Olsenella profusa
sp. nov. Int J Syst Evol Microbiol 51: 1797-1804.
035. Diaz PI, Chalmers NI, Rickard AH, Kong C, Milburn CL et al. (2006) Molecular
characterization of subject-specific oral microflora during initial colonization of enamel.
Appl Environ Microbiol 72: 2837-2848.
036. Dige I, Raarup MK, Nyengaard JR, Kilian M, Nyvad B (2009) Actinomyces naeslundii
in initial dental biofilm formation. Microbiology 155: 2116-2126.
037. Downes J, Munson MA, Spratt DA, Kononen E, Tarkka E et al. (2001)
Characterisation of Eubacterium-like strains isolated from oral infections. J Med
Microbiol 50: 947-951.
038. Dyke van TE, Sheilesh D (2005) Risk factors for periodontitis. J Int Acad Periodontol
7: 3-7.
039. Eberhard J, Jerve-Storm PM, Needleman I, Worthington H, Jepsen S (2008) Full-
mouth treatment concepts for chronic periodontitis: a systematic review. J Clin
040. Ebersole JL (2003) Humoral immune responses in gingival crevice fluid: local and
systemic implications. Periodontol 2000 31: 135-166.
041. Enwonwu CO, Ritchie CS (2007) Nutrition and inflammatory markers. J Am Dent
Assoc 138: 70-73.
042. Fletcher J, Nair S, Poole S, Henderson B, Wilson M (1998) Cytokine degradation by
biofilms of Porphyromonas gingivalis. Curr Microbiol 36: 216-219.
043. Franks AH, Harmsen HJ, Raangs GC, Jansen GJ, Schut F et al. (1998) Variations of
145
CHAPTER 10
bacterial populations in human feces measured by fluorescent in situ hybridization

with group-specific 16S rRNA-targeted oligonucleotide probes. Appl Environ Microbiol
64: 3336-3345.
044. Fujimoto C, Maeda H, Kokeguchi S, Takashiba S, Nishimura F et al. (2003)
Application of denaturing gradient gel electrophoresis (DGGE) to the analysis of
microbial communities of subgingival plaque. J Periodontal Res 38: 440-445.
045. Funke G, Graevenitz von A, Clarridge JE, III, Bernard KA (1997) Clinical microbiology
of coryneform bacteria. Clin Microbiol Rev 10: 125-159.
046. Furcht C, Eschrich K, Merte K (1996) Detection of Eikenella corrodens and
Actinobacillus actinomycetemcomitans by use of the polymerase chain reaction (PCR)
in vitro and in subgingival plaque. J Clin Periodontol 23: 891-897.
047. Garcia L, Tercero JC, Legido B, Ramos JA, Alemany J et al. (1998) Rapid detection
of Actinobacillus actinomycetemcomitans, Prevotella intermedia and Porphyromona
gingivalis by multiplex PCR. J Periodontal Res 33: 59-64.
048. Gersdorf H, Meissner A, Pelz K, Krekeler G, Gbel UB (1993) Identification of
Bacteroides forsythus in subgingival plaque from patients with advanced periodontitis.
J Clin Microbiol 31: 941-946.
049. Gillan DC, Speksnijder AG, Zwart G, Ridder de C (1998) Genetic diversity of the
biofilm covering Montacuta ferruginosa (Mollusca, bivalvia) as evaluated by denaturing
gradient gel electrophoresis analysis and cloning of PCR-amplified gene fragments
coding for 16S rRNA. Appl Environ Microbiol 64: 3464-3472.
050. Gmr R, Thurnheer T (2002) Direct quantitative differentiation between Prevotella
intermedia and Prevotella nigrescens in clinical specimens. Microbiology 148: 1379-
1387.
051. Gmr R, Wyss C, Xue Y, Thurnheer T, Guggenheim B (2004) Gingival crevice
microbiota from Chinese patients with gingivitis or necrotizing ulcerative gingivitis.
Eur J Oral Sci 112: 33-41.
052. Gmr R, Lthi-Schaller H (2007) A combined immunofluorescence and fluorescent in
situ hybridization assay for single cell analyses of dental plaque microorganisms. J
Microbiol Methods 69: 402-405.
053. Greenstein G, Lamster I (1997) Bacterial transmission in periodontal diseases: a
critical review. J Periodontol 68: 421-431.
054. Guggenheim M, Shapiro S, Gmr R, Guggenheim B (2001) Spatial arrangements and
associative behavior of species in an in vitro oral biofilm model. Appl Environ
Microbiol 67: 1343-1350.
REFERENCE LIST
055. Haffajee AD, Socransky SS (1994) Microbial etiological agents of destructive

periodontal diseases. Periodontol 2000 5: 78-111.
056. Haffajee AD, Cugini MA, Dibart S, Smith C, Kent RL, Jr. et al. (1997) The effect of
SRP on the clinical and microbiological parameters of periodontal diseases. J Clin
057. Hannig C, Hannig M, Rehmer O, Braun G, Hellwig E et al. (2007) Fluorescence
microscopic visualization and quantification of initial bacterial colonization on enamel
in situ. Arch Oral Biol 52: 1048-1056.
058. Hart TC, Kornman KS (1997) Genetic factors in the pathogenesis of periodontitis.
Periodontol 2000 14: 202-215.
059. Hugenholtz P, Hooper SD, Kyrpides NC (2009) Focus: Synergistetes. Environ Microbiol
11: 1327-1329.
060. Hugoson A, Norderyd O (2008) Has the prevalence of periodontitis changed during the
last 30 years? J Clin Periodontol 35: 338-345.
061. Hujoel PP, Lo H, Anerud A, Boysen H, Leroux BG (1999) The informativeness of
attachment loss on tooth mortality. J Periodontol 70: 44-48.
062. Humphrey SP, Williamson RT (2001) A review of saliva: normal composition, flow,
and function. J Prosthet Dent 85: 162-169.
063. Hutter G, Schlagenhauf U, Valenza G, Horn M, Burgemeister S et al. (2003)
Molecular analysis of bacteria in periodontitis: evaluation of clone libraries, novel
phylotypes and putative pathogens. Microbiology 149: 67-75.
064. Ide M, Jagdev D, Coward PY, Crook M, Barclay GR et al. (2004) The short-term
effects of treatment of chronic periodontitis on circulating levels of endotoxin, C-
reactive protein, tumor necrosis factor-alpha, and interleukin-6. J Periodontol 75:
420-428.
065. Ihalin R, Asikainen S (2006) 16S rDNA PCR-denaturing gradient gel electrophoresis in
determining proportions of coexisting Actinobacillus actinomycetemcomitans strains.
J Microbiol Methods 65: 417-424.
066. Jalava J, Eerola E (1999) Phylogenetic analysis of Fusobacterium alocis and
Fusobacterium sulci based on 16S rRNA gene sequences: proposal of Filifactor alocis
(Cato, Moore and Moore) comb. nov. and Eubacterium sulci (Cato, Moore and Moore)
comb. nov. Int J Syst Bacteriol 49 Pt 4: 1375-1379.
067. Jefferson KK (2004) What drives bacteria to produce a biofilm? FEMS Microbiol Lett
236: 163-173.
068. Jenkinson HF, Dymock D (1999) The microbiology of periodontal disease. Dent
147
CHAPTER 10
Update 26: 191-197.

069. Jerve-Storm PM, Semaan E, Alahdab H, Engel S, Fimmers R et al. (2006) Clinical
outcomes of quadrant root planing versus full-mouth root planing. J Clin Periodontol
33: 209-215.
070. Jerve-Storm PM, Alahdab H, Semaan E, Fimmers R, Jepsen S (2007) Microbiological
outcomes of quadrant versus full-mouth root planing as monitored by real-time PCR. J
Clin Periodontol 34: 156-163.
071. Kampinga GA, Bollen AE, Harmsen HJ, de Vries-Hospers HG (2002) [Meningitis
after a superficial dog bite]. Ned Tijdschr Geneeskd 146: 73-76.
072. Kaplan JB, Schreiner HC, Furgang D, Fine DH (2002) Population structure and genetic
diversity of Actinobacillus actinomycetemcomitans strains isolated from localized
juvenile periodontitis patients. J Clin Microbiol 40: 1181-1187.
073. Kempf VA, Trebesius K, Autenrieth IB (2000) Fluorescent In situ hybridization allows
rapid identification of microorganisms in blood cultures. J Clin Microbiol 38: 830-838.
074. Kigure T, Saito A, Seida K, Yamada S, Ishihara K et al. (1995) Distribution of
Porphyromonas gingivalis and Treponema denticola in human subgingival plaque at
different periodontal pocket depths examined by immunohistochemical methods. J
Periodontal Res 30: 332-341.
075. Kinane DF, Hart TC (2003) Genes and gene polymorphisms associated with
periodontal disease. Crit Rev Oral Biol Med 14: 430-449.
076. Kinane DF, Attstrm R (2005) Advances in the pathogenesis of periodontitis. Group B
consensus report of the fifth European Workshop in Periodontology. J Clin Periodontol
32 Suppl 6: 130-131.
077. Kisand V, Wikner J (2003) Limited resolution of 16S rDNA DGGE caused by melting
properties and closely related DNA sequences. J Microbiol Methods 54: 183-191.
078. Kleinberg I (2002) A mixed-bacteria ecological approach to understanding the role of
the oral bacteria in dental caries causation: an alternative to Streptococcus mutans
and the specific-plaque hypothesis. Crit Rev Oral Biol Med 13: 108-125.
079. Kolenbrander PE, London J (1993) Adhere today, here tomorrow: oral bacterial
adherence. J Bacteriol 175: 3247-3252.
080. Kolenbrander PE, Andersen RN, Blehert DS, Egland PG, Foster JS et al. (2002)
Communication among oral bacteria. Microbiol Mol Biol Rev 66: 486-505.
081. Kolenbrander PE, Palmer RJ, Jr., Rickard AH, Jakubovics NS, Chalmers NI et al.
(2006) Bacterial interactions and successions during plaque development. Periodontol
2000 42: 47-79.
148
REFERENCE LIST
082. Koshy G, Kawashima Y, Kiji M, Nitta H, Umeda M et al. (2005) Effects of single-visit
full-mouth ultrasonic debridement versus quadrant-wise ultrasonic debridement. J Clin
083. Knnen E (1999) Oral colonization by anaerobic bacteria during childhood: role in
health and disease. Oral Dis 5: 278-285.
084. Kroes I, Lepp PW, Relman DA (1999) Bacterial diversity within the human subgingival
crevice. Proc Natl Acad Sci U S A 96: 14547-14552.
085. Lai CH, Listgarten MA, Rosan B (1975) Immunoelectron microscopic identification
and localization of Streptococcus sanguis with peroxidase-labeled antibody:
localization of Streptococcus sanguis in intact dental plaque. Infect Immun 11: 200-
210.
086. Lamont RJ, Jenkinson HF (1998) Life below the gum line: pathogenic mechanisms of
Porphyromonas gingivalis. Microbiol Mol Biol Rev 62: 1244-1263.
087. Lang NP, Tan WC, Krahenmann MA, Zwahlen M (2008) A systematic review of the
effects of full-mouth debridement with and without antiseptics in patients with
chronic periodontitis. J Clin Periodontol 35: 8-21.
088. Langendijk-Genevaux PS, Grimm WD, Hoeven van der JS (2001) Sulfate-reducing
bacteria in relation with other potential periodontal pathogens. J Clin Periodontol 28:
1151-1157.
089. Ledder RG, Gilbert P, Huws SA, Aarons L, Ashley MP et al. (2007) Molecular
analysis of the subgingival microbiota in health and disease. Appl Environ Microbiol
73: 516-523.
090. Lee DH, Zo YG, Kim SJ (1996) Nonradioactive method to study genetic profiles of
natural bacterial communities by PCR-single-strand-conformation polymorphism. Appl
Environ Microbiol 62: 3112-3120.
091. Lee MK, Ide M, Coward PY, Wilson RF (2008) Effect of ultrasonic debridement using
a chlorhexidine irrigant on circulating levels of lipopolysaccharides and interleukin-6. J
092. Li J, Helmerhorst EJ, Leone CW, Troxler RF, Yaskell T et al. (2004) Identification of
early microbial colonizers in human dental biofilm. J Appl Microbiol 97: 1311-1318.
093. Listgarten MA, Mayo HE, Tremblay R (1975) Development of dental plaque on epoxy
resin crowns in man. A light and electron microscopic study. J Periodontol 46: 10-26.
094. Listgarten MA (1976) Structure of the microbial flora associated with periodontal
health and disease in man. A light and electron microscopic study. J Periodontol 47:
1-18.
149
CHAPTER 10
095. Loesche WJ, Grossman NS (2001) Periodontal disease as a specific, albeit chronic,
infection: diagnosis and treatment. Clin Microbiol Rev 14: 727-52.
096. Lo H, Silness J (1963) Periodontal disease in pregnancy. I. prevalence and severity.
Acta Odontol Scand 21: 533-551.
097. Lo H, Theilade E, Jensen SB (1965) Experimental gingivitis in man. J Periodontol 36:
177-187.
098. Ludwig W, Strunk O, Klugbauer S, Klugbauer N, Weizenegger M et al. (1998)
Bacterial phylogeny based on comparative sequence analysis. Electrophoresis 19:
554-568.
099. Ludwig W, Strunk O, Westram R, Richter L, Meier H et al. (2004) ARB: a software
environment for sequence data. Nucleic Acids Res 32: 1363-1371.
100. Madianos PN, Bobetsis YA, Kinane DF (2005) Generation of inflammatory stimuli:
how bacteria set up inflammatory responses in the gingiva. J Clin Periodontol 32
Suppl 6: 57-71.
101. Magnusson I, Listgarten MA (1980) Histological evaluation of probing depth following
periodontal treatment. J Clin Periodontol 7: 26-31.
102. Maidak BL, Cole JR, Lilburn TG, Parker CT, Jr., Saxman PR et al. (2000) The RDP
(Ribosomal Database Project) continues. Nucleic Acids Res 28: 173-174.
103. Manz W, Amann R, Ludwig W, Vancanneyt M, Schleifer KH (1996) Application of a
suite of 16S rRNA-specific oligonucleotide probes designed to investigate bacteria of
the phylum cytophaga-flavobacter-bacteroides in the natural environment. Microbiology
142: 1097-1106.
104. Mombelli A, Gmr R, Gobbi C, Lang NP (1994) Actinobacillus
actinomycetemcomitans in adult periodontitis. II. Characterization of isolated strains
and effect of mechanical periodontal treatment. J Periodontol 65: 827-834.
105. Moore WE, Moore LV (1994) The bacteria of periodontal diseases. Periodontol 2000
5: 66-77.
106. Moter A, Hoenig C, Choi BK, Riep B, Gbel UB (1998) Molecular epidemiology of oral
treponemes associated with periodontal disease. J Clin Microbiol 36: 1399-1403.
107. Moter A, Gbel UB (2000) Fluorescence in situ hybridization (FISH) for direct
visualization of microorganisms. J Microbiol Methods 41: 85-112.
108. Muyzer G, Waal de EC, Uitterlinden AG (1993) Profiling of complex microbial
populations by denaturing gradient gel electrophoresis analysis of polymerase chain
reaction-amplified genes coding for 16S rRNA. Appl Environ Microbiol 59: 695-700.
109. Muyzer G, Smalla K (1998) Application of denaturing gradient gel electrophoresis
150
REFERENCE LIST
(DGGE) and temperature gradient gel electrophoresis (TGGE) in microbial ecology.

Antonie Van Leeuwenhoek 73: 127-141.
110. Muyzer G., Brinkhoff, T., Nbel, U., Santegoeds, C., Schafer, H., & Wawer, C.
(1998) in Molecular Microbial Ecology Manual, eds. Akkermans, A. D., van Elzas, J.
D., de Bruijn, F. T., & ed (Kluwer Academic Publishers, Dordrecht, The Netherlands),
pp. 1-27.
111. Mhling M, Woolven-Allen J, Murrell JC, Joint I (2008) Improved group-specific PCR
primers for denaturing gradient gel electrophoresis analysis of the genetic diversity of
complex microbial communities. ISME J 2: 379-392.
112. Netuschil L, Reich E, Unteregger G, Sculean A, Brecx M (1998) A pilot study of
confocal laser scanning microscopy for the assessment of undisturbed dental plaque
vitality and topography. Arch Oral Biol 43: 277-285.
113. Newman MG, Marinho VC (1994) Assessing bacterial risk factors for periodontitis
and peri-implantitis: using evidence to enhance outcomes. Compendium 15: 958,
960, 962.
114. Noiri Y, Ozaki K, Nakae H, Matsuo T, Ebisu S (1997) An immunohistochemical study
on the localization of Porphyromonas gingivalis, Campylobacter rectus and
Actinomyces viscosus in human periodontal pockets. J Periodontal Res 32: 598-607.
115. Noiri Y, Li L, Ebisu S (2001) The localization of periodontal-disease-associated
bacteria in human periodontal pockets. J Dent Res 80: 1930-1934.
116. Nbel U, Engelen B, Felske A, Snaidr J, Wieshuber A et al. (1996) Sequence
heterogeneities of genes encoding 16S rRNAs in Paenibacillus polymyxa detected by
temperature gradient gel electrophoresis. J Bacteriol 178: 5636-5643.
117. NvvP (2010) Uw tandvlees krijgt een cijfer. Folder.
118. OBrien-Simpson NM, Veith PD, Dashper SG, Reynolds EC (2003) Porphyromonas
gingivalis gingipains: the molecular teeth of a microbial vampire. Curr Protein Pept Sci
4: 409-426.
119. OLeary TJ (1986) The impact of research on scaling and root planing. J Periodontol
57: 69-75.
120. Oringer RJ (2002) Modulation of the host response in periodontal therapy. J
121. Page RC (1991) The role of inflammatory mediators in the pathogenesis of periodontal
disease. J Periodontal Res 26: 230-242.
122. Page RC, Offenbacher S, Schroeder HE, Seymour GJ, Kornman KS (1997) Advances
in the pathogenesis of periodontitis: summary of developments, clinical implications
151
CHAPTER 10
and future directions. Periodontol 2000 14: 216-248.

123. Page RC, Kornman KS (1997) The pathogenesis of human periodontitis: an
introduction. Periodontol 2000 14: 9-11.
124. Page RC (2000) Vaccination and periodontitis: myth or reality. J Int Acad Periodontol
2: 31-43.
125. Paju S, Carlson P, Jousimies-Somer H, Asikainen S (2000) Heterogeneity of
Actinobacillus actinomycetemcomitans strains in various human infections and
relationships between serotype, genotype, and antimicrobial susceptibility. J Clin
126. Palmer Jr RJ, Gordon SM, Cisar JO, Kolenbrander PE (2003) Coaggregation-mediated
interactions of streptococci and actinomyces detected in initial human dental plaque. J
Bacteriol 185: 3400-3409.
127. Palmer RM, Wilson RF, Hasan AS, Scott DA (2005) Mechanisms of action of
environmental factors-tobacco smoking. J Clin Periodontol 32 Suppl 6: 180-195.
128. Papapanou PN, Behle JH, Kebschull M, Celenti R, Wolf DL et al. (2009) Subgingival
bacterial colonization profiles correlate with gingival tissue gene expression. BMC
Microbiol 9: 221.
129. Parahitiyawa NB, Jin LJ, Leung WK, Yam WC, Samaranayake LP (2009) Microbiology
of odontogenic bacteremia: beyond endocarditis. Clin Microbiol Rev 22: 46-64.
130. Paster BJ, Boches SK, Galvin JL, Ericson RE, Lau CN et al. (2001) Bacterial diversity
in human subgingival plaque. J Bacteriol 183: 3770-3783.
131. Pawlowski AP, Chen A, Hacker BM, Mancl LA, Page RC et al. (2005) Clinical effects
of scaling and root planing on untreated teeth. J Clin Periodontol 32: 21-28.
132. Pedrazzoli V, Kilian M, Karring T, Kirkegaard E (1991) Effect of surgical and non-
surgical periodontal treatment on periodontal status and subgingival microbiota. J Clin
133. Pruesse E, Quast C, Knittel K, Fuchs BM, Ludwig W et al. (2007) SILVA: a
comprehensive online resource for quality checked and aligned ribosomal RNA
sequence data compatible with ARB. Nucleic Acids Res 35: 7188-7196.
134. Quirynen M, Bollen CM, Vandekerckhove BN, Dekeyser C, Papaioannou W et al.
(1995) Full- vs. partial-mouth disinfection in the treatment of periodontal infections:
short-term clinical and microbiological observations. J Dent Res 74: 1459-1467.
135. Quirynen M, Papaioannou W, Steenberghe van D (1996) Intraoral transmission and
the colonization of oral hard surfaces. J Periodontol 67: 986-993.
136. Quirynen M, Mongardini C, Soete de M, Pauwels M, Coucke W et al. (2000) The role
152
REFERENCE LIST
of chlorhexidine in the one-stage full-mouth disinfection treatment of patients with

advanced adult periodontitis. Long-term clinical and microbiological observations. J
137. Quirynen M, Soete de M, Dierickx K, Steenberghe van D (2001) The intra-oral
translocation of periodontopathogens jeopardises the outcome of periodontal therapy.
A review of the literature. J Clin Periodontol 28: 499-507.
138. Quirynen M, Soete de M, Boschmans G, Pauwels M, Coucke W et al. (2006) Benefit
of one-stage full-mouth disinfection is explained by disinfection and root planing
within 24 hours: a randomized controlled trial. J Clin Periodontol 33: 639-647.
139. Reese S, Guggenheim B (2007) A novel TEM contrasting technique for extracellular
polysaccharides in in vitro biofilms. Microsc Res Tech 70: 816-822.
140. Reynaud AH, Nygaard-Ostby B, Boygard GK, Eribe ER, Olsen I et al. (2001) Yeasts in
periodontal pockets. J Clin Periodontol 28: 860-864.
141. Reynolds JJ, Meikle MC (1997) Mechanisms of connective tissue matrix destruction
in periodontitis. Periodontol 2000 14: 144-157.
142. Reynolds MA, Dawson DR, Novak KF, Ebersole JL, Gunsolley JC et al. (2009) Effects
of caloric restriction on inflammatory periodontal disease. Nutrition 25: 88-97.
143. Rhemrev GE, Timmerman MF, Veldkamp I, Winkelhoff van AJ, Velden van der U
(2006) Immediate effect of instrumentation on the subgingival microflora in deep
inflamed pockets under strict plaque control. J Clin Periodontol 33: 42-48.
144. Riggio MP, Lennon A, Roy KM (1998) Detection of Prevotella intermedia in subgingival
plaque of adult periodontitis patients by polymerase chain reaction. J Periodontal Res
33: 369-376.
145. Riggio MP, Lennon A, Smith A (2001) Detection of Peptostreptococcus micros DNA
in clinical samples by PCR. J Med Microbiol 50: 249-254.
146. Ritz HL (1967) Microbial population shifts in developing human dental plaque. Arch
Oral Biol 12: 1561-1568.
147. Rodenburg JP, Winkelhoff van AJ, Winkel EG, Goene RJ, Abbas F et al. (1990)
Occurrence of Bacteroides gingivalis, Bacteroides intermedius and Actinobacillus
actinomycetemcomitans in severe periodontitis in relation to age and treatment
history. J Clin Periodontol 17: 392-399.
148. Rogers AH, Pfennig AL, Gully NJ, Zilm PS (1991) Factors affecting peptide
catabolism by oral streptococci. Oral Microbiol Immunol 6: 72-75.
149. Saitou N, Nei M (1987) The neighbor-joining method: a new method for reconstructing
phylogenetic trees. Mol Biol Evol 4: 406-425.
153
CHAPTER 10
150. Sakamoto M, Umeda M, Ishikawa I, Benno Y (2000) Comparison of the oral bacterial
flora in saliva from a healthy subject and two periodontitis patients by sequence
analysis of 16S rDNA libraries. Microbiol Immunol 44: 643-652.
151. Salvi GE, Lawrence HP, Offenbacher S, Beck JD (1997) Influence of risk factors on
the pathogenesis of periodontitis. Periodontol 2000 14: 173-201.
152. Salvi GE, Carollo-Bittel B, Lang NP (2008) Effects of diabetes mellitus on periodontal
and peri-implant conditions: update on associations and risks. J Clin Periodontol 35:
398-409.
153. Sanguinetti CJ, Dias NE, Simpson AJ (1994) Rapid silver staining and recovery of
PCR products separated on polyacrylamide gels. Biotechniques 17: 914-921.
154. Sanz M, Teughels W (2008) Innovations in non-surgical periodontal therapy:
Consensus Report of the Sixth European Workshop on Periodontology. J Clin
155. Satokari RM, Vaughan EE, Akkermans AD, Saarela M, Vos de WM (2001)
Bifidobacterial diversity in human feces detected by genus-specific PCR and
denaturing gradient gel electrophoresis. Appl Environ Microbiol 67: 504-513.
156. Savitt ED, Darack AP, Killoy WJ, Lieberman MG (1991) Site selection criteria for
microbiological testing of periodontal microorganisms. J Periodontol 62: 558-561.
157. Scannapieco FA (1994) Saliva-bacterium interactions in oral microbial ecology. Crit
Rev Oral Biol Med 5: 203-248.
158. Schabereiter-Gurtner C, Maca S, Rlleke S, Nigl K, Lukas J et al. (2001) 16S rDNA-
based identification of bacteria from conjunctival swabs by PCR and DGGE
fingerprinting. Invest Ophthalmol Vis Sci 42: 1164-1171.
159. Schwartz Z, Goultschin J, Dean DD, Boyan BD (1997) Mechanisms of alveolar bone
destruction in periodontitis. Periodontol 2000 14: 158-172.
160. Sharma A, Inagaki S, Sigurdson W, Kuramitsu HK (2005) Synergy between Tannerella
forsythia and Fusobacterium nucleatum in biofilm formation. Oral Microbiol Immunol
20: 39-42.
161. Shiloah J, Patters MR (1996) Repopulation of periodontal pockets by microbial
pathogens in the absence of supportive therapy. J Periodontol 67: 130-139.
162. Silness J, Lo H (1964) Periodontal disease in pregnancy. II. Correlation between oral
hygiene and periodontal condition. Acta Odontol Scand 22: 121-135.
163. Siqueira JF, Rocas IN, Uzeda de M, Colombo AP, Santos KR (2002) Comparison of
16S rDNA-based PCR and checkerboard DNA-DNA hybridisation for detection of
selected endodontic pathogens. J Med Microbiol 51: 1090-1096.
154
REFERENCE LIST
164. Siqueira JF, Jr., Sen BH (2004) Fungi in endodontic infections. Oral Surg Oral Med
Oral Pathol Oral Radiol Endod 97: 632-641.
165. Siqueira JF, Jr., Rocas IN, Rosado AS (2004) Investigation of bacterial communities
associated with asymptomatic and symptomatic endodontic infections by denaturing
gradient gel electrophoresis fingerprinting approach. Oral Microbiol Immunol 19: 363-370.
166. Sissons CH (1997) Artificial dental plaque biofilm model systems. Adv Dent Res 11:
110-126.
167. Slots J, Mashimo P, Levine MJ, Genco RJ (1979) Periodontal therapy in humans. I.
Microbiological and clinical effects of a single course of periodontal scaling and root
planing, and of adjunctive tetracycline therapy. J Periodontol 50: 495-509.
168. Slots J (1982) Selective medium for isolation of Actinobacillus
actinomycetemcomitans. J Clin Microbiol 15: 606-609.
169. Slots J, Ting M (1999) Actinobacillus actinomycetemcomitans and Porphyromonas
gingivalis in human periodontal disease: occurrence and treatment. Periodontol 2000
20: 82-121.
170. Slots J (2000) Primer for antimicrobial periodontal therapy. J Periodontal Res 35:
108-114.
171. Socransky SS, Haffajee AD, Cugini MA, Smith C, Kent RL, Jr. (1998) Microbial
complexes in subgingival plaque. J Clin Periodontol 25: 134-144.
172. Socransky SS, Haffajee AD (2002) Dental biofilms: difficult therapeutic targets.
Periodontol 2000 28: 12-55.
173. Socransky SS, Haffajee AD (2005) Periodontal microbial ecology. Periodontol 2000
38: 135-187.
174. Soete de M, Dekeyser C, Pauwels M, Teughels W, Steenberghe van D et al. (2005)
Increase in cariogenic bacteria after initial periodontal therapy. J Dent Res 84: 48-53.
175. Speksnijder AG, Kowalchuk GA, Jong de S, Kline E, Stephen JR et al. (2001)
Microvariation artifacts introduced by PCR and cloning of closely related 16S rRNA
gene sequences. Appl Environ Microbiol 67: 469-472.
176. Spratt DA, Weightman AJ, Wade WG (1999) Diversity of oral asaccharolytic
Eubacterium species in periodontitisidentification of novel phylotypes representing
uncultivated taxa. Oral Microbiol Immunol 14: 56-59.
177. Stach JE, Maldonado LA, Ward AC, Goodfellow M, Bull AT (2003) New primers for
the class Actinobacteria: application to marine and terrestrial environments. Environ
178. Steenbergen van TJ, Mispel van der LM, Graaff de J (1986) Effects of ammonia and
155
CHAPTER 10
volatile fatty acids produced by oral bacteria on tissue culture cells. J Dent Res 65:
909-912.
179. Stephen JR, Chang YJ, Macnaughton SJ, Kowalchuk GA, Leung KT et al. (1999)
Effect of toxic metals on indigenous soil beta-subgroup proteobacterium ammonia
oxidizer community structure and protection against toxicity by inoculated metal-
resistant bacteria. Appl Environ Microbiol 65: 95-101.
180. Suchett-Kaye G, Morrier JJ, Barsotti O (1998) Interactions between non-immune host
cells and the immune system during periodontal disease: role of the gingival
keratinocyte. Crit Rev Oral Biol Med 9: 292-305.
181. Sunde PT, Olsen I, Gbel UB, Theegarten D, Winter S et al. (2003) Fluorescence in
situ hybridization (FISH) for direct visualization of bacteria in periapical lesions of
asymptomatic root-filled teeth. Microbiology 149: 1095-1102.
182. Swierkot K, Nonnenmacher CI, Mutters R, Flores-de-Jacoby L, Mengel R (2009) One-
stage full-mouth disinfection versus quadrant and full-mouth root planing. J Clin
183. Syed SA, Loesche WJ (1972) Survival of human dental plaque flora in various
transport media. Appl Microbiol 24: 638-644.
184. Takahashi N, Yamada T (1999) Glucose and lactate metabolism by Actinomyces
naeslundii. Crit Rev Oral Biol Med 10: 487-503.
185. Teles RP, Haffajee AD, Socransky SS (2006) Microbiological goals of periodontal
therapy. Periodontol 2000 42: 180-218.
186. Timmerman MF, Weijden van der GA, Abbas F, Arief EM, Armand S et al. (2000)
Untreated periodontal disease in Indonesian adolescents. Longitudinal clinical data and
prospective clinical and microbiological risk assessment. J Clin Periodontol 27: 932-
942.
187. Tomasi C, Leyland AH, Wennstrom JL (2007) Factors influencing the outcome of non-
surgical periodontal treatment: a multilevel approach. J Clin Periodontol 34: 682-690.
188. Tonetti MS, Claffey N (2005) Advances in the progression of periodontitis and
proposal of definitions of a periodontitis case and disease progression for use in risk
factor research. Group C consensus report of the 5th European Workshop in
Periodontology. J Clin Periodontol 32 Suppl 6: 210-213.
189. Vartoukian SR, Palmer RM, Wade WG (2009) Diversity and morphology of members
of the phylum Synergistetes in periodontal health and disease. Appl Environ
Microbiol 75: 3777-3786.
190. Velden van der U, Jansen J (1980) Probing force in relation to probe penetration into
156
REFERENCE LIST
the periodontal tissues in dogs. A microscopic evaluation. J Clin Periodontol 7: 325-

327.
191. Velden van der U (1979) Probing force and the relationship of the probe tip to the
periodontal tissues. J Clin Periodontol 6: 106-114.
192. Velden van der U, Winkelhoff van AJ, Abbas F, Graaff de J (1986) The habitat of
periodontopathic micro-organisms. J Clin Periodontol 13: 243-248.
193. Wade WG, Spratt DA, Dymock D, Weightman AJ (1997) Molecular detection of novel
anaerobic species in dentoalveolar abscesses. Clin Infect Dis 25 Suppl 2: S235-
S236.
194. Wang D, Koshy G, Nagasawa T, Kawashima Y, Kiji M et al. (2006) Antibody
response after single-visit full-mouth ultrasonic debridement versus quadrant-wise
therapy. J Clin Periodontol 33: 632-638.
195. Watanabe K, Kodama Y, Harayama S (2001) Design and evaluation of PCR primers to
amplify bacterial 16S ribosomal DNA fragments used for community fingerprinting.
J Microbiol Methods 44: 253-262.
196. Wecke J, Kersten T, Madela K, Moter A, Gbel UB et al. (2000) A novel technique
for monitoring the development of bacterial biofilms in human periodontal pockets.
FEMS Microbiol Lett 191: 95-101.
197. Wennstrm JL, Tomasi C, Bertelle A, Dellasega E (2005) Full-mouth ultrasonic
debridement versus quadrant scaling and root planing as an initial approach in the
treatment of chronic periodontitis. J Clin Periodontol 32: 851-859.
198. Whittaker CJ, Klier CM, Kolenbrander PE (1996) Mechanisms of adhesion by oral
bacteria. Annu Rev Microbiol 50: 513-552.
199. Wickstrm C, Herzberg MC, Beighton D, Svensater G (2009) Proteolytic degradation
of human salivary MUC5B by dental biofilms. Microbiology 155: 2866-2872.
200. Wildeboer-Veloo AC, Harmsen HJ, Welling GW, Degener JE (2007) Development of
16S rRNA-based probes for the identification of Gram-positive anaerobic cocci
isolated from human clinical specimens. Clin Microbiol Infect 13: 985-992.
201. Williams RC (1993) Periodontal diseases: gingivitis, juvenile periodontitis, adult
periodontitis. Curr Clin Top Infect Dis 13: 146-163.
202. Wimmer G, Kohldorfer G, Mischak I, Lorenzoni M, Kallus KW (2005) Coping with
stress: its influence on periodontal therapy. J Periodontol 76: 90-98.
203. Winkel EG, Winkelhoff van AJ, Timmerman MF, Velden van der U, Weijden van der
GA (2001) Amoxicillin plus metronidazole in the treatment of adult periodontitis
patients. A double-blind placebo-controlled study. J Clin Periodontol 28: 296-305.
157
CHAPTER 10
204. Winkelhoff van AJ, Velden van der U, Winkel EG, Graaff de J (1986) Black-pigmented
Bacteroides and motile organisms on oral mucosal surfaces in individuals with and
without periodontal breakdown. J Periodontal Res 21: 434-439.
205. Winkelhoff van AJ, Velden van der U, Graaff de J (1988) Microbial succession in
recolonizing deep periodontal pockets after a single course of supra- and subgingival
debridement. J Clin Periodontol 15: 116-122.
206. Winkelhoff van AJ, Winkel EG (2009) Antibiotics in periodontics: right or wrong?
J Periodontol 80: 1555-1558.
207. Wood SR, Kirkham J, Marsh PD, Shore RC, Nattress B et al. (2000) Architecture of
intact natural human plaque biofilms studied by confocal laser scanning microscopy. J
Dent Res 79: 21-27.
208. Wyss C (1989) Dependence of proliferation of Bacteroides forsythus on exogenous N-
acetylmuramic acid. Infect Immun 57: 1757-1759.
209. Ximenez-Fyvie LA, Haffajee AD, Socransky SS (2000) Comparison of the microbiota
of supra- and subgingival plaque in health and periodontitis. J Clin Periodontol 27:
648-657.
210. Yang HW, Huang YF, Chan Y, Chou MY (2005) Relationship of Actinobacillus
actinomycetemcomitans serotypes to periodontal condition: prevalence and
proportions in subgingival plaque. Eur J Oral Sci 113: 28-33.
211. Yao Y, Berg EA, Costello CE, Troxler RF, Oppenheim FG (2003) Identification of
protein components in human acquired enamel pellicle and whole saliva using novel
proteomics approaches. J Biol Chem 278: 5300-5308.
212. Zaura-Arite E, Marle van J, Cate ten JM (2001) Conofocal microscopy study of
undisturbed and chlorhexidine-treated dental biofilm. J Dent Res 80: 1436-1440.
213. Zijnge V, Harmsen HJ, Kleinfelder JW, Rest van der ME, Degener JE et al. (2003)
Denaturing gradient gel electrophoresis analysis to study bacterial community
structure in pockets of periodontitis patients. Oral Microbiol Immunol 18: 59-65.
214. Zijnge V, Welling GW, Degener JE, Winkelhoff van AJ, Abbas F et al. (2006)
Denaturing gradient gel electrophoresis as a diagnostic tool in periodontal
microbiology. J Clin Microbiol 44: 3628-3633.
215. Zger J, Lthi-Schaller H, Gmr R (2007) Uncultivated Tannerella BU045 and BU063
are slim segmented filamentous rods of high prevalence but low abundance in
inflammatory disease-associated dental plaques. Microbiology 153: 3809-3816.
158
CHAPTER 10
160

11complete Microbial Dynamics in Subgingival Biofilms

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

11complete Microbial Dynamics in Subgingival Biofilms

Uploaded by

Copyright:

Available Formats

Microbial dynamics

ter verkrijging van het doctoraat in de

geboren op 20 oktober 1976

Copromotor: Dr. Ir. HJM Harmsen

Beoordelingscommissie: Prof. dr. AJ van Winkelhoff

Chapter 01 General introduction 009

Chapter 02 Denaturing gradient gel electrophoresis analysis 025

Chapter 03 Denaturing gradient gel electrophoresis as a 041

Chapter 04 Microbial population dynamics of subgingival pockets after 059

Chapter 05 Oral biofilm architecture on natural teeth 079

Chapter 06 The recolonization hypothesis in a full-mouth or quadrant- 099

Chapter 07 General discussion 119

Chapter 08 Summary 129

Chapter 09 Samenvatting 135

Chapter 10 Reference list 141

This chapter is based on:

Strength in numbers; illness causing biofilms

Zijnge V, Abbas F, Degener JE

Nederlands Tijdschrift voor Tandheelkunde (2008) 115: 5-12

The oral cavity

Periodontal pathogenesis model.

PGE2, IgG, IL-1 Smoking

Connective Clinical signs

Figure 1.3. Periodontal pathogenesis model. Polymorphnuclear leukocyte (PMN), prostaglandin E2

Bacterial mass on the teeth

The localization of most bacteria in mature supragingival plaque or subgingival plaque

Figure 1.5. Electron microscopic view of

Periodontal connective tissue and bone metabolism.

TNF- have antagonistic effects on osteoblast and osteoclast activity. Osteoblasts

Aim of the thesis

Hence, the aim of the present thesis is four-fold:

The introduction of Denaturing gradient gel electrophoresis (DGGE) in micro-

different species display different migration patterns after electrophoresis on a gel

Zijnge V, Harmsen HJM, van der Rest ME, Degener

Oral Microbiology and Immunology (2003) 18: 59-65

Periodontal diseases refer to inflammatory processes leading to destruction of

DGGE facilitates profiling of mixed microbial populations by the separation of amplified

Separation of 16S rRNA gene fragments on a polyacrylamide gel containing a linearly

MATERIALS AND METHODS

Clinical and radiographic assessments

Analysis of the DGGE profiles

Excision and sequence analysis of products

Figure 2.1. PCR-DGGE profiles representing the bacterial diversity

Sample Total number of bands Coefficient of similarity (Cs) (%)

Nucleotide sequence accession numbers

Table 2.3. Closest relative as determined by comparative sequence analysis, percentage

Filifactor alocis 1* 096 385 AJ428517

Uncultured Eubacterium pus 9.170 2 086 -

Exiguobacterium aurantiacum 3*,4,7,8,12 098 379 AJ428516

Campylobacter rectus 5 046 -

Campylobacter rectus 6 055 -

Actinomyces israelii 9* 100 381 AJ428518

Actinobacillus actinomycetemcomitans 10*,11 100 379 AJ428519

Desulfovibrio fairfieldensis 13 090 -

*These bands have been submitted to GenBank.

Elucidation of whether periodontal disease is the result of plaque overgrowth or

gen Campylobacter and appeared in the microbial population after 3 months.

Zijnge V, Welling GW, Degener JE,

Bacteria play an important role in the initiation and progression of periodontal

Periodontal diseases are infectious inflammatory disorders caused by bacte-

MATERIALS AND METHODS

Organisms and culture conditions

Sammlung von Mikroorganismen und Zellkulturen (DSM strains; Braunschweig,

Pr ime r or pr obe Se que nc e s (5' -->3') Re fe r e nc e