Thalamus & Related Systems, 2008, 4(1), 59 –77.

#2008 Cambridge University Press

doi:10.1017/S1472928808000368 Printed in the United Kingdom

Anterior thalamic lesions produce chronic

and profuse transcriptional deregulation in
retrosplenial cortex: a model of retrosplenial
hypoactivity and covert pathology
g.l. poirier1,5, k.l. shires1,2,3,4,5, d. sugden3, e. amin1, k.l. thomas2,
d.a. carter2, and j.p. aggleton1
1
School of Psychology, 2School of Biosciences, Cardiff University, Cardiff, UK, 3Division of Reproduction and Endocrinology, School
of Biomedical and Health Sciences, King’s College, London, UK, 4Present address: Centre for Cognitive and Neural Systems, Dept of
Neuroscience, University of Edinburgh, UK and 5These authors contributed equally to this work

Anterior thalamic lesions are thought to produce ‘covert pathology’ in retrosplenial cortex, but the causes are unknown. Using
microarray analyses we tested the hypothesis that thalamic damage causes a chronic, hypofunction of metabolic and
plasticity-related pathways (Experiment 1). Rats with unilateral, anterior thalamic lesions were exposed to a novel environ-
ment for 20 min, and granular retrosplenial tissue sampled from both hemispheres 30 min, 2 hours and 8 hours later.
Complementary statistical approaches (analyses of variance, predictive patterning and gene set-enrichment analysis) revealed
pervasive gene expression differences between retrosplenial cortex ipsilateral to the thalamic lesion and contralateral to the
lesion. Selected gene differences were validated by QPCR, immunohistochemistry (Experiment 1) and in situ hybridization
(Experiment 2). Following thalamic lesions, the retrosplenial cortex undergoes profuse cellular transcriptome changes includ-
ing lower relative levels of specific mRNAs that are involved in energy metabolism and neuronal plasticity. These changes in
functional gene expression might be driven largely by decreases in the expression of genes encoding transcription factors
including brd8, c-fos, fra-2, klf5, nfix, nr4a1, smad3, smarcc2 and zfp9, with far fewer (nfat5, neuroD1 and RXRg)
showing increases. These findings have implications for conditions such as diencephalic amnesia and Alzheimer’s disease
in which both anterior thalamic pathology and retrosplenial cortex hypometabolism are prominent.

Keywords: Alzheimer’s disease, gene, microarray, pathology

INTRODUCTION impair retrosplenial function and, thereby, disrupt memory

There is a growing list of disorders that exhibit memory
impairments associated with dysfunction of the retrosple-
nial cortex. Such disorders include Alzheimer’s disease
(Minoshima et al., 1997; Nestor et al., 2003a), vascular demen-
tia (Martinez-Bisbal et al., 2004), diencephalic amnesia
(Aupée et al., 2001; Reed et al., 2003), hypoxia-induced
amnesia (Reed et al., 1999; Aupée et al., 2001), hypothyroid-
ism (Krausz et al., 2004), epilepsy (Archer et al., 2003) and
schizophrenia (Mitelman et al., 2003; Laurens et al., 2005;
Newell et al., 2005). In many of these disorders marked
hypoactivity of the retrosplenial cortex is apparent from
reductions in glucose utilization, regional cerebral blood
flow and blood-oxygen-level-dependent activity (Minoshima
et al., 1997; Reed et al., 1999; Aupée et al., 2001; Archer et al.,
2003; Nestor et al., 2003a; Reed et al., 2003; Krausz et al.,
2004; Martinez-Bisbal et al., 2004; Laurens et al., 2005). A poss-
ible explanation of these findings is that pathology in a site
directly connected to the retrosplenial cortex is sufficient to
Corresponding author:
G.L. Poirier and K.L. Shires
Emails: PoirierG@cardiff.ac.uk; kshires@staffmail.ed.ac.uk
processes.
The anterior thalamic nuclei (ATN) project densely on the
retrosplenial cortex (Vogt et al., 1981; van Groen et al., 1993)
and there is evidence that these two regions are functionally
interdependent (Sutherland and Hoesing, 1993). Furthermore,
pathology in the ATN is associated closely with diencephalic
amnesia (Valenstein et al., 1987; Aggleton and Sahgal, 1993;
Harding et al., 2000; Maguire, 2001; van der Werf et al.,
2003). Likewise, in Alzheimer’s disease ATN pathology is pro-
minent at early stages (Masliah et al., 1989; Braak and Braak,
1991a; Braak and Braak, 1991b) whereas the retrosplenial
region is often the first area to exhibit metabolic hypoactivity
(Minoshima, 1997; Kogure et al., 2000; Desgranges et al.,
2002; Matsuda et al., 2002; Drzezga et al., 2003; Nestor et al.,
2003a; Nestor et al., 2003b). Such findings indicate that anterior
thalamic damage might severely disrupt retrosplenial cortex
function, so linking these two regions in a shared set of neuro-
logical disorders, all of which display memory loss.
Additional evidence for this view comes from the finding
(van Groen et al., 1993) that large, unilateral thalamic
lesions decrease a marker of cell metabolism, cytochrome
oxidase, in granular retrosplenial cortex (Rgb). However, the
thalamic lesions in that study were very extensive, involving
many nuclei. More direct support comes from the finding

59
60 g.l. poirier et al.
that selective ATN lesions (Jenkins et al., 2004) produce a dra-
matic loss of the immediate-early gene (IEG) products of c-fos
and zif268 in Rgb, including a 90% reduction of c-Fos in
superficial Rgb (Jenkins et al., 2004). These changes were
striking because (1) they represented the greatest loss of IEG
products in any brain area, (2) they occurred even though
many other afferents to Rgb remained intact, (3) they are
selective because lesions to other input areas such as the
entorhinal cortex, the postrhinal cortex and the laterodorsal
thalamic nucleus do not produce such IEG losses in retrosple-
nial cortex (Albasser et al., 2007; Jenkins et al., 2004; Poirier
and Aggleton, 2006). Perhaps more remarkable is the
finding from a preliminary in vitro study that prior, unilateral
lesions of the ATN block the induction of long-term
depression (LTD) in slices of ipsilateral Rgb (Garden et al.,
2006). This loss of plasticity is confined to the superficial cor-
tical laminae and, hence, in register with the IEG changes, but
the microcircuits are intact in this preparation so the abnorm-
ality is not lack of an afferent signal (Garden et al., 2006).
These in vitro data also provide strong evidence for ‘covert
pathology’ (i.e. a functional lesion where pathology is not
detected by standard histological means) because there is no
overt pathology in the retrosplenial cortex following ATN
lesions (van Groen et al., 1993; Jenkins et al., 2004) and the
IEG hypoactivity seems to be permanent (Jenkins et al.,
2004). These recent findings indicate that the impact of
anterior thalamic damage might be amplified via covert pathol-
ogy in the retrosplenial cortex. In this study, lesions were placed
unilaterally in the ATN to compare retrosplenial cortices in the
‘Intact’ and ‘Lesioned’ hemispheres in a within-subjects design
that helped to restrict variance.
OBJECTIVES
In the present study we sought to identify candidate molecular
mechanisms that might result in permanent retrosplenial dys-
functions after ATN damage. Using microarray technology we
provide the first comprehensive map of gene expression
abnormalities in the retrosplenial cortex after ATN pathology.
Particular questions were how ATN lesions cause retrosplenial
cortex hypometabolism and disrupt plasticity-associated func-
tions. In Experiment 1, selected gene differences identified by
microarray were validated using quantitative polymerase
chain reaction (QPCR) and immunohistochemistry. In
Experiment 2, in situ hybridization was used to validate
used to validate one further gene, gabrd, which was selected
because GABA(A) activity is crucial for the regulation of glu-
tamatergic afferents to the cortex, such as those from ATN to
the retrosplenial cortex (Gonzalo-Ruiz et al., 1997; Ichinohe
and Rockland, 2002; Li et al., 2002).
METHODS
Both experiments examined the status of the granular retrosple-
nial cortex following a unilateral anterior thalamic lesion. The
principal data were derived from the microarray study
(Experiment 1), and findings verified for particular genes by
the use of immunohistochemistry (IHC, Experiment 1), QPCR
(Experiment 1) and in situ hybridization (Experiment 2).
All experiments were performed in accordance with the
UK Animals (Scientific Procedures) Act (1986) and associated
guidelines.
Experiment 1
subjects
Male pigmented rats (Dark Agouti strain; Harlan) were
housed in pairs under a 13 hour light/11 hour dark cycle
with ad libitum access to food and water. Each animal was
extensively habituated to handling. The weight of the
animals was monitored (212 –248 g at the time of surgery).
Surgery
Unilateral lesions were placed in the ATN because the projec-
tions to the retrosplenial cortex remain ipsilateral, which
makes it possible to make within-subject comparisons
between the ‘Lesion’ (ipsilateral to the thalamic lesion) and
the ‘Intact’ (contralateral to the thalamic lesion) hemispheres.
Excitotoxic lesions were made with the goal of minimizing
damage to fibers of passage.
Animals (n ¼ 12) were first anaesthetized with an intraper-
itoneal injection of pentobarbitone sodium (Sagatal,
75 mg kg21), and then placed in a stereotaxic frame (David
Kopf Instruments). A craniotomy was made over both hemi-
spheres. Excitotoxic lesions were produced by injecting
0.19 ml of 0.12 M N-methyl-D-aspartate (NMDA; Sigma)
made up in phosphate buffered saline (PBS), pH 7.2, into
two sites in the same hemisphere using a 1 ml syringe
(Hamilton). The stereotaxic coordinates were as follows:
anterio-posterior, 20.5 from bregma; medio-lateral, 1.0 and
1.7 from the midline; dorso-ventral, 26.3 and 25.7 from
the top of the dura for the medial and lateral injections,
respectively. The incisor bar was set at þ5.0. Antibiotic
powder (Aureomycin; Fort Dodge Animal Health) was sub-
sequently applied topically and all rats also received a subcu-
taneous injection (5 ml) of glucose saline. Paracetamol was
dissolved in the drinking water and rats were observed daily
until recovery. A period of six to nine weeks preceded tissue
sampling.
Behavioral procedures
Five days before tissue extraction, the animals were housed
individually. In order to minimize unwanted disruption the
rats were first habituated daily to a separate holding room
in which there were no other rats. At 24 hours before tissue
extraction the animals were placed in this new holding
room under the standard feeding regimen and light cycle.
The next day, the animals were individually placed for
20 min in a novel, larger cage with different flooring in a
novel environment of different dimensions and containing
different visual stimuli. The purpose of this manipulation
was to increase the likelihood of transcript expression, and
so minimize floor effects.
Retrosplenial tissue from animals with unilateral anterior
thalamic lesions was sampled at three times, 30 min, 2 hours
and 8 hours after the onset of exposure to the novel
environment (Fig. 1a), each at comparable times of day. The
three delays allowed changes to be detected in genes that are
expressed early and late after stimulation (e.g. Cavallaro
et al., 2002; Hong et al., 2004).
Anatomical nomenclature
The retrosplenial cortex of the rat (area 29) comprises two
major subregions, granular and dysgranular (Vogt and
Peters, 1981). The granular retrosplenial cortex can be subdi-
vided (Vogt and Peters, 1981) into a caudal area a (Rga) and a

Fig. 1. (A) Timetable on experimental day. Animals were placed individually
for 20 min in a novel cage in a novel environment, then returned to the test
room (for either 10 min, 100 min or 7 hours and 40 min). (B) Approximate
location of the coronal slices along the rostro-caudal axis. (C) Location of
the tissue punches on a coronal plane (adapted from Paxinos and Watson,
1997). Abbreviations: ATN, anterior thalamic nuclei; Rgb, granular b
retrosplenial cortex; IHC, slices taken for Nissl stains and
immunohistochemistry.
more rostral and dorsal area b (Rgb). It should be noted that
the rat brain does not possess a distinct area 23, rather the ret-
rosplenial cortex occupies all of the posterior cingulate region.
For this study, Rgb was the region of interest for three princi-
pal reasons. First, Rgb receives dense inputs from the ATN
(Vogt et al., 1981; van Groen et al., 1993). Second, the most pro-
minent retrosplenial IEG changes are seen in this region after
anterior thalamic lesions (Jenkins et al., 2004). Third, its
location (immediately above the caudal half of the corpus callo-
sum) can readily be determined in fresh tissue, so aiding both
the reliability and validity of the tissue samples.
Tissue microdissection
Rats were killed between 17 –20 hours by stunning, followed
immediately by cervical dislocation. In order to kill the rats
thalamic lesions and retrosplenial activity 61
at the same time of day, it was necessary to stage their intro-
duction to the novel environment according to their group
(8 hours, 2 hours and 0.5 hours prior to sacrifice) (Fig. 1a).
Following removal from the skull, the brain was rinsed in
cold, DEPC-treated 0.1 M PBS, and placed dorsal-surface up
in a Perspex rat brain matrix (WPI; specific for rats weighing
175 –300 g). The dissection lasted, at most, 2 min. Two, 2 mm
coronal slices were first obtained by making three coronal cuts
(Fig. 1b), and then placed on dry ice. Discrete samples of Rgb
were then punched out with a 19 gauge punch (Fig. 1c) using
techniques already validated for array analysis (Holter et al.,
2001). The gauge size ensured that all laminae were involved
while minimising any encroachment into adjacent grey and
white matter.
One retrosplenial cortex punch was taken from each hemi-
sphere for each slice. For each subject, the two punches from
the same hemisphere (i.e. ‘Lesion’ and ‘Intact’) were pooled.
This entire procedure was repeated for a total of six
animals and 12 hemispheres per replicate. The punches
were stored at 2708C. Confirmation of the anterior thalamic
lesions used the tissue immediately anterior to the more
rostral slice (‘IHC’) (Fig. 1c). After confirmation of the
lesions (see below), the tissue from two rats per time point
was pooled together by hemispheric condition (‘Lesion’ or
‘Intact’).
Confirmation of ATN lesions
The lesions were confirmed in two ways. First, coronal sec-
tions from the IHC (Fig. 1b) were Nissl stained (the ATN
lie just rostral to the most anterior slice taken for Rgb
tissue). Second, coronal sections from the most rostral
portion of Rgb (immediately in front of the most anterior
slice) were processed immunohistochemically to confirm
that the thalamic lesions were sufficient to produce clear
reductions of c-Fos levels in Rgb (Jenkins et al., 2004).
The portion of the rat brain anterior to the most rostral
coronal slice (Fig. 1c) was placed overnight in 4% paraformal-
dehyde in PBS for fixation and then again overnight in 25%
sucrose in PBS. Coronal sections (40 mm) were cut on a cryo-
stat (Leica Instruments) and three series of adjacent sections
retained. One series was for Nissl staining and another for
c-Fos immunohistochemistry. For Nissl staining, the sections
were first mounted onto gelatine-coated slides, stained with
cresyl violet and coverslipped using DPX mountant (Fisher
Scientific). For c-Fos visualization the sections were collected
in 0.2% Triton-X-100 in 0.1 M PBS at pH 7.4 (PBST).
Endogenous peroxidase activity was blocked by washing the
sections with 0.3% hydrogen peroxide in PBST for 10 min,
and then four times with PBST alone for the same duration.
Sections were incubated at 48C for 48 hours in PBST with
rabbit polyclonal antibody for c-Fos (1:5000, Ab-5,
Oncogene Science). Sections were then rinsed for 10 min in
PBST, four times. Next, they were incubated in biotinylated
secondary antibody and then avidin-biotinylated horseradish
peroxidase complex in PBST (Elite Kit, Vector Laboratories).
Sections were next rinsed in Tris non-saline buffer (pH 7.4).
Finally, immunoreactivity was visualized with diaminobenzi-
dine (DAB Substrate Kit, Vector Laboratories) chromogen
incubation. Sections were then mounted on gelatinised
slides, dehydrated through a series of alcohol gradients and
coverslipped.
Sections were viewed on a Leica DMRB microscope,
digitally photographed using an Olympus DP70 camera.
62 g.l. poirier et al.
Counts of c-Fos-positive cells used the analySIS^D program
(Olympus). The threshold was set at the same level for all sec-
tions and counts were made in a frame area (1768 
1331 mm, using 5 magnification) that included all Rgb
lamina. Typically, counts were taken from three consecutive
sections from both hemispheres of the retrosplenial cortex
(approximately between 22.56 and 23.14 from bregma
(Paxinos and Watson, 1997), and these counts were averaged
to produce a mean. A two-way paired-samples t-test com-
pared c-Fos counts between the ‘Intact’ and ‘Lesion’
hemisphere.
RNA extraction and microarray hybridization
RNA was extracted as described (Chomczynski and Sacchi,
1987) from the pooled tissue (Humphries et al., 2002).
Briefly, the sample was homogenised in the denaturing sol-
ution (guanidinium isothiocyanate/mercaptoethanol) and
then sodium acetate, phenol and chloroform-iso-amyl
alcohol mixture were added and the solution shaken vigor-
ously. After 10 min incubation on ice, samples were centri-
fuged for 10 min at 14 000 rpm at 48C. At this point the
RNA was present in the aqueous phase. This phase was
removed and mixed with ethanol and placed at 2208C for 1
hour for the RNA to precipitate. This solution was centrifuged
again for 10 min and the resulting pellet dissolved in the dena-
turing solution and then precipitated with ethanol at 2208C
for 1 hour. After a further 10-min centrifugation, the pellet
was washed in 95% ethanol, dried and dissolved in diethyl
pyrocarbonate (DEPC)-treated water. Yields of total cellular
RNA extracted from the pooled punches in each sample
ranged from 1.40– 2.52 mg. A 3 ml aliquot (0.6 mg) of each
sample was supplied to the Wales Gene Park Affymetrix
GeneChip Expression Profiling Service, Cardiff University.
Before further processing, each RNA sample was quality con-
trolled using Agilent RNA6000 chips, following which 100 ng
of each sample was used to amplify biotinylated cRNA targets
using Affymetrix GeneChip protocols and reagents. The bio-
tinylated cRNA (target) was probed with rat genome 230A
GeneChips. Hybridization and washing was performed
using a GeneChip fluidics station 400 (Affymetrix). After
scanning the microarrays, initial data processing was con-
ducted with Microarray Suite 5.0 (Affymetrix). The average
signal intensity of each array was scaled to 100. This procedure
normalizes the raw data and corrects for technical variation
between the arrays (e.g. differences in hybridization
conditions).
QPCR validation of microarray candidate genes
QPCR was used to verify the microarray findings for nine
genes. These candidate genes were chosen from different
classes of genes identified by the microarray analyses (see
below). Using material from the same subjects as for the
microarray analyses, for each sample 0.5 mg of total RNA
was processed in a reverse transcription reaction in either
the presence (RTþ) or absence (RT2) of reverse transcriptase
(Superscript II protocol, Invitrogen). Then 15 ml of each
cDNA was diluted with 135 ml of 10 mg ml21 tRNA. QPCR
analysis of transcript levels was performed according to
established protocols (Sugden, 2003). Briefly, QPCR was
performed using a LightCyclerTM 1.2 (Roche) in a 10 ml
volume using sense and anti-sense primers (0.5 mM;
sequences which is available as “Supplementary data” on
Cambridge Journals Online: http://www.journals.cup.org/
abstract_S1472928808000368) and the dNTPs, Taq DNA
polymerase and reaction buffer provided in the QuantiTect
SYBR Green kit (Qiagen). All QPCR assays used an initial
15 min, 958C step to activate Taq polymerase, followed by
35 –40 cycles of denaturation 958C, 15 sec, annealing 568C,
20 sec and extension 728C, 10 sec. The fluorescence of the
accumulating product was acquired each cycle after an
additional 3-sec step to 38C below the product Tm. All
assays included a tRNA and RT negative control. Target
amplification was verified for all genes as all assays gave a
single melting peak and a single band of the expected size
on agarose gel/EtBr electrophoresis (2.2% w/v). The standards
used for quantification of copy number in cDNA samples
were gene-specific PCR products purified by agarose gel/
EtBr electrophoresis and quanitated by densitometry against
a known quantity of a low-molecular weight (109 bp) DNA
marker. Standards were diluted to give 101 to 107 copies/
assay, aliquoted, stored at 2808C and used in each assay.
All assays were highly efficient (.92%) and standard curves
were all linear from 101 to 107 with correlation coefficients
(r2) .0.9990 (see QPCR Assay Characteristics which is avail-
able as “Supplementary data” on Cambridge Journals Online:
http://www.journals.cup.org/abstract_S1472928808000368).
Analyses of microarray data
Analyses used GeneSpringTM software (Version 6.1; Silicon
Genetics) to characterize mRNA changes in area Rgb follow-
ing anterior thalamic lesions. The data for all of the analyses
were first log transformed. The hybridization intensity was
normalized per chip to the 50th percentile (0.01 cut-off
value) and per gene to the median. Data filtering was
applied using parameters recommended by Silicon Genetics.
Genes that were labeled as ‘absent’ based on their absolute
signal level in all samples were removed.
To augment the replication reliability, the cross-gene-error
model was applied to the analyses of variance. Calculations for
all samples, thus, relied on the combined within-sample and
between-sample variation, taking into account replicate varia-
bility using values produced by the scanning software for the
signal precision of each transcript. A control strength cutoff
value was, thus, calculated for ‘reliable’ data and used as a
filter for the signal strength of the probes in each condition.
The cross-gene-error model used by GeneSpringTM generally
yields more conservative results than signal strength com-
pared to control.
Analysis of variance
Initially we used the widespread approach of fold-change ana-
lyses (see below). Lists of genes exhibiting 1.8-fold-change in
expression between treatment groups were created for each
time condition and then pooled. The application of para-
metric statistical measures for microarray data using
Affymetrix chips is suitable because such data sets exhibit
good correlation with normality (Giles and Kipling, 2003).
A two-way ANOVA using Surgical Treatment (‘Intact’ and
‘Lesion’) and Time (30 min, 2 hour and 8 hour after the begin-
ning of novel context exposure) was performed, followed by
one-way ANOVAs for individual Time levels. Correction for
multiple testing was applied using a false discovery rate
(FDR) of 0.05 (Benjamini and Hochberg, 1995), which
means that 5% of the genes that pass the statistical test are
considered to be false positives (i.e. genes that pass the test
by chance).

Expression pattern cluster analysis: The quality threshold (QT)
clustering method uses a set of rules to retain only clusters of a
good quality. Only genes for which expression profiles are
within a user-specified level of similarity will be clustered
(minimum cluster size 5; minimum similarity 0.9; similarity
measure Pearson correlation). All other genes remained
unclassified.
Treatment profiling
The analyses of variance were complemented by using the
class prediction function of GeneSpringTM . Whereas an
ANOVA on differences in gene-expression levels based on
fold change might allow the production of a reasonable list
of genes that are affected by the manipulation, the fold-change
analysis is based on an arbitrary value (here, 1.8) that has no
physiological correlate. For some transcripts, changes smaller
than the chosen value of 1.8 are biologically meaningful, so it
is possible that subtle, but robust, findings might be hidden by
such an analysis (Murphy, 2002; Pavlidis, 2003).
The class prediction function of GeneSpringTM allows the
statistical comparison of gene expression levels between treat-
ments, without any arbitrary fold-change threshold. Only
genes whose relative expression level correctly predicted
class membership (e.g. treatment condition) were identified,
based on robust differential expression levels. In other
words, the relative expression level of these genes predicts
treatment in any condition of either duplicate.
The class prediction function uses Fisher’s exact test to
assign a P-value for the possibility that transcripts are
located by chance closer to either of the classes (according
to hypergeometric distribution) on either side of a decision
cut-off value. This value is created by producing for each tran-
script the ratio of the P-values from each class. The default
cutoff value is 0.2, meaning that the magnitude of the differ-
ence between the P-values must be five or more. This forms
the basis for the prediction-strength value, according to
which the transcripts are then ranked. A final filter was
applied, limiting the number of regulated genes for further
analysis to the top 2%. The class-prediction analysis yielded
a set of genes that always correctly identified surgical treat-
ment membership.
Pooling the surgical treatment conditions and producing
gene class predictions for Time was unreliable because this
yielded numerous group prediction errors. In contrast,
pooling across time points and using the class prediction
tool for the Surgical treatment variable yielded no prediction
errors for the transcriptome profiling of each surgical treat-
ment, and so only these results are presented.
Expression pattern cluster analysis: A QT cluster analysis was
conducted on this class prediction list. The parameters were
the same as for the fold-change analyses (minimum cluster
size 5; minimum similarity 0.9; similarity measure Pearson
Correlation). To identify transcripts only labeled as expressed
sequence tags (ESTs), we used the Basic Local Alignment
Search Tool (Altschul et al., 1997), a nucleotide sequence
similarity search program (http://www.ncbi.nlm.nih.gov/
BLAST/). Transcripts that were labeled by GeneSpringTM as
‘similar to’ a known gene were also thus confirmed. A
positive identity was inferred when high similarity ratings
were produced, where the possibility that a similar nucleotide
sequence match would be found by chance was low (i.e. the
E-value was close to zero).
thalamic lesions and retrosplenial activity 63
Where possible, gene transcripts were next annotated using
gene ontology information from the Rat Genome Database
(www.rgd.mcw.edu), Genecards (www.genecards.org) and lit-
erature searches on Pubmed (www.ncbi.nlm.nih.gov/entrez/).
In order to capture the overall nature of the changes produced
by the thalamic lesions the genes were then classified in terms
of their cellular localization and their functional role accord-
ing to the Kyoto Encyclopedia of Genes and Genomes
scheme (http://www.genome.jp/kegg/).
Analysis of transcription factor binding sites: The evaluation of
the potential transcription binding sites shared by the promoter
regions of genes identified by the fold-change and treatment
profiling microarray analyses used the MatchTM program
(Kel et al., 2003) with the TRANSFAC database (http://www.
gene-regulation.com/pub/programs.html#match).
Gene set enrichment analysis (GSEA)
We applied GSEA as another method of supervised compu-
tational data processing. Similar to the treatment profiling
approach described earlier, GSEA compared the two surgical
conditions. However, rather than being based on analyses of
individual genes, the strength of GSEA lies in the evaluation
of the over-representation of predefined gene sets that are
pathway-related (Subramanian et al., 2005). This approach
enabled formal consideration of pathways in relation to the
observed gene expression changes, and was applied as
described by Subramanian and co-workers (Subramanian
et al., 2005).
Experiment 2
GABA-mediated signals are central to intrinsic retrosplenial
cortex signal integration (Ichinohe and Rockland, 2002; Li
et al., 2002) and for the control of the feed-forward communi-
cation in thalamocortical circuits (Daw et al., 2007). In light of
the vital role of cortical GABA, the expression levels of the
microarray-derived gabrd transcript were tested using a differ-
ent technology, in situ hybridization. This method required
a different group of rats.
Subjects
Male rats (n ¼ 10, Dark Agouti strain, Harlan) weighing
200 –225 g at the time of surgery were housed in pairs
under a 13 hour light/11 hour dark cycle with ad libitum
access to food and water. Each animal was habituated exten-
sively to handling.
Tissue preparation
For the in situ hybridization experiment, unilateral anterior
thalamic lesions were produced by infusing 0.20 ml of
0.12 M NMDA twice, per hemisphere (for coordinates see
Experiment 1). Four weeks after surgery, the rats were killed
30 min after exposure to a novel environment by CO2
exposure and decapitation. Whole brains were rapidly
removed, frozen on dry ice and stored at 2708C until sec-
tioned. Sections (14 mm) were cut on a cryostat (Leica
Instruments) and thaw-mounted onto poly-L-lysine (hydro-
bromide; molecular mass .300 000; Sigma)-coated glass
slides (0.02 mg ml21 in DEPC-treated water). The sections
were air-dried for 30 min, fixed in 4% paraformaldehyde
in 0.1 M PBS, pH 7.4, for 5 min, rinsed in PBS for 1 min,
64 g.l. poirier et al.

delipidated in 70% ethanol for 4 min, and stored in 95%
ethanol at 48C.
In situ hybridization
A DNA antisense probe complementary to nucleotides 119 –
159 of the rat gabrd gene (NCBI accession number NM
017289) (Shivers et al., 1989) was synthesized commercially
(Sigma-Genosys). This oligonucleotide was 30 end-labelled
with [a-35S]dATP (1200 Ci mmol21; New England Nuclear)
in a 30:1 molar ratio of radiolabeled ATP:oligonucleotide
using terminal deoxynucleotidyl transferase (Promega) as
described previously (Wisden and Morris, 1994). Specific
activity of the 35S-labelled probe was between 1.8  105
d.p.m. ml21. To define nonspecific hybridization, adjacent,
slide-mounted sections were incubated with the radiolabelled
gabrd oligonucleotide probe in the presence of an excess
(100) concentration of unlabelled oligonucleotide probe.
After hybridization, sections were opposed to BioMax
X-ray film (Eastman Kodak) for two weeks. After obtaining
appropriate x-ray film exposures, sections were dipped in
K5 photographic emulsion (Ilford). Sections were exposed
for 18 weeks at 48C before developing and then counterstained
with 0.01% thionin.
Silver grain density was assessed in laminae II (superficial)
and V (deep) of Rgb from typically three adjacent sections
(22.8 to 26.0 mm from bregma) using LeicaQWIN
imaging software (Leica Microsystems). Grains (total and
non-specific) were counted over 8–10 cells per hemisphere
for each lamina, and the mean number of silver grains per
cell calculated. The specific grain count mean was then
obtained by subtracting the non-specific from the total
count means. Statistical analyses (SPSS 14.0, Chicago)
started with a two-way ANOVA with the factors surgical
treatment and lamina. Post hoc tests were made where appro-
priate. The grain counts were obtained by an investigator
blind to the treatment of each hemisphere.
RESULTS
Experiment 1
Histology: nissl confirmation of thalamic lesions
All animals included in the analyses exhibited discrete lesions
in the ATN, removing most of the cells in the anterodorsal
and anteroventral nuclei (Fig. 2). In the smallest of these 12
lesions there was light sparing of the anterior ventral
nucleus throughout, athough mainly in the rostral part of
the nucleus with less sparing further caudally. Complete loss
of the anterodorsal nucleus was seen in this case, but little
damage in either the anterior medial nucleus or the lateral
dorsal nucleus. The largest lesion of the 12 cases removed
all of the anterior ventral and anterior dorsal nuclei. There
was damage in the anterior medial nucleus but it was not com-
pletely removed. Very limited cell loss was sometimes
observed in the immediately adjacent part of the dentate
gyrus (i.e. in the most rostral part of the medial blade of the
dentate gyrus, n ¼ 8). The fornix always contained two
needle tracks. There was also restricted damage to the
rostral pole of the lateral dorsal nucleus in all cases. As
expected, counts of Nissl-stained cells in the retrosplenial
cortex failed to find evidence of a difference between the

Fig. 2. (A) The smallest and largest ATN lesions are represented in dark and light grey, respectively, on a series of standard coronal sections. The numbers refer to
the distance from bregma. (B) Photomicrograph of a Nissl-stained coronal section, contrasting the ATN in a normal hemisphere (left) and a lesioned hemisphere
(right). The outline highlights the area of gliosis and cell loss. The tissue was not perfused, hence the poor differentiation. Abbeviations: AD, anterior dorsal
thalamic nucleus; AM, anterior medial thalamic nucleus; AV anterior ventral thalamic nucleus. Scale bar, 500 mm.
 thalamic lesions and retrosplenial activity 65

‘Lesion’ and ‘Intact’ hemispheres (paired samples t-test, t(11) ¼
1.3, P ¼ 0.2) (Fig. 3c).
Histology: immunohistochemical confirmation of thalamic
lesions
Further confirmation of the effectiveness of the lesions came
from the expected (Jenkins et al., 2004), striking decrease in
the number of c-Fos-positive cells in Rgb in the ‘Lesion’
hemisphere [paired samples t-test (two-way), t(11) ¼ 6.3,
P , 0.0001] (Fig. 3).
Microarray analyses
The normalized probe signal intensity profiles of individual
samples were similar and normally distributed, thus, no set
was removed (Fig. S1, which is available as “Supplementary
data” on Cambridge Journals Online: http://www.journals.
cup.org/abstract_S1472928808000368). All samples were
also correlated highly (.0.90, 0.25 weighing coefficient).
The data quality filters yielded 9075 satisfactory ‘transcripts’
out of the original 15923 probe sets. All comparisons are
between the ‘Intact’ and the ‘Lesion’ hemisphere, so the tran-
script analyses are based on relative, not absolute, levels.
Fold-change ANOVA
A total of 319 transcripts were differentially expressed at the
1.8 fold-level. The 2-way ANOVA based on this fold-
change in gene expression identified 32 genes with signifi-
cant changes in expression levels between the surgical con-
ditions (Table 1), but there was no significant effect of
post-novelty Time interval or significant interaction
between Time and Surgical Treatment. All genes were sig-
nificant for Surgical Treatment (P , 0.05). In this list,
according to the chosen false discovery rate, 1.6 genes
would be expected to be false positives. Typically, these 32
genes were expressed at a relatively higher level on the
‘Intact’ than the ‘Lesion’ side (25 compared to 7 genes,
respectively). Among the genes with a 1.8-fold change in
expression were several transcription factors (c-fos, klf5,
fra-2 and zfp91), which have functional associations with
cellular processes and genetic information processing, most
prominently relating to immune responses and the regu-
lation of transcription.
Although there was no overall effect of post-novelty time
interval on gene expression, cluster analysis on this list ident-
ified sets of genes with three major temporal patterns of
expression according to condition (Table 1). One-way
ANOVA identified the times at which there was a 1.8-fold
change in expression of each gene between the two surgical
treatment conditions (Table 1). The complementary nature
of the profiles of these cluster analyses helps to explain why
there was an overall null effect of post-novelty interval.
Furthermore, although there were no systematic differences
in the post-lesion durations for the three novelty context
intervals, variability in this measure might increase the likeli-
hood of a null result.
Treatment transcriptome profiling
Class prediction analysis identified 202 genes (Table 2, which
is available as “Supplementary data” on Cambridge Journals
Online: http://www.journals.cup.org/abstract_S1472928808
000368) for which the relative expression levels were consist-
ent for data across all time points and both replicates, and so
exhibited significant differences according to this method
(e.g. a specific transcript was always significantly greater in
one level of the Surgical treatment, for all time points and
across both replicates). Expression of .75% of the 202
genes identified by this method was higher in the ‘Intact’
than ‘Lesion’ Rgb tissue (157 compared to 45, respectively).
Cluster analysis again allowed us to further segregate the
genes idenifed into sets according to their expression patterns
across the time points for each condition (Table 2, which is avail-
able as “Supplementary data” on Cambridge Journals Online:
http://www.journals.cup.org/abstract_S1472928808000368).
Both the fold change and the predictive patterning analyses
specified that expression of genes that encode proteins in the
nucleus and the membrane appeared to be affected more than
those associated with other cellular compartments. Furthermore,
transcription was one of the functions represented most

Fig. 3. (A) Photomicrographs of representative sections showing reduction of c-Fos but not of Nissl, indicated by the arrow in Rgb ipsilateral to the ATN lesions.
The laminae are identified in each photomicrograph. Scale bar, 200 mm. (B) The selective loss of c-Fos protein is shown by the normal pattern of signal intensity in
the cresyl violet sections (upper) compared with the c-Fos-labelled sections (lower), with 0 – 600 mm corresponding to laminae I –VI. Note the difference in the
superficial laminae. The horizontal mean profile was derived by analySIS^D (Olympus). Measures of the grey value intensity of each pixel were made along a
horizontal plane, and all of these were averaged to produce a laminar profile of signal intensity. (C) Significant reduction of c-Fos-positive cells but not
Nissl-stained cells in the Lesion hemisphere ( P , 0.0001, see text).
 66
Table 1. Sets of genes with similar expression patterns, determined by cluster analysis (based on fold-change list).

g.l. poirier et al.

Set Found in Time point (h)‡ Functional Common Name Synonym EST Genbank
class classification
patterning?†
0.5 2 8

1S.L y 3 – – Ion transport Naþ channel, voltage-gated, type I, GEFSP1 – AF182949

beta polypeptide (Scn1b)
n – – – Cell adhesion Nel-like 1 (Nell1) IDH3GL, NRP1 – NM_031069
y 3 – – Transcription Kruppel-like factor 5 (intestinal) IKLF, BTEB-2 – NM_053394
(Klf5)
y – – – Development Netrin-G1a (Ntng1a) Laminet1 1067 BM391312
0.0
n 3 – 3 Development Cerebellin 1 precursor protein (cbln1) Precerebellin-1 gene 908 AI227829
0.0
n – – 3 Signal transduction Small inducible cytokine subfamily 8 SCYB14, KS1, Kec, BMAC, 178 BG380414
(cys-xcys) member 14 (Scyb14) BRAK, NJAC, MIP-29, 6e-42
bolekine
y – – – Folding, sorting, and Matrix metalloproteinase 9 (MMP9) Gelatinase b, Macrophage – NM_031055
degradation gelatinase, type V
collagenase, 92kD type IV
collagenase, CLG4B
2S.L n 3 – – Cell communication Chromogranin B (Chgb) Parathyroid secretory protein; – NM_012526
secretogranin I
y – – 3 Cell adhesion Olfactomedin 3 (olfm3) Optimedin form B, NOE3 – AF442822
y 3 – – Cell adhesion Limbic system associated membrane LAMP-1, CD107a, LGP120 – U31554
protein (Lsamp)
y 3 – – Development Fibronectin type III domain Peroxisomal protein 599 AI172165
containing 5 (Fndc5) (pepgene, Pep), Pxp, 4e-168
FRCP2, LOC260327
y 3 – – Neuroactive ligand- 5-HT2C receptor (5-HT2cR) Htr1c 509 BF285539
receptor interaction 3e-141
y – – – Unknown BAC clone RP23-312H15 from 16 LOC360483 mRNA – AI412090
y 3 – 3 Transcription Retinoblastoma binding protein 5 RBQ 3 396 AA946518
(RBBP-5) 3e-107
3L.S y 3 – – Neuroactive ligand- Adrenergic receptor, beta 3 (Adrb3) – NM_013108
receptor interaction
n – – – Immune system Cysteinyl leukotriene receptor 1 – NM_053641
(Cyslt1, Cysltr1)
y 3 – – Cell communication Zyxin (zyx) HED-2 – AA943537
Unclassified S.L n – – – Transcription zinc finger protein 644 (Zfp644) 182 AW916491
3e-43
S.L n – – – Transcription c-fos – BF415939
S.L n – – – Lipid metabolism Hydroxysteroid dehydrogenase, 11 Corticosteroid – NM_017080
beta type 1 (Hsd11b1) 11-beta-dehydrogenase
isozyme 1
S.L n – – – Cell adhesion Non-processed neurexin I-alpha Nrxn1b – NM_021767
(Nrxn1)
 S.L n – – – Signal transduction Solute carrier family 9 (sodium/ Ezrin-radixin-moesin-binding – NM_021594
hydrogen exchanger), isoform 3 phosphoprotein
regulator 1 (Slc9a3r1)
S.L n – – – Transcription Zinc finger protein 91 (PZF) ZFP91 – BE112093
S.L y – 3 – Lipid metabolism hypothetical protein MGC11324, 398 AI599365
Hypothetical phospholipid and 9e-108
glycerol acyltransferase
S.L n – – – Transcription Fos-related antigen, exon 4 (Fra-2) 307 AI031032
9e-81
S.L y – – – Translation Speckle-type POZ protein (Spop) TEF2 476 BF283504
2e-131
S.L y – – – Folding, sorting, and Ubiquitin specific protease 3 (Usp3) – AI411205
degradation
L.S y 3 3 3 Immune system CD74 INVG34, LN2 – NM_031069
L.S n – – – Cytoskeleton, Desmuslin (Dmn) KIAA0353, synemin – BG373779
Microtubule and
actin-movement
related
L.S n – – – Immune system Protein S alpha (ProS1) PSA, PS21, PS22, PS23, PS24, – U06230
PS25
S.L n 3 – – Cytoskeleton, Cytoskeleton-associated protein 4 CLIMP-63, P63, MGC99554 – BI278813
Microtubule and (Ckap4)
actin-movement
related
L.S y 3 3 3 Immune response Rat MHC class II RT1.u-D-alpha HLA-DRA – Y00480
chain mRNA, 30 end
†
Refers to gene, not necessarily the same transcript. ‡Level of time condition for which surgical treatment resulted in significant differences in gene expression of 1.8 fold change.  For Expressed Sequence Tag (EST)

thalamic lesions and retrosplenial activity

similarity searches, the similarity score and the E-value are provided. (S ¼ ‘Intact’ ¼ solid line; L ¼ Lesion ¼ dashed line).

67
68 g.l. poirier et al.
frequently in both the fold-change and the predictive pattern-
ing analyses. In addition to the expected fall in the expression
of c-fos, based on previous immunohistochemical studies of
c-Fos protein concentration after anterior thalamic lesions
(Jenkins et al., 2004), differences between the ‘Intact’ and
the ‘Lesion’ hemispheres were also found for the transcription
factors fra-2, zfp91 and klf5, based on fold-change differences.
The transcription factor genes identified by predictive pattern-
ing included klf5, brd8, nfat5, nfix, nr4a1, smad3, NeuroD1,
SMARCC2 and RXRg, with klf5 common to both methods.
It is evident that diverse functions were disturbed by the
lesion, affecting more pathways than only those that converge
on the c-fos promoter region. Computational analysis of the
gene promoter elements identified candidate binding sites
for transcription factors that were shared by the genes high-
lighted by the treatment profiling and the fold-change
approaches. In descending order, the most common binding
sites were for the transcription factors FoxD3, Pax-4, Oct-1
and AP-1 for treatment profiling, and FoxD3, Oct-1 and
AP-1 for the fold-change gene lists (Fig. S2, which is available
as “Supplementary data” on Cambridge Journals Online:
http://www.journals.cup.org/abstract_S1472928808000368).
AP-1, but not FoxD3, Pax-4 or Oct-1 was differentially
expressed between the surgical conditions. Two of the hetero-
dimeric AP-1 binding partners, c-fos and fra-2, were lowest in
the ‘Lesion’ hemisphere in the fold-change list (Table 1). It is,
thus, plausible that these two transcription factors have an
important role in regulating the altered retrosplenial cortex
response.
Both analyses yielded candidates underlying biological
function changes, and we have no a priori reason to believe
that the results of one type of analysis is more important
than the other. Thus, to simplify the description of the data,
we integrated the results of the fold-change and the treatment
profiling analyses because they indicate many similar altera-
tions in gene expression.
We found evidence of widespread alterations in the
expression of genes involved in many biological functions
(Fig. 4). These alterations are most likely to be chronic
effects because acute recovery processes, such as an increase
in c-Fos, are thought to peak 3–10 days after injury and
return to baseline before one month (Nieto-Sampedro et al.,
1982; Buytaert, 2001; Mingorance et al., 2005). In the
present study the changes indicated potential differences in
neuroendocrine activity (e.g. hsd11b1, RXRg, brd8 and
adcyap1), cell adhesion, growth and reorganization (e.g.
cyclinD2, klf5, lsamp, neuroD1, nptx2, reprimo, actin
alpha-1, cbln1, lsamp, map2, mmp9, mmp24, myosin Ie,
myosin IXa, nelf, nefh, netrin1, netrin-g1a, neurexin1, neuri-
tin1, plexinb2, scn1b and tuba4) as well as immune functions
and inflammation (e.g. CD74, CD83, cyslt1, hla-dmb,
LOC171412, masp1, ppib, RT1.B beta 1, RT1-Da and tore).
We focus on gene expression changes that reflect energy
metabolism and neuroplasticity, because these best address
the goals of the experiment.
Energy production
Expression differences were found that indicate disturbances
in blood, oxygen and energetic activities (Fig. 5). The
‘Lesion’ hemisphere contained lower levels of transcripts
associated with effective hemoglobin oxygen transport (hba1
and urod) and glucose transport and metabolism (exoc7,
ehd2 and pank4) (Ishiki and Klip, 2005; Yunfeng et al.,
2005). Additionally, the higher expression of COX1/Ptgs1
after the lesion might be associated with an alteration in oxy-
genation and metabolism because this molecule is an import-
ant mediator of neurovascular coupling and vasodilation
(Takano et al., 2006). There were pervasive alterations in
expression of mitochondrial genes, which have an important
role in oxidative phosphorylation and can affect the gluta-
mine –glutamate cycle. Deficient metabolic function is indi-
cated by the finding that mitochondrial transcripts exhibited
altered expression patterns in all mitochondrial complexes,
and were almost exclusively lower in the ‘Lesion’ condition
(ndufv2, ndufa8, ndufb6, CoQ9, UCR/QCR9, cox6a, atp5o,
atp6s14, mdh2, sdhc, but not cox6b) (Fig. 5; Table 2, which
is available as “Supplementary data” on Cambridge Journals
Online: http://www.journals.cup.org/abstract_S1472928808
000368). GSEA replicated this finding because gene sets for
the electron transport chain (FDR ¼ 0.044) and oxidative
phosphorylation (FDR ¼ 0.040 which is available as
“Supplementary data” on Cambridge Journals Online: http://
www.journals.cup.org/abstract_S1472928808000368) were
both relatively enriched in the ‘Intact’ condition. These were
the only enriched sets with FDR ,0.05 in that condition.
c-Fos and the AP-1 complex can translocate to the mito-
chondrion, and there are AP-1-like binding sequences in
mouse mitochondrial DNA (Ogita et al., 2002; Ogita et al.,
2003). Computational analyses of transcription factor
binding sites for the genes that are altered in the current
study identified potential AP-1 binding sites on several mito-
chondrial genes, including ndufv2, ndufa8, COQ9, atp6s14
and mdh2 (all reduced on the lesioned side). Although plaus-
ible, that the deficit in c-fos expression might be linked directly
to the mitochondrial deficits was not tested in the present
study.
Neuroplasticity
Some of the genes that are differentially regulated in this study
have a role in neuroplasticity. For example, the activity of
some transcripts that were found in lower abundance on the
‘Lesion’ side are associated with either long-term potentiation
(LTP), including adcyap1 (Otto et al., 2001; Matsuyama et al.,
2003), carbonic anhydrase 4 (White and Platt, 2001), mmp9
(Nagy et al., 2006), ncs-1 (Genin et al., 2001; Brackmann
et al., 2004) and neuritin1 (Wibrand et al., 2006), ppp1r1a
(Allen et al., 2000) or long-term depression (LTD), including
cbln1 (Hirai et al., 2005), Nr4a1 (Lindecke et al., 2006),
ppp1r1a (Mulkey et al., 1994; Morishita et al., 2001;
Jouvenceau et al., 2006) and Prkar1b (Brandon et al., 1995).
In contrast, in the ‘Lesion’ side there were higher levels of
nptx2, which is LTP-related (Wibrand et al., 2006), and
RXRg, which is involved in LTD, but not LTP (Chiang
et al., 1998).
Cell signaling
Cell signaling appears to be grossly affected by the lesion. The
tissue in the ‘Intact’ cortex displayed more transcripts associ-
ated with synaptic signaling (e.g. scamp1, syt5, napa, ap2m1,
ncs-1, exoc7, lrp3 and neurexin1, but lower for ehd2).
Neuronal signaling from the ATN to the retrosplenial cortex
relies on glutamatergic inputs (Gonzalo-Ruiz et al., 1997)
and their interaction with GABA-releasing interneurons
within the cortex (Ichinohe and Rockland, 2002). It is, thus,
not surprising to find evidence of altered regulation of both
neurotransmitters.
 thalamic lesions and retrosplenial activity 69

Fig. 4. Hierarchical pathway prediction for the Rgb deregulation associated with the deficit in c-Fos production. Representative, microarray-derived Rgb
genes were annotated into different functional classes and grouped according to either molecular function (e.g. transcription factor, c-Fos) or biological
process (e.g. neurotransmission molecule, Gabrd). This hierarchical organization of groups of genes affected by the lesion provides the basis for pathway
predictions. For clarity, representative genes only are shown. Left pathway: The transcription factor Fra-2 is phosphorylated and regulates expression of the
RGS4 gene (D.A. Carter, unpublished). RGS4 affects neurotransmission (via GTPase activation). Altered neurotransmission is manifested in altered LTD/P.
Right pathway: The transcription factor c-Fos is phosphorylated and can be sorted to the mitochondrial genome where it associates with mitochondrial DNA
(Ogita et al., 2002). Altered mitochondrial function can affect synaptic plasticity (see text).

Whereas no glutamate receptors were found to be differen-
tially regulated, several transcripts indicate a disturbance in
glutamate-mediated functions (Fig. 5). An immediate-early
effector gene, nptx2, which is reported to be involved in selec-
tive clustering of glutamate receptors on interneurons
(O’Brien et al., 1999; Mi et al., 2002) was higher on the
‘Lesion’ side, hinting at potentially more intense excitatory
activity on these cells in this condition. Enzymes involved in
the metabolism of glutamate itself and of molecules involved
in glutamate function were also affected by the ATN lesion,
and, likewise, point to upregulation of glutamate-mediated
activity. NMDA receptor antagonism leads to increases in glu-
tamine synthetase and also in extended tricarboxylic acid
cycling (Brenner et al., 2005). Accordingly, NMDA
hyperactivity might be associated with a reduction in gluta-
mine synthetase and a decrease in tricarboxylic acid cycling.
In the present experiment, the finding of a lower expression
on the ‘Lesion’ side of gene transcripts that encode glutamine
synthetase, malate dehydrogenase and succinate dehydro-
genase is consistent with reduced activity of the tricarboxylic
acid cycle and a potential increase in NMDA-receptor
stimulation.
Relatively lower levels of glutamine synthetase, glutaminase
and asparagine synthetase in the ‘Lesion’ hemisphere indicate
an alteration in glutamate metabolism and homeostasis.
Glutamate is converted to glutamine by glutamine synthetase,
a glial-specific enzyme (Norenberg and Martinez-Hernandez,
1979), therefore the disparity between the surgical conditions
70 g.l. poirier et al.

Fig. 5. Schematic of some pathways disrupted by the lesion involving oxidative phosphorylation. These include all mitochondrial complexes (I – V), the
tricarboxylic acid cycle (TCA, Krebs cycle), glutamate2glutamine cycling, and glucose uptake and metabolism. Genes altered in the current study and
associated with these pathways are identified in red. Abbreviations: Glu, glutamate; Gln, glutamine.

might reflect differences in mechanisms of glutamate signaling
and metabolism, including neuron –glia interaction (Hertz
and Zielke, 2004; Patel et al., 2005).
Evidence of perturbations in glutamate function also arises
from apparent alterations in kynurenine metabolism.
Transcripts encoding cyclooxygenase 1 (COX1/ptgs1) and
kynurenine 3-monooxygenase (KMO), enzymes that are
associated with the metabolites of this pathway, were relatively
higher on the ‘Lesion’ side. The endpoints of kynurenine
metabolism are kynurenic acid and quinolinic acid (Moroni
et al., 1999). Kynurenic acid, a neuroprotective molecule
(Carpenedo et al., 2002), and quinolinic acid act as antagonist
and agonist, respectively, at NMDA receptors. Reduced con-
centrations of KMO cause kynurenic acid to increase
(Carpenedo et al., 2002; Erhardt and Engberg, 2002). COX1
is associated with NMDA activity and modulation of kynure-
nic acid levels. NMDA activation increases levels of this
enzyme (Pepicelli et al., 2005) and reduction in COX1
increases kynurenic acid levels (Schwieler et al., 2005).
Finally, adenylate cyclase activating polypeptide 1
(adcyap1) increases the re-uptake of glutamate by glia
(Figiel and Engele, 2000). A lower concentration of adcyap1
on the ‘Lesion’ side might be associated with greater
glutamate-mediated activity in this hemisphere. This obser-
vation, and the evidence presented above, indicate a disturb-
ance in glutamate-mediated signalling, which is potentially
associated with an increase in NMDA activity in Rgb.
Transcripts for other neurotransmitter receptors and
enzymes, in addition to several Naþ and Kþ ion channels,
appear to display robust, consistent differences between the

surgical treatment conditions. Such changes were apparent
for GABA-mediated signaling, including gabrd and ubqln1
(a mediator of GABA receptor subunit composition)
(Bedford et al., 2001), and also noradrenaline- (adrb3 and
adrbk1) and 5-HT-mediated signaling (HT2C). Transcripts
encoding HT2C were lower on the ‘Lesion’ side, which is
consistent with previous findings for 5HT1B, whereas
those for Adrb3 were relatively higher on the ‘Lesion’ side,
which is opposite to findings for Adrb2 (van Groen et al.,
1993).
QPCR validation of candidate genes
Fig. 6 shows the total number of transcripts in 2 ml, normal-
ized to b-actin, for the mRNA of nine preselected genes.
The QPCR results were highly consistent with the microarray
results, strengthening confidence in the overall findings of
the microarray analyses. All but one of the gene time-point
values (see below) revealed relative patterns of expression
that were similar to those seen in the microarray analyses (26
out of 27). The exception was zyxin at the 30 min time point
(Fig. 6).
Experiment 2
In situ hybridization was used to validate the microarray data
for one gene, gabrd, which was reduced in the ‘Lesion’ hemi-
sphere. This gene was chosen because GABA(A) activity is
Fig. 6. QPCR confirmation of candidate genes selected from microarray results. The candidates were selected from the sets of genes derived from fold-change
microarray analysis. Abbreviations: S, ‘Intact’; L, ‘Lesion’.
thalamic lesions and retrosplenial activity 71
crucial in regulating glutamatergic afferents to the cortex
(Daw et al., 2007).
RESULTS
The unilateral anterior thalamic lesions (n ¼ 10, largest and
smallest depicted in Fig. 7a) were similar to those described
for Experiment 1, although, on average, slightly larger.
In Experiment 2, the lesions included most of the cells in
the anterodorsal and anteroventral nuclei, but spared some
of the anteromedial nucleus. There was cell loss in the most
rostral portion of the laterodorsal nuclei (n ¼ 5) and
some restricted cell loss in the immediately adjacent parts of
the dentate gyrus and CA3 regions associated with the
largest lesions. Injection tracts passed through the fornix in
all cases.
Again, there was no interhemispheric difference in counts
of cresyl-stained material in Rgb after the unilateral
thalamic lesions (data not shown). Although there was no
overall effect of Surgical Treatment on gabrd grain counts
(F(1,6) ¼ 0.23; P ¼ 0.65) (Fig. 7c) there was a Lamina by
Surgical Treatment interaction (F(1,6) ¼ 10.69; P , 0.05).
Follow-up comparisons (Bonferroni adjusted) revealed sig-
nificantly reduced gabrd grain counts in the superficial
lamina (II) of the lesioned hemisphere (P , 0.05), but no
interhemispheric difference for lamina V (P ¼ 0.24).
72 g.l. poirier et al.
Fig. 7. (A) The smallest and largest lesions are represented in dark and light
grey, respectively. The plates, from left to right, represent the distances
20.92, 21.4, 21.8, 22.12, and 22.56 mm from bregma. (B)
Photomicrograph of a Nissl-stained coronal section, contrasting the ATN in
a normal hemisphere (left) and a lesioned hemisphere (right). The outline
highlights the area of gliosis and cell loss. The tissue was not perfused, hence
the poor differentiation. Abbreviations: AD, anterior dorsal thalamic
nucleus; AM, anterior medial thalamic nucleus; AV, anterior ventral
thalamic nucleus. Scale bar, 500 mm. (C) Anterior thalamic lesions reduced
Rgb gabrd expression in a superficial (II) but not a deep (V) lamina. Data
are mean + s.e.m., but note that the comparisons are within-subject.  P , 0.05.
(D) Photomicrographs (100) of small dark silver grains associated with
superficial Rgb laminae II in an ‘Intact’ (left) and ‘Lesion’ (right) hemisphere.
Scale bar, 10 mm.
CONCLUSIONS
† The sensitivity of the retrosplenial cortex to damage in one of
its key afferents, the ATN, extended to many functions, per-
vading cellular activities represented by the transcriptome.
† Replicating several findings using a different technique,
QPCR, validated changes in the transcriptome.
† Important groups of molecules associated with essential
functions, including energy and oxygenation, neuroplasti-
city, and cell signaling from synaptic to intracellular com-
munication, exhibited altered transcription patterns.
† Transcription factors with altered expression levels were not
restricted to either c-Fos or AP-1 dimer members. These
transcription factors might have an important role in med-
iating the response of the retrosplenial cortex to ATN
lesions. Computational analyses revealed that AP-1 binding
sites are among the most common binding sites for tran-
scription factors on the genes affected by the lesion. Via
c-fos, the concentration of AP-1 was the most common tran-
scription factor affected by the lesion. By contrast, although
FOXD3 has the most binding sites on genes affected by the
distal lesion, expression of FOXD3 was not altered.
† The greater sensitivity of the superficial laminae of the ret-
rosplenial cortex to anterior thalamic lesions was reflected
in a lamina-specific reduction of a specific GABA receptor
subunit.
DISCUSSION
Dysfunction of the retrosplenial cortex following lesions of
the ATN was analyzed globally for the first time using micro-
array techniques. Specific goals were to determine the perva-
siveness of any changes and potential mechanisms that
might explain the metabolic hypoactivity and loss of neural
plasticity seen in the retrosplenial cortex (van Groen et al.,
1993; Garden et al., 2006). The lack of evidence of neuronal-
cell loss in the retrosplenial cortex following ipsilateral thal-
amic lesions confirmed that the microarray approach was
appropriate, and the potential for ‘covert’ pathology. In
addition to the biological replications, the microarray
results were validated for specific genes using three other
techniques (QPCR, in situ hybridization and immunohisto-
chemistry), which all demonstrated concordance.
A general point should be made before considering the
findings. Disconnection of a site in the brain will, presumably,
induce some changes in mRNA in the target region. However,
we decided not to compare findings in the retrosplenial cortex
with microarray results from another region because each
input will have unique properties, as will the target site itself
(Vogt et al., 1981; van Groen et al., 1993). As a consequence,
there is no natural ‘baseline’ comparison or control condition.
For these reasons, the uniqueness of the reported retrosplenial
mRNA changes cannot be ascertained without making mul-
tiple comparisons with numerous sites, but this is not practical
at present. In addition, we know that the loss of other afferents
to retrosplenial cortex (e.g. from the entorhinal cortex, post-
rhinal cortex and laterodorsal thalamic nucleus) have no
marked effects on the immediate early genes (IEGs) c-fos
and zif268, which strongly indicates that there is a unique
relationship between the retrosplenial cortex and the ATN.
The significance of the present study relates both to (a) how
the findings inform specific retrosplenial changes that are
already linked to the distal effects of anterior thalamic
lesions (e.g. whether any IEGs, in addition to c-Fos and
Zif268, are affected by anterior thalamic lesions and how
mRNA changes might help to explain the loss of LTD in retro-
splenial cortex), and (b) why retrosplenial dysfunction (typi-
cally hypoactivity) is observed in diverse neurological
disorders.

As predicted (Jenkins et al., 2004), the IEG c-fos was
hypoactive on the ‘Lesion’ side. This hypoactivity extended
to genes encoding other transcription factors (e.g. brd8,
fra-2, klf5, nfat5, neuroD1, nfix, nr4a1, RXRg, smad3,
smarcc2 and zfp91), so providing a fuller picture of how
pervasive the changes in cellular function might be.
Markers for energy metabolism were also affected strongly,
providing another key indicator of the functional status of
cells in the retrosplenial cortex after anterior thalamic
lesions. Energy metabolism and synaptic activity are inter-
related (Williams et al., 1998; Vaynman et al., 2006).
Glutamate metabolism depends on astrocyte function
(Hertz and Zielke, 2004), whereas synaptic plasticity and
energy metabolism are coupled through neuron – astroglia
interactions (Hyder et al., 2006). Numerous pathways
involved in these exchanges appear to be affected by the
lesion, as depicted in Fig. 5.
Cell signaling appears to be grossly affected by the surgical
treatment. The current results indicate that ATN lesions
might result in the promotion of glutamate-related activity
in Rgb. This change might be a combined result of the loss
of glutamatergic inputs and the disinhibition of GABA regu-
lation within the cortex. The latter might be mediated via
the delta subunit of the GABA(A) receptor, which is important
for tonic inhibition (Mody et al., 2001; Petrini et al., 2004), and
for which the gabrd transcript was reduced in the lesioned hemi-
sphere in both microarray and in situ hybridization studies.
Effects of GABA, 5-HT and noradrenaline as well as Kþ-,
Naþ- and Ca2þ-channel activity all appear to be affected by
the thalamic lesions. These effects are likely to produce func-
tional changes in neuronal excitability and firing pattern
modulation, which is apparent from recent work (Garden
et al., 2006) to evaluate the effect of ATN lesions on single-
unit recordings in slices of retrosplenial cortex. Recordings
were made from retrosplenial cortex layer II neurons after
stimulation in either layer II or layer V. In unilateral lesion
preparations, LTD could be induced in layers II and V of
the ‘Intact’ cortex but not in layer II in the ‘Lesion’ hemisphere
(Garden et al., 2006). This selective lack of plasticity in the
superficial layers in the retrosplenial cortex after anterior thal-
amic lesions accords both with the only mRNA data looking at
different cortical lamina (i.e. the changes in gabrd transcripts;
Experiment 2), and with superficial reductions of c-Fos and
Zif268 after lesions of the ATN that have been described pre-
viously (Jenkins et al., 2004).
The dendrites of the NMDA-dependent layer II– III Rgb
interneurons (Li et al., 2002) are associated physically with
those of cells that receive anterior thalamic projections
(Ichinohe and Rockland, 2002). The anterior thalamic lesion
might result in disruption of the Rgb intrinsic and extrinsic
inhibitory/excitatory balance. Like interneuron activity, clus-
tering of delta-subunit containing GABA(A) receptors regu-
lates integration of excitatory signals (Mody et al., 2001;
Petrini et al., 2004). Together, these changes might reflect
altered cortical feed-forward inhibition, producing deficient
excitatory input summation and poor spike generation (Daw
et al., 2007), which contribute to the energy hypometabolism
in addition to potentially deficient energy functions (see
Fig. 5 for inter-related energy and neuronal activity functions).
The apparent reduction in mitochondrial activity in the
retrosplenial cortex is of potential relevance to Alzheimer’s
disease. In the earliest stages of this disease, the anterior
dorsal nucleus of the thalamus and the entorhinal cortex are
thalamic lesions and retrosplenial activity 73
two of the few regions that display structural changes (Braak
and Braak, 1991b). These regions might be preceded by trans-
entorhinal pathology, which coincides with a ‘clinically silent’
phase (Braak and Braak, 1991b). Both the entorhinal cortex
and the anterodorsal thalamic nucleus are connected to the
retrosplenial cortex, the latter with particularly dense connec-
tions (Insausti et al., 1997; van Groen and Wyss, 2003).
Furthermore, the ATN are one of the few regions that
exhibit hypoperfusion in patients that convert to
Alzheimer’s disease (Johnson et al., 1998).
Interestingly, during the progression of Alzheimer’s disease
there is a discrepancy in retrosplenial cortex between the time-
course of overt pathology and metabolic disturbance
(Matsuda et al., 2002). Whereas the retrosplenial area does
not usually exhibit overt pathology in early Alzheimer’s
disease, it does display hypometabolism. The severity of
memory loss correlates with in the posterior cingulate but
not the medial temporal lobe (Salmon et al., 2000; Matsuda
et al., 2002).
Memory loss in Alzheimer’s disease does, however, corre-
late with atrophy in the medial temporal lobe but not in the
posterior cingulate cortex (Baron et al., 2001; Chételat et al.,
2002; Chételat et al., 2003). Clinical studies and animal exper-
iments have led to the suggestion that hypometabolism in
adults with dementia of the Alzheimer type might be the
result of neuroanatomical disconnection (Fazio et al., 1992;
Meguro et al., 1999; Aupée et al., 2001). Studies into the
importance of the ATN for human memory (Aggleton and
Brown, 1999) and the impact of selective anterior thalamic
lesions in rodents (Jenkins et al., 2004) provide support for
this disconnection explanation and point to the key role of
the ATN. The present findings add considerable weight to
this view because they reveal potential mechanisms that
underlie some of these effects.
There is some evidence that, like hypometabolism,
a reduction in synaptic efficacy also precedes detectable struc-
tural changes in Alzheimer’s disease (Ho et al., 2001; Small
et al., 2001; Selkoe, 2002; Yao, 2003). Interestingly, in rats
the effect of anterior thalamic lesions on IEG activation in
the retrosplenial cortex occurs soon after surgery, and is
both long-lasting and constant (from 1 week to 10
months). The loss of IEGs is especially dramatic in the super-
ficial laminae of the retrosplenial cortex (Jenkins et al., 2004;
Poirier et al., 2005). This is of particular relevance because,
in Alzheimer’s disease, the superficial layers of posterior cin-
gulate cortex exhibit severely reduced levels of cytochrome
oxidase (Valla et al., 2001). Furthermore, beta-amyloid infu-
sions into the ATN reduce GABA in the Rgb
(Gonzalo-Ruiz, 1999). The latter result is notable given the
reduction in gabrd identified after the selective thalamic
lesion in the present study.
Several other genes for which expression patterns appear
be altered and that might be associated with dysfunction of
the retrosplenial cortex are associated with processes related
to Alzheimer’s disease. These include mmp9, chgB and
Hsd11b1 (Marcus et al., 1998; Marksteiner et al., 2000;
Lorenzl et al., 2003; de Quervain et al., 2004). Some transcripts
that were expressed differentially encode presenilin ligands
(e.g. ubqln1 and NCS-1), ApoE ligands (e.g. LRP3) and
ApoB processors (APOBEC1). Alterations were also noted in
transcripts that are associated with Lewy bodies (ubqln1 and
nefh). Metals are differentially regulated in neurodegenerative
disorders (Roloff and Platt, 1999), and pank4, which is lower
74 g.l. poirier et al.
in the ‘Lesion’ hemisphere, encodes an isoform of the pan-
tothenate kinase enzymes, which have a role in iron depo-
sition and neurodegeneration (Thomas and Jankovic, 2004).
The concentration of selenium is reduced in the temporal
lobe of people with Alzheimer’s disease (Wenstrup et al.,
1990) and the gene encoding selenoprotein M (selm) is also
expressed at lower levels in mice that overexpress human
presenilin-2 compared to their wild-type littermates (Hwang
et al., 2005). In the current study selm was lower in the
‘Lesion’ hemisphere, and selenium deficits can augment the
effects of glutamate overactivity (Savaskan et al., 2003).
In summary, tissue that appears normal when examined
with standard histological methods reveals evidence of wide-
spread alterations, including hypoactivity, even though it is
distal to the site of overt pathology. These findings are
similar to reports of posterior cingulate hypometabolism fol-
lowing thalamic atrophy in amnesic patients, again suggestive
of alterations in regions that are distal to those that exhibit
overt pathology (Fazio et al., 1992; Reed et al., 1999;
Chételat et al., 2003). Our results also address the controversy
about the existence and functional relevance of ‘covert’ path-
ology (Bachevalier and Meunier, 1996; Squire and Zola, 1996).
The widespread transcriptional abnormalities lend further
support for the notion that the retrosplenial cortex is respon-
sible for cognitive deficits even though its apparently intact
appearance has led it to be largely ignored in these conditions.
The present study identifies candidate genes, thereby indicat-
ing mechanisms involved in retrosplenial dysregulation and,
hence, better characterization of the susceptibility of the retro-
splenial cortex to distal damage. These results further our
understanding of the effects of insults to the brain and
reinforce the view that we need to consider the contributions
from regions without overt pathology.
ACKNOWLEDGEMENTS
We thank Prof. Zafir I. Bashir and Prof. Malcolm W. Brown
for their assistance. This research was funded by the
Medical Research Council (UK, G9713086 to J.P.A).
REFERENCES
Aggleton J.P. and Sahgal A. (1993) The contribution of the anterior thal-
amic nuclei to anterograde amnesia. Neuropsychologia 31, 1001–1019.
Aggleton J.P. and Brown M.W. (1999) Episodic memory, amnesia, and
the hippocampal-anterior thalamic axis. Behavioral and Brain
Sciences 22, 425 –444.
Albasser M.M., Poirier G.L., Warburton E.C., Aggleton J.P. (2007)
Hippocampal lesions halve immediate-early gene protein counts in
retrosplenial cortex: distal dysfunctions in a spatial memory system.
European Journal of Neuroscience 26, 1254–1266.
Allen P.B., Hvalby O., Jensen V., Errington M.L., Ramsay M.,
Chaudhry F.A. et al. (2000) Protein phosphatase-1 regulation in the
induction of long-term potentiation: Heterogeneous molecular mech-
anisms. Journal of Neuroscience 20, 3537–3543.
Altschul S.F., Madden T.L., Schaffer A.A., Zhang J., Zhang Z., Miller W.
et al. (1997) Gapped BLAST and PSI-BLAST: a new generation of protein
database search programs. Nucleic Acids Research 25, 3389–3402.
Archer J.S., Abbott D.F., Waites A.B. and Jackson G.D. (2003) fMRI
“deactivation” of the posterior cingulate during generalized spike
and wave. NeuroImage 20, 1915–1922.
Aupée A.M., Desgranges B., Eustache F., Lalevée C., de la Sayette V.,
Viader F. et al. (2001) Voxel-based mapping of brain hypometabolism
in permanent amnesia with PET. NeuroImage 13, 1164–1173.
Bachevalier J. and Meunier M. (1996) Cerebral ischemia: are the memory
deficits associated with hippocampal cell loss? Hippocampus 6, 553–560.
Baron J.C., Chételat G., Desgranges B., Perchey G., Landeau B., de la
Sayette V. et al. (2001) In vivo mapping of gray matter loss with voxel-
based morphometry in mild Alzheimer’s disease. Neuroimage 14, 298–309.
Bedford F.K., Kittler J.T., Muller E., Thomas P., Uren J.M., Merlo D.
et al. (2001) GABAA receptor cell surface number and subunit stab-
ility are regulated by the ubiquitin-like protein Plic-1. Nature
Neuroscience 4, 908–916.
Benjamini Y. and Hochberg Y. (1995) Controlling the false discovery
rate: A practical and powerful approach to multiple testing. Journal
of the Royal Statistical Society: Series B 57, 289–300.
Braak H. and Braak E. (1991a) Alzheimer’s disease affects limbic nuclei of
the thalamus. Acta Neuropathoogica 81, 261–268.
Braak H. and Braak E. (1991b) Neuropathological stageing of
Alzheimer-related changes. Acta Neuropathoogica 82, 239–259.
Brackmann M., Zhao C., Kuhl D., Manahan-Vaughan D. and
Braunewell K.-H. (2004) MGluRs regulate the expression of neuronal
calcium sensor proteins NCS-1 and VILIP-1 and the immediate early
gene arg3.1/arc in the hippocampus in vivo. Biochemical and
Biophysical Research Communications 322, 1073–1079.
Brandon E.P., Zhuo M., Huang Y., Qi M., Gerhold K.A., Burton K.A.
et al. (1995) Hippocampal long-term depression and depotentiation
are defective in mice carrying a targeted disruption of the gene encod-
ing the RIß subunit of cAMP-dependent protein kinase. Proceedings of
the National Academy of Sciences of the United States of America 92,
8851–8855.
Brenner E., Kondziella D., Haberg A. and Sonnewald U. (2005)
Impaired glutamine metabolism in NMDA receptor hypofunction
induced by MK801. Journal of Neurochemistry 94, 1594–1603.
Buytaert K.A., Kline A.E., Montanez S., Likler E., Millar C.J. and
Hernandez T.D. (2001) The temporal patterns of c-Fos and basic
fibroblast growth factor expression following a unilateral anteromedial
cortex lesion. Brain Research 894, 121–130.
Carpenedo R., Meli E., Peruginelli F., Pellegrini-Giampietro D.E. and
Moroni F. (2002) Kynurenine 3-mono-oxygenase inhibitors attenuate
post-ischemic neuronal death in organotypic hippocampal slice cul-
tures. Journal of Neurochemistry 82, 1465–1471.
Cavallaro S., D’Agata V., Manickam P., Dufour F. and Alkon D.L.
(2002) Memory-specific temporal profiles of gene expression in the
hippocampus. Proceedings of the National Academy of Sciences of the
United States of America 99, 16279–16284.
Chételat G., Desgranges B., De La Sayette V., Viader F., Eustache F. and
Baron J.C. (2002) Mapping gray matter loss with voxel-based mor-
phometry in mild cognitive impairment. Neuroreport 13, 1939–1943.
Chételat G., Desgranges B., de la Sayette V., Viader F., Berkouk K.,
Landeau B. et al. (2003) Dissociating atrophy and hypometabolism
impact on episodic memory in mild cognitive impairment. Brain
126, 1955–1967.
Chiang M.-Y., Misner D., Kempermann G., Schikorski T., Giguere V.,
Sucov H.M. et al. (1998) An essential role for retinoid receptors RARb
and RXRg in long-term potentiation and depression. Neuron 21,
1353–1361.
Chomczynski P. and Sacchi N. (1987) Single-step method of RNA iso-
lation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Analytical Biochemistry 162, 156–159.

Daw M.I., Ashby M.C. and Isaac J.T.R. (2007) Coordinated developmen-
tal recruitment of latent fast spiking interneurons in layer IV barrel
cortex. Nature Neuroscience 10, 453 –461.
Desgranges B., Baron J.-C., Lalevée C., Giffard B., Viader F., de la
Sayette V. et al. (2002) The neural substrates of episodic memory
impairment in Alzheimer’s disease as revealed by FDG-PET: relation-
ship to degree of deterioration. Brain 125, 1116–1124.
de Quervain D.J.F., Poirier R., Wollmer M.A., Grimaldi L.M.E., Tsolaki
M., Streffer J.R., Hock C., Nitsch R.M., Mohajeri M.H.,
Papassotiropoulos A. (2004) Glucocorticoid-related genetic suscepti-
bility for Alzheimer’s disease. Human Molecular Genetics 13, 47–52.
Drzezga A., Lautenschlager N., Siebner H., Riemenschneider M.,
Willoch F., Minoshima S. et al. (2003) Cerebral metabolic changes
accompanying conversion of mild cognitive impairment into
Alzheimer’s disease: a PET follow-up study. European Journal of
Nuclear Medicine and Molecular Imaging 30, 1104–1113.
Erhardt S. and Engberg G. (2002) Increased phasic activity of dopamin-
ergic neurones in the rat ventral tegmental area following pharmaco-
logically elevated levels of endogenous kynurenic acid. Acta
Physiologica Scandinavica 175, 45–53.
Fazio F., Perani D., Gilardi M.C., Colombo F., Cappa S.F., Vallar G.
et al. (1992) Metabolic impairment in human amnesia: a PET study
of memory networks. Journal of Cerebral Blood Flow and
Metabolism 12, 353 –358.
Figiel M. and Engele J. (2000) Pituitary adenylate cyclase-activating poly-
peptide (PACAP), a neuron-derived peptide regulating glial glutamate
transport and metabolism. Journal of Neuroscience 20, 3596–3605.
Garden D.L.F., Warburton E.C., Barker G.R.I., Aggleton J.P., Brown
M.W. and Bashir Z.I. (2006) A role for anterior thalamic nuclei in
determining synaptic plasticity in retrosplenial cortex. FENS
Abstracts 3, A120.6.
Genin A., Davis S., Meziane H., Doyere V., Jeromin A., Roder J. et al.
(2001) Regulated expression of the neuronal calcium sensor-1 gene
during long-term potentiation in the dentate gyrus in vivo.
Neuroscience 106, 571–577.
Giles P.J. and Kipling D. (2003) Normality of oligonucleotide microarray
data and implications for parametric statistical analyses.
Bioinformatics 19, 2254–2262.
Gonzalo-Ruiz A. (1999) Alteraciones en los sistemas de neurotransmisión
tras inyectar la proteı́na beta-amiloide ß(12-28) en el hipotálamo y en
el tálamo anterior de la rata. Revista de Neurologı́a 28, 931–941.
Gonzalo-Ruiz A., Sanz J.M., Morte L. and Lieberman A.R. (1997)
Glutamate and aspartate immunoreactivity in the reciprocal projec-
tions between the anterior thalamic nuclei and the retrosplenial gran-
ular cortex in the rat. Brain Research Bulletin 42, 309–321.
Harding A., Halliday G., Caine D. and Kril J. (2000) Degeneration of
anterior thalamic nuclei differentiates alcoholics with amnesia. Brain
123, 141 –154.
Hertz L. and Zielke H.R. (2004) Astrocytic control of glutamatergic
activity: astrocytes as stars of the show. Trends in Neuroscience 27,
735–743.
Hirai H., Pang Z., Bao D., Miyazaki T., Li L., Miura E. et al. (2005)
Cbln1 is essential for synaptic integrity and plasticity in the cerebel-
lum. Nature Neuroscience 8, 1534–1541.
Ho L., Guo Y., Spielman L., Petrescu O., Haroutunian V., Purohit D.
et al. (2001) Altered expression of a-type but not b-type synapsin
isoform in the brain of patients at high risk for Alzheimer’s disease assessed
by DNA microarray technique. Neuroscience Letters 298, 191–194.
Holter J.L., Humphries A., Crunelli V. and Carter D.A. (2001)
Optimisation of methods for selecting candidate genes from cDNA
thalamic lesions and retrosplenial activity 75
array screens: application to rat brain punches and pineal. Journal of
Neuroscience Methods 112, 173 –184.
Hong S.J., Li H., Becker K.G., Dawson V.L. and Dawson T.M. (2004)
Identification and analysis of plasticity-induced late-response genes.
Proceedings of the National Academy of Sciences of the United States
of America 101, 2145–2150.
Humphries A., Klein D., Baler R. and Carter D.A. (2002) cDNA array
analysis of pineal gene expression reveals circadian rhythmicity of
the dominant negative helix-loop-helix protein-encoding gene Id-1.
Journal of Neuroendocrinology 14, 101–108.
Hwang D.Y., Cho J.S., Oh J.H., Shim S.B., Jee S.W., Lee S.H. et al.
(2005) Differentially expressed genes in transgenic mice carrying
human mutant presenilin-2 (N141I): Correlation of selenoprotein M
with Alzheimer’s disease. Neurochemical Research 30, 1009–1019.
Hyder F., Patel A.B., Gjedde A., Rothman D.L., Behar K.L. and
Shulman R.G. (2006) Neuronal-glial glucose oxidation and
glutamatergic-GABAergic function. Journal of Cerebral Blood Flow
and Metabolism 26, 865 –877.
Ichinohe N. and Rockland K.S. (2002) Parvalbumin positive dendrites
co-localize with apical dendritic bundles in rat retrosplenial cortex.
Neuroreport 13, 757–761.
Insausti R., Herrero M.T. and Witter M.P. (1997) Entorhinal cortex of
the rat: Cytoarchitectonic subdivisions and the origin and distribution
of cortical efferents. Hippocampus 7, 146–183.
Ishiki M. and Klip A. (2005) Minireview: Recent developments in the
regulation of glucose transporter-4 traffic: New signals, locations,
and partners. Endocrinology 146, 5071–5078.
Jenkins T.A., Vann S.D., Amin E. and Aggleton J.P. (2004) Anterior
thalamic lesions stop immediate early gene activation in selective
laminae of the retrosplenial cortex: evidence of covert pathology in
rats? European Journal of Neuroscience 19, 3291–3304.
Johnson K.A., Jones K., Holman B.L., Becker J.A., Spiers P.A., Satlin A.
et al. (1998) Preclinical prediction of Alzheimer’s disease using
SPECT. Neurology 50, 1563–1571.
Jouvenceau A., Hedou G., Potier B., Kollen M., Dutar P. and Mansuy I.M.
(2006) Partial inhibition of PP1 alters bidirectional synaptic plasticity in
the hippocampus. European Journal of Neuroscience 24, 564–572.
Kel A.E., Gossling E., Reuter I., Cheremushkin E., Kel-Margoulis O.V.
and Wingender E. (2003) MATCHTM : a tool for searching transcrip-
tion factor binding sites in DNA sequences. Nucleic Acids Research 31,
3576–3579.
Kogure D., Matsuda H., Ohnishi T., Asada T., Uno M., Kunihiro T.
et al. (2000) Longitudinal evaluation of early Alzheimer’s disease using
brain perfusion SPECT. Journal of Nuclear Medicine 41, 1155–1162.
Krausz Y., Freedman N., Lester H., Newman J.P., Barkai G., Bocher M.
et al. (2004) Regional cerebral blood flow in patients with mild
hypothyroidism. Journal of Nuclear Medicine 45, 1712–1715.
Laurens K.R., Kiehl K.A., Ngan E.T.C. and Liddle P.F. (2005) Attention
orienting dysfunction during salient novel stimulus processing in
schizophrenia. Schizophrenia Research 75, 159–171.
Li Q., Clark S., Lewis D.V. and Wilson W.A. (2002) NMDA receptor
antagonists disinhibit rat posterior cingulate and retrosplenial cortices:
A potential mechanism of neurotoxicity. Journal of Neuroscience 22,
3070–3080.
Lindecke A., Korte M., Zagrebelsky M., Horejschi V., Elvers M., Widera
D. et al. (2006) Long-term depression activates transcription of
immediate early transcription factor genes: involvement of serum
response factor/Elk-1. European Journal of Neuroscience 24, 555–563.
Lorenzl S., Albers D.S., Relkin N., Ngyuen T., Hilgenberg S.L.,
Chirichigno J., Cudkowicz M.E., Beal M.F. (2003) Increased
76 g.l. poirier et al.
plasma levels of matrix metalloproteinase-9 in patients with
Alzheimer’s disease. Neurochemistry International 43, 191–196.
Maguire E. (2001) The retrosplenial contribution to human navigation:
A review of lesion and neuroimaging findings. Scandinavian Journal
of Psychology 42, 225–238.
Marcus D.L., Strafaci J.A., Miller D.C., Masia S., Thomas C.G.,
Rosman J., Hussain S., Freedman M.L. (1998) Quantitative
neuronal c-Fos and c-Jun expression in Alzheimer’s disease.
Neurobiology of Aging 19, 393 –400.
Marksteiner J., Lechner T., Kaufmann W.A., Gurka P., Humpel C.,
Nowakowski C., Maier H., Jellinger K.A. (2000) Distribution of chro-
mogranin B-like immunoreactivity in the human hippocampus and its
changes in Alzheimer’s disease. Acta Neuropathologica 100, 205–212.
Martinez-Bisbal M.C., Arana E., Marti-Bonmati L., Molla E. and Celda
B. (2004) Cognitive impairment: classification by 1H magnetic reson-
ance spectroscopy. European Journal of Neurology 11, 187–193.
Masliah E., Terry R. and Buzsaki G. (1989) Thalamic nuclei in Alzheimer
disease: evidence against the cholinergic hypothesis of plaque for-
mation. Brain Research 493, 240–246.
Matsuda H., Kitayama N., Ohnishi T., Asada T., Nakano S., Sakamoto
S. et al. (2002) Longitudinal evaluation of both morphologic and func-
tional changes in the same individuals with Alzheimer’s disease.
Journal of Nuclear Medicine 43, 304–311.
Matsuyama S.C.A., Matsumoto A., Hashimoto H., Shintani N. and
Baba A. (2003) Impaired long-term potentiation in vivo in the dentate
gyrus of pituitary adenylate cyclase-activating polypeptide (PACAP) or
PACAP type 1 receptor-mutant mice. Neuroreport 14, 2095–2098.
Meguro K., Blaizot X., Kondoh Y., Le Mestric C., Baron J.C. and
Chavoix C. (1999) Neocortical and hippocampal glucose hypometa-
bolism following neurotoxic lesions of the entorhinal and perirhinal
cortices in the non-human primate as shown by PET: Implications
for Alzheimer’s disease. Brain 122, 1519–1531.
Mi R., Tang X., Sutter R., Xu D., Worley P. and O’Brien R.J. (2002)
Differing mechanisms for glutamate receptor aggregation on dendritic
spines and shafts in cultured hippocampal neurons. Journal of
Neuroscience 22, 7606–7616.
Mingorance A., Fontana X., Soriano E. and del Rio J.A. (2005)
Overexpression of myelin-associated glycoprotein after axotomy of the
perforant pathway. Molecular and Cellular Neurosciences 29, 471–483.
Minoshima S., Giordani B., Berent S., Frey K.A., Foster N.L., Kuhl D.E.
(1997) Metabolic reduction in the posterior cingulate cortex in very
early Alzheimer’s disease. Annals of Neurology 42, 85–94.
Mitelman S.A., Shihabuddin L., Brickman A.M., Hazlett E.A. and
Buchsbaum M.S. (2003) MRI assessment of gray and white matter
distribution in Brodmann’s areas of the cortex in patients with schizo-
phrenia with good and poor outcomes. American Journal of Psychiatry
160, 2154–2168.
Mody I. (2001) Distinguishing between GABA(A) receptors responsible
for tonic and phasic conductances. Neurochemical Research 26, 907–913.
Morishita W., Connor J.H., Xia H., Quinlan E.M., Shenolikar S. and
Malenka R.C. (2001) Regulation of synaptic strength by protein phos-
phatase 1. Neuron 32, 1133–1148.
Moroni F. (1999) Tryptophan metabolism and brain function: focus on
kynurenine and other indole metabolites. European Journal of
Pharmacology 375, 87–100.
Mulkey R.M., Endo S., Shenolikar S. and Malenka R.C. (1994)
Involvement of a calcineurin/ inhibitor-1 phosphatase cascade in hip-
pocampal long-term depression. Nature 369, 486–488.
Murphy D. (2002) Gene expression studies using microarrays: Principles,
problems, and prospects. Advances in Physiology Education 26, 256–270.
Nagy V., Bozdagi O., Matynia A., Balcerzyk M., Okulski P., Dzwonek J.
et al. (2006) Matrix metalloproteinase-9 is required for hippocampal
late-phase long-term potentiation and memory. Journal of
Neuroscience 26, 1923–1934.
Nestor P.J., Fryer T.D., Ikeda M. and Hodges J.R. (2003a) Retrosplenial
cortex (BA 29/30) hypometabolism in mild cognitive impairment
(prodromal Alzheimer’s disease). European Journal of Neuroscience
18, 2663–2667.
Nestor P.J., Fryer T.D., Smielewski P. and Hodges J.R. (2003b) Limbic
hypometabolism in Alzheimer’s disease and mild cognitive impair-
ment. Annals of Neurology 54, 343 –351.
Newell K.A., Zavitsanou K. and Huang X-F.C.A. (2005) Ionotropic glu-
tamate receptor binding in the posterior cingulate cortex in schizo-
phrenia patients. Neuroreport 16, 1363–1367.
Nieto-Sampedro M., Lewis E.R., Cotman C.W., Manthorpe M., Skaper
S.D. and Barbin G. et al. (1982) Brain injury causes a time-dependent
increase in neuronotrophic activity at the lesion site. Science 217, 860–861.
Norenberg M.D. and Martinez-Hernandez A. (1979) Fine structural
localization of glutamine synthetase in astrocytes of rat brain. Brain
Research 161, 303–310.
O’Brien R.J., Xu D., Petralia R.S., Steward O., Huganir R.L. and
Worley P. (1999) Synaptic clustering of AMPA receptors by the extra-
cellular immediate-early gene product Narp. Neuron 23, 309–323.
Ogita K., Fujinami Y., Kitano M. and Yoneda Y. (2003) Transcription
factor activator protein-1 expressed by kainate treatment can bind to
the non-coding region of mitochondrial genome in murine hippo-
campus. Journal of Neuroscience Research 73, 794–802.
Ogita K., Okuda H., Kitano M., Fujinami Y., Ozaki K. and Yoneda Y.
(2002) Localization of Activator Protein-1 complex with DNA binding
activity in mitochondria of murine brain after in vivo treatment with
kainate. Journal of Neuroscience 22, 2561–2570.
Otto C., Kovalchuk Y., Wolfer D.P., Gass P., Martin M., Zuschratter W.
et al. (2001) Impairment of mossy fiber long-term potentiation and
associative learning in pituitary adenylate cyclase activating polypeptide
type I receptor-deficient mice. Journal of Neuroscience 21, 5520–5527.
Patel A.B., de Graaf R.A., Mason G.F., Rothman D.L., Shulman R.G.
and Behar K.L. (2005) The contribution of GABA to glutamate/gluta-
mine cycling and energy metabolism in the rat cortex in vivo.
Proceedings of the National Academy of Sciences of the United States
of America 102, 5588–5593.
Pavlidis P. (2003) Using ANOVA for gene selection from microarray
studies of the nervous system. Methods 31, 282–289.
Paxinos G. and Watson C. (1997) The Rat Brain in Stereotaxic
Coordinates. Academic Press.
Pepicelli O., Fedele E., Berardi M., Raiteri M., Levi G., Greco A. et al.
(2005) Cyclo-oxygenase-1 and -2 differently contribute to prostaglan-
din E2 synthesis and lipid peroxidation after in vivo activation of
N-methyl-d-aspartate receptors in rat hippocampus. Journal of
Neurochemistry 93, 1561–1567.
Petrini E.M., Marchionni I., Zacchi P., Sieghart W. and Cherubini E.
(2004) Clustering of extrasynaptic GABAA receptors modulates
tonic inhibition in cultured hippocampal neurons. Journal of
Biological Chemistry 279, 45833–45843.
Poirier G. and Aggleton J.P. (2006) The retrosplenial cortex and
immediate-early gene reactivity following deafferentation in the rat.
Experimental Psychology Society Abstract.
Poirier G., Bloom Z. and Aggleton J.P. (2005) Temporal effect of
anterior thalamic lesions on gene activation in retrosplenial cortex in
the rat: Early appearance of “covert” pathology. European Brain and
Behaviour Society Abstract.

Reed L.J., Marsden P., Lasserson D., Sheldon N., Lewis P., Stanhope N.
et al. (1999) FDG-PET analysis and findings in amnesia resulting from
hypoxia. Memory 7, 599 –612.
Reed L.J., Lasserson D., Marsden P., Stanhope N., Stevens T., Bello F.
et al. (2003) FDG-PET findings in the Wernicke-Korsakoff syndrome.
Cortex 39, 1027–1045.
Roloff E.L. and Platt B. (1999) Biochemical dysfunction and memory
loss: the case of Alzheimer’s dementia. Cellular and Molecular Life
Sciences 55, 601 –616.
Salmon E., Collette F., Degueldre C., Lemaire C. and Franck G. (2000)
Voxel-based analysis of confounding effects of age and dementia
severity on cerebral metabolism in Alzheimer’s disease. Human
Brain Mapping 10, 39–48.
Savaskan N.E., Brauer A.U., Kuhbacher M., Eyupoglu I.Y., Kyriakopoulos
A., Ninnemann O. et al. (2003) Selenium deficiency increases suscepti-
bility to glutamate-induced excitotoxicity. FASEB Journal 17, 112–114.
Schwieler L., Erhardt S., Erhardt C. and Engberg G. (2005)
Prostaglandin-mediated control of rat brain kynurenic acid synthesis -
opposite actions by COX-1 and COX-2 isoforms. Journal of Neural
Transmission 112, 863 –872.
Selkoe D.J. (2002) Alzheimer’s disease is a synaptic failure. Science 298,
789–791.
Shivers B.D., Killisch I., Sprengel R., Sontheimer H., Kohler M.,
Schofield P.R. et al. (1989) Two novel GABAA receptor subunits
exist in distinct neuronal subpopulations. Neuron 3, 327 –337.
Small D.H., Mok S.S. and Bornstein J.C. (2001) Alzheimer’s disease and
Abeta toxicity: from top to bottom. Nature Reviews Neuroscience 2,
595–598.
Squire L.R. and Zola S.M. (1996) Ischemic brain damage and memory
impairment: a commentary. Hippocampus 6, 546–552.
Subramanian A., Tamayo P., Mootha V.K., Mukherjee S., Ebert B.L.,
Gillette M.A. et al. (2005) Gene set enrichment analysis: A
knowledge-based approach for interpreting genome-wide expression
profiles. Proceedings of the National Academy of Sciences of the
United States of America 102, 15545–15550.
Sugden D. (2003) Comparison of circadian expression of tryptophan
hydroxylase isoform mRNAs in the rat pineal gland using real-time
PCR. Journal of Neurochemistry 86, 1308–1311.
Sutherland R.J. and Hoesing J.M. (1993) Posterior cingulate cortex and
spatial memory: A microlimnology analysis. In Vogt B.A., Gabriel M.
(eds) Neurobiology of cingulate cortex and limbic thalamus: A compre-
hensive handbook. Birkhäuser. pp 461 –477.
Takano T., Tian G.-F., Peng W., Lou N., Libionka W., Han X. et al.
(2006) Astrocyte-mediated control of cerebral blood flow. Nature
Neuroscience 9, 260–267.
Thomas M. and Jankovic J. (2004) Neurodegenerative disease and iron
storage in the brain. Current Opinion in Neurology 17, 437–442.
Valenstein E., Bowers D., Verfaellie M., Heilman K.M., Day A. and
Watson R.T. (1987) Retrosplenial amnesia. Brain 110, 1631–1646.
Valla J., Berndt J.D. and Gonzalez-Lima F. (2001) Energy hypometabo-
lism in posterior cingulate cortex of Alzheimer’s patients: superficial
laminar cytochrome oxidase associated with disease duration.
Journal of Neuroscience 21, 4923–4930.
van der Werf Y.D., Scheltens P., Lindeboom J., Witter M.P., Uylings
H.B.M. and Jolles J. (2003) Deficits of memory, executive functioning
and attention following infarction in the thalamus; a study of 22 cases
with localised lesions. Neuropsychologia 41, 1330–1344.
van Groen T. and Wyss J.M. (2003) Connections of the retrosplenial
granular b cortex in the rat. Journal of Comparative Neurology 463,
249–263.
thalamic lesions and retrosplenial activity 77
van Groen T., Vogt B.A. and Wyss J.M. (1993) Interconnections between
the thalamus and retrosplenial cortex in the rodent brain. In Vogt B.A.,
Gabriel M. (eds) Neurobiology of cingulate cortex and limbic thalamus:
A comprehensive handbook. Birkhäuser. pp. 123–150.
Vaynman S., Ying Z., Wu A. and Gomez-Pinilla F. (2006) Coupling
energy metabolism with a mechanism to support brain-derived neuro-
trophic factor-mediated synaptic plasticity. Neuroscience 139, 1221–
1234.
Vogt B.A. and Peters A. (1981) Form and distribution of neurons in rat
cingulate cortex: Areas 32, 24, and 29. Journal of Comparative
Neurology 195, 603–625.
Vogt B.A., Rosene D.L. and Peters A. (1981) Synaptic termination of
thalamic and callosal afferents in cingulate cortex of the rat. Journal
of Comparative Neurology 201, 265–283.
Wenstrup D., Ehman W.D. and Markesbery W.R. (1990) Trace element
imbalances in isolated subcellular fractions of Alzheimer’s disease
brains. Brain Research 533, 125 –131.
White A.-M. and Platt B. (2001) Ionic mechanisms of GABA-induced
long-term potentiation in the rat superior colliculus. Experimental
Brain Research 140, 486–494.
Wibrand K., Messaoudi E., Havik B., Steenslid V., Lovlie R., Steen V.M.
et al. (2006) Identification of genes co-upregulated with Arc during
BDNF-induced long-term potentiation in adult rat dentate gyrus in
vivo. European Journal of Neuroscience 23, 1501–1511.
Williams J.M., Thompson V.L., Mason-Parker S.E., Abraham W.C. and
Tate W.P. (1998) Synaptic activity-dependent modulation of mito-
chondrial gene expression in the rat hippocampus. Brain Research.
Molecular Brain Research 60, 50–56.
Wisden W. and Morris B.J. (1994) In situ hybridization with synthetic
oligonucleotide probes. In Wisden, W. and Morris, B.J. (eds) In situ
hybridization protocols for the brain. Academic Press, pp 9–34.
Yao P.J., Zhu M., Pyun E.I., Brooks A.I., Therianos S., Meyers V.E.
et al. (2003) Defects in expression of genes related to synaptic
vesicle trafficking in frontal cortex of Alzheimer’s disease.
Neurobiology of Disease 12, 97–109.
and
Yunfeng L., Yongsheng C., Lifeng Z., Qiping F., Zhuo L., Yongwei Z.
et al. (2005) High glucose upregulates pantothenate kinase 4
(PanK4) and thus affects M2-type pyruvate kinase (Pkm2).
Molecular and Cellular Biochemistry 277, 117–125.
Correspondence should be addressed to:
Guillaume Poirier
School of Psychology
Cardiff University
70 Park Place
Cardiff, UK, CF10 3AT
tel: 44 (0) 29 2087 5301
fax: 44 (0) 29 2087 4858
email: PoirierG@cardiff.ac.uk
and
Kate Shires
Centre for Cognitive and Neural Systems
Dept of Neuroscience
University of Edinburgh
1 George Square
Edinburgh, UK, EH8 9JZ
tel: þ44 131 650 4571
fax: þ44 131 651 1835
email: kshires@staffmail.ed.ac.uk
SUPPLEMENTAL MATERIAL ATN LESIONS & RSC TRANSCRIPTOME

S L S L S L S L S L S L
30 min 2 hrs 8 hrs 30 min 2 hrs 8 hrs

Replicate 1 Replicate 1
Figure S1: Histogram representation of the normalised intensity (log scale) profiles of all the samples. S, ‘Intact’;
L, Lesion.
SUPPLEMENTAL MATERIAL ATN LESIONS & RSC TRANSCRIPTOME

Table 2: Treatment profiling analysis list of genes that were found to be consistently expressed at different levels in the
‘Intact’ and the Lesion retrosplenial cortex hemispheres, grouped by expression pattern set. *If applicable. For EST
similarity, the value on the left is the similarity score, and the value on the right is the E-value. (S= ‘Intact’ = solid line; L =
‘Lesion’ = dashed line).

EST
Function
Set Classification
Name Synonym(s) similarity
*
Genbank

1 Immune system

Vesicle-related
Glucocorticoid induced transcript 1 (Glcci1)

Secretory carrier embrane protein 1 (Scamp1)

Gig 18, Tssn1 1203 0.0 BE108162

BM386698
Signal transduction Protein phosphatase 1, regulatory (inhibitor) subunit 1c
801 0.0 AA943808
(unclassified) (Ppp1r1c)
Signal transduction Disabled homolog 2 (Drosophila) interacting protein
DIP1/2 AF236130
(unclassified) (Dab2ip)
Signal transduction Protein kinase, cAMP dependent regulatory, type 1
BG375376
(unclassified) beta (Prkar1b) R1beta
Gamma-SNAP-associated factor 1 (GAF1),
GTP-binding
RAB11 family interacting protein 5 (RAB11FIP5) pp75, RIP11, KIAA0857, DKFZP434H018, 505 6e-140 BI296378
proteins
D6Ertd32e
Potassium voltage-gated channel, delayed rectifier,
Ion transport Voltage-gated potassium channel subunit Kv9.1 NM_053954
subfamily S, 1 (kcns1)
Small acidic protein (Smap), thyroid receptor
Transcription Bromodomain containing 8 (Brd8) AI549477
coactivating protein, p120
Transcription Kruppel-like factor 5 (intestinal) (Klf5) IKLF, BTEB-2 NM_053394

Translation Ribosomal 60S protein l15 (Rpl15) EC45, RPYL10 AA800007

S>L Folding, Sorting LOC361797; Heat shock protein 70-3 (HSP70 -
and Degradation Heat shock 70kD protein 1-like (Hspa1l) 3); HSP70-HOM; Major histocompatibility 561 8e-157 BG381414
component complex 4-1 (C4-1)
Folding, Sorting
Mitochondria associated granulocyte macrophage CSF
and Degradation CGI-136, TIM16 BG379323
signaling molecule (Magmas)
Replication and
Replication protein A3 (Rpa3) 720 0.0 BM383451
repair
Carbohydrate
Malate dehydrogenase, mitochondrial (Mdh2) Mor1 NM_031151
metabolism
ATP synthase, H+ transporting, mitochondrial F1
ATP synthesis D13127
complex, O subunit (Atp5o)
Nitrogen
glutamate-ammonia ligase (Glul) Glutamine synthase AW528806
metabolism
Metabolism of
Uroporphyrinogen decarboxylase (Urod) hemE Y00350
cofactors and
SUPPLEMENTAL MATERIAL ATN LESIONS & RSC TRANSCRIPTOME

vitamins

2
Kelch domain containing 3 (Klhdc3)/ Protein
phosphatase 2a regulatory b56-delta subunit (confirmed)
Cell growth Peas for klhdc3 662 0.0
AA894104
(Ppp2r5d)/Male-enhanced antigen-1 (Mea1)
[OVERLAPPING GENE COMPLEX]
Development Neuritin 1 (Nrn1) Nrn NM_053346

Vesicle-related Synaptotagmin 5 (Syt5) NM_019350

Signal transduction Calcium/calmodulin-dependent protein kinase (CaM
NM_133605
(unclassified) kinase) II gamma (Camk2g)
N-ethylmaleimide sensitive fusion protein attachment
Vesicle-related SNAPA NM_080585
protein alpha (Napa)
GTP-binding
S>L Rab3B protein NM_031091
proteins
Transcription Nuclear factor I/X (Nfix) CTF, NF1A BF420722

Transcription Single stranded DNA binding protein 3 (SSBP3) SSDP, CSDP; FLJ10355 NM_053358
DEAD (aspartate-glutamate-alanine-aspartate) box
Translation GRTH NM_031630
polypeptide 25 (Ddx25)
Translation Deoxyhypusine synthase (DHS/Dhps/Dys1) AA892493
Folding, Sorting Down syndrome critical region homolog 2 (H. sapiens
C21LRP, LRPC21, PAC1 803 0.0 BF407158
and Degradation (Dscr2)
Folding, Sorting
F-box only protein 6b (Fbxo6b) FBX6, FBG2,FBS2 AF393484
and Degradation
Lipid Metabolism Monoglyceride lipase (Mgll) AI713204
Oxidative
NADH dehydrogenase (Ndufa8) 1029 0.0 BI280270
phosphorylation
Small nuclear ribonucleoprotein associated protein N,
Unclassified 60.0 9e-06 AI171982
upstream reading frame (SNURF)
942 0.0
Unknown SID1 transmembrane family, member 2 (sidt2) CGI-40 (predicted); AI579643
474 1e-130

3 Lipid metabolism

MAPK signalling
Phosphatidylinositol transfer protein (Pitpn)

PTPL1-associated RhoGAP1 (Parg1)

VIB1A ( Homo sapiens: PITPNA (Homologs)

490 3e-135
NM_017231

AI407483
WNT signalling DGPWD, Transducin-like enhancer of split 1
Groucho protein (GRG1) BG380534
pathway (Tle1)
Neuroactive ligand-
5-HT2C receptor (5-HT2cR) Htr1c 509 3e-141 BF285539
receptor interaction
Potassium voltage gated channel, shaker related
S>L Ion transport
subfamily, member 4 (kcna4)
KV1.4 NM_012971
Cell adhesion
Olfactomedin 3 (Olfm3) Optimedin form B, NOE3 AF442822
molecules
Transcription Polymerase (RNA) III a (155kd) RPC155 BC053071; MGC62420 733 0.0 BI274108

Translation 40S ribosomal protein S14 (RPS14) NM_022672

Translation Mitochondrial ribosomal protein L4 isoform 2 (Mrpl4) CGI-28 BI275903

SUPPLEMENTAL MATERIAL ATN LESIONS & RSC TRANSCRIPTOME

Folding, Sorting
Ubiquitin specific protease 3 (Usp3) AI411205
and Degradation
Folding, Sorting
Cyclophilin B (Ppib) NM_022536
and Degradation
Oxidative NADH dehydrogenase, mitochondrial 24-kDa subunit
M22756
phosphorylation (Ndufv2)
Clathrin coat assembly protein AP50; clathrin-
Adaptor-related protein complex 2, mu 1 subunit
Vesicle-related associated/assembly/adaptor protein, medium NM_053837
(Ap2m1)
1 (CLAPM1)

4
Signal transduction Protein phosphatase 1, regulatory (inhibitor) subunit 1A
NM_022676
(unclassified) (Ppp1r1a)
Signal transduction
Exostosin 1 (Ext1) BM384468
(unclassified)
MAPK signalling Regulator of G-protein signaling 4 (Rgs4) RGP4 U27767

Ion transport GABA A receptor delta (Gabrd) NM_017289

Sodium channel, voltage-gated, type I, beta
S>L Ion transport
polypeptide (Scn1b)
GEFSP1 NM_017288
Cell adhesion Syndecan 1 (Synd1), CD138 antigen, HSPG,
Syndecan-1 (Sdc1) NM_013026
molecules Syndeca, CD138
Folding, Sorting Proteasome (prosome, macropain) 26s non-ATPase 26S Proteasome subunit p58, Psd3, AntP91a,
BI285842
and Degradation subunit 3 (Psmd3) Tstap91a, D11Bwg1349e
hypothetical protein MGC11324, Hypothetical
Lipid Metabolism 398 9e-108 AI599365
phospholipid and glycerol acyltransferase
ATP synthesis ATPase, vacuolar, 14 kD (Atp6s14) Atp6v1f, VATF, VMA7 NM_053884
Host cell factor C1 regulator 1 (XPO1-dependent;
Unclassified HPIP, FLJ20568, MGC70711 AA944494
HCFC1R1)

5 Development

Immune System
Plexin b2 (Plxnb2)

CD83
BG380275

AI412355

MAPK signalling Adrenergic receptor kinase, beta 1 (Adrbk1) BARK1, GRK2 AI716801

MAPK signalling Mitogen-activated protein kinase 6 (Mapk6) ERK3 NM_031622

S>L
Transcription nuclear receptor subfamily 4, group A, member 1 Nur77/NGFIB BI282332
(NR4A1)
(confirmed)
Translation Ribosomal protein L23a (Rpl23a) 60S ribosomal protein L23a 1003 0.0
AI172199
Endoplasmic reticulum transmembrane protein
(Dri 42), Phosphatidic acid phosphohydrolase,
Lipid Metabolism Phosphatidic acid phosphatase type 2B (PPAP2B) Y07783
Vascular endothelial growth factor and type I
collagen inducible
Lipid Metabolism Fatty acid Coenzyme A ligase, long chain 6 (Facl6) NM_130739

Unknown KIAA1086 728 0.0 BI294610

6 Cell growth

Cell growth
Cyclin D2 (CCND2)

PKC-delta binding protein (Prkcdbp)

KIAK0002, MGC102758 BG380633

NM_134449
SUPPLEMENTAL MATERIAL ATN LESIONS & RSC TRANSCRIPTOME

U2(RNU2) small nuclear RNA auxillary factor 1-like 1

Transcription SP2, U2afi-rsi, U2AF1RS1, U2AFBPL BF404554
(U2AF1L1) [located in an intron of the Murr1 gene]
S>L Translation Staufen NM_053436
Folding, Sorting Proteasome [20S] (prosome,macropain) inhibitor
PI31, MGC18784 BF561377
and Degradation subunit 1 (Psmf1)
Oxidative
NADH dehydrogenase (Ndufb6) AI104528
phosphorylation
Cytoskeleton,
microtubule and Neurofilament, heavy polypeptide (Nefh) Nfh AF031879
actin-related

7 Cell communication
Neuroactive ligand-
Tubulin alpha 4 chain (Tuba4)

Adenylate cyclase activating polypeptide 1 (Adcyap1)

alpha-tubulin 4

PACAP
BI284599

NM_016989
receptor interaction
Cell adhesion
Limbic system-associated membrane protein (Lsamp) LAMP-1, CD107a, LGP120 U31554
molecules
Translation Eukaryotic initiation factor 5 (eIF-5) BE107346
S>L Folding, Sorting
similar to similar to Protein C20orf22 homolog 908 0.0 BI284608
and Degradation
Folding, Sorting
Signal recognition particle 68kDa (Srp68) MGC38208 BI296671
and Degradation
Unknown leucine rich repeat containing 57 (Lrrc57) 389 7e-105 BE101274

8
MAPKK Mitogen-activated protein kinase kinase 1
MAPK signalling Mek binding partner 1 (Mp1), Mabp AA817829
interacting protein 1 (MAP2K1IP1)
Potassium voltage gated channel, Shaw-related
Ion transport KV3.1; KV4 NM_012856
subfamily, member 1 (kcnc1)
Transcription Splicing factor 3a, subunit 3 (Sf3a3) SAP 61, SF3A60 1065 0.0 BM391739
S>L
Oxidative Cytochrome C oxidase- subunit Via polypeptide 1
BI282326
phosphorylation (Cox6a1)
Asparagine synthetase, Cell cycle control
Amino acid
Asparagine synthetase (Asns) protein TS11, Glutamine- dependent U07202
metabolism
asparagine synthetase
Cytoskeleton,
microtubule and Microtubule-associated protein 2 (MAP2) Mtap2 X74211
actin-related

9
Mdm4, transformed 3T3 cell double minute 1, p53
Cell growth BE099784
binding protein (mouse) (mdm1)
Immune System CD74 INVG34, LN2 NM_013069
L>S Signal transduction transmembrane emp24 protein transport domain
HNLF 204 2e-49 AI235294
(unclassified) containing 4 (tmed4)
Solute carrier organic anion transporter family, member Solute carrier family 21 (organic anion
Ion transport AF169410
2B1 (SLCO2B1) transporter), member 9 (Slc21a9)
Transcription Putative homeodomain transcription factor 2 (Phtf2) 295 8e-77 AI410924
Folding, Sorting
DEAH (Asp-Glu-Ala-His) box polypeptide 40 (DHX40) ARG147, DDX40, PAD AI178155
and Degradation
10 Transcription Retinoblastoma binding protein 5 (RBBP-5) RBQ 3 396 3e-107 AA946518
SUPPLEMENTAL MATERIAL ATN LESIONS & RSC TRANSCRIPTOME

Signal transduction
G protein-coupled receptor 162 (GPR162) Gene rich cluster, A gene (Grca); A-2 BM386619
(unclassified)
S>L Calcium channel, voltage-dependent T-type, alpha 1I
Ion transport Cav3.3 287 1e-74 BE105417
subunit (CACNA1I), transcript variant 2
CDP-diacylglycerol synthase (phosphatidate
Lipid Metabolism NM_031242
cytidylyltransferase) 1 (Cds1)
Metabolism of
cofactors and coenzyme Q9 homolog 1068 0.0 AI232494
vitamins
similar to and predicted: chromosome 20 open reading
Unknown 601 6e-169 AI638949
frame 116 (LOC296162)

11
Nasal embryonic LHRH [luteinizing hormone-releasing Jacob protein alternatively spliced isoform
Development AJ293698
hormone] factor (Nelf) delta1 (jac gene)
Calcium/calmodulin-dependent protein kinase kinase
unclassified NM_031662
1, alpha (Camkk1)
Transient receptor potential cation channel, subfamily
Ion transport Epithelial calcium channel 1 (Ecac1) NM_053787
S>L V, member 5 (TRPV5)
Transcription THAP domain containing 4 (Thap4) CGI-36, PP238 BI275281
Folding, Sorting
Matrix metalloproteinase 24 (Mmp24) Mt5-mmp 188 1e-44 BF285924
and Degradation
Metabolism of
cofactors and Pantothenate kinase 4 (Pank4) NM_133531
vitamins

12
Cytoskeleton,
microtubule and Actin alpha-1 (Acta1) NM_019212
actin-related
Vesicle-related Frequenin homolog (Drosophila) Neuronal calcium sensor 1 (NCS-1) NM_024366
S>L Vesicle-related Exocyst complex component 7 (Exoc7) EXO70 BM388722
transmembrane protein 93; Vanilloid receptor subtype 944 0.0; 507
Unknown MGC2963 1e-140
BI285673
1 (H. sapiens)
Homo Sapiens Chromosome 9 open reading frame 25
Unknown FLJ39031, bA573M23.5 272 6e-70 BI298306
(C9orf25)

13
Nuclear distribution gene C homolog (Aspergillus;
Cell growth c15, Silg92 NM_017271
Nudc)
DNA-directed RNA polymerase II 7.6 kda polypeptide L
Transcription RBP-10 476 3e-161 AA924509
(POL2RL)
S>L
Unclassified Selenoprotein M (Selm) SepM, A230103K18, 1500040L08Rik BI282694

Unknown Gene rich cluster C10 (Grcc10) C10, C12orf57 BI282112

Unknown RGD1564450_predicted LOC294291 793 0.0 AW915035

14
Reprimo (candidate mediator of the tp53-dependent
Cell growth 672 0.0 BG381258
G2 arrest)
E-3 epididymal fluid protein, 2D6 glycoprotein;
Immune System LOC171412 AF329091
Defb22,
L>S Folding, Sorting
Apobec-1 complementation factor (Acf) ACF64 NM_133400
and Degradation
176 6e-41;
Unknown Calpain10 (capn10); BDNF exon 5 172 1e-39
BI296532
 SUPPLEMENTAL MATERIAL ATN LESIONS & RSC TRANSCRIPTOME

Unknown EST BI291373

15 Transcription
Oxidative
Neurogenic differentiation 1 (NeuroD1)

Cytochrome oxidase 6b1 (Cox6b1)

BETA2, BHF-1, Neurod

739 0.0
AI639109

AI230604
phosphorylation
L>S Metabolism Kynurenine 3-monooxygenase (KMO) Kynurenine 3-hydroxylase NM_021593

Vesicle-related EH-domain containing 2 (Ehd-2) MGEPS, PAst2, MGC25606, MGC38650 BE110691

LOC294019, Hypothetical protein FLJ12133,
Unknown Family with sequence similarity 26, member B 1120 0.0 BM391099
2810048G17Rik
unclassified

Mitochondrial 28S ribosomal protein S29 (MRP-

S>L Cell death Death associated protein 3 (DAP-3) 831 0.0 BI285645
S29)
(confirmed)
S>L Cell death Tnf receptor-asociated factor 7 (Traf7) MGC7807, RFWD 1 682 0.0
BI287266
PREDICTED: Mus musculus angiomotin-like 1,
L>S Cell communication JEAP 678 0.0 BI277433
transcript variant 5 (Amotl1), mRNA
L>S Cell communication Zyxin (Zyx) HED-2 AA943537

L>S Development Netrin 1 NM_053731

S>L Development Dihydropyrimidinase-like 4 (Dpysl4) rCRMP-3 BF413467

L>S Development Enah/Vasp-like (Evl) RNB6 BF404078

Major histocompatibility complex clas II DM beta (Hla-
L>S Immune System AI171966
dmb)
RT1 class histocompatibility antigen, B-1 beta chain
L>S Immune System AI715202
precursor (RT1.B beta 1)
Rat MHC class II RT1.u-D-alpha chain mRNA, 3' end
L>S Immune System HLA-DRA Y00480
(RT1-Da)
CRIT (complement C2 receptor inhibitory
L>S Immune System Trispanning orphan (Tore) NM_022679
trispanning)*
Complement-activating component of Ra-
L>S Immune System Mannan-binding lectin serine protease 1 (Masp1) BE111083
reactive factor precursor (CRARF1)
PX-19-like protein homolog, H. sapiens); Preli,
S>L Immune System PX-19 BI279855
CGI-106
Amino acid
S>L Amiloride binding protein 1 (Abp1) NM_022935
metabolism
S>L MAPK signalling Mitogen activated protein kinase kinase 2 (Map2k2) D14592
*predicted similar to A-kinase anchor protein 13 428 9e-117
isoform 2 isoform 11 [mus musculus] 428 9e-117
L>S MAPK signalling AI599048
*Homo sapiens A kinase (PRKA) anchor protein 13
(AKAP13), transcript variant 2 180 3e-42 180 3e-42
Membrane-spanning 4-domains, subfamily A, member
L>S MAPK signalling CD20L3 [Homo sapiens] BI294706
6B (Ms4a6b) [homolog of Homo sapiens Ms4a6b]
L>S MAPK signalling similar to G protein-coupled receptor 146 (Gpr146) similar to G protein-coupled receptor PGR8 369 7e-99 AI170446

S>L MAPK signalling G protein-coupled receptor kinase-interactor 1 (Git1) Cat-1 NM_031814

SUPPLEMENTAL MATERIAL ATN LESIONS & RSC TRANSCRIPTOME

WNT signaling
S>L Frizzled homolog 2 (D. melanogaster; Fzd2) Fz2 L02530
pathway
Neuroactive ligand-
L>S Adrenergic receptor, beta 3 (Adrb3) NM_013108
receptor interaction
Potassium voltage-gated channel, shaker-related
S>L Ion transport KVbeta2.1; KVbeta2.2 BE097195
subfamily, beta member 2 (Kcnab2)
Potassium inwardly-rectifying channel, subfamily J,
L>S Ion transport KCNJ7; GIRK2; GIRK3.2; KIR3.2 AB073756
member 6 (kcnj6)
Sodium channel, voltage-gated, type VII, alpha Sodium channel, voltage gated type 6 alpha
L>S Ion transport BF285019
polypeptide (SCN7a) polypeptide (scn6a); Na-G
Membrane glycoprotein: nectin-like protein 1
Cell adhesion (confirmed)
S>L immunoglobulin superfamily, member 4B (IGSF4B) (necl1)/TSLC1-like 1 (Tsll1)/brain 729 0.0
BG378062
molecules
immunoglobulin receptor precursor (BIgR)
Acidic secreted protein 1 (ASPIC1),
Cell adhesion
S>L Cartilage acidic protein 1 (Crtac1) Chondrocyte expressed protein 68 kDa (CEP- NM_134401
molecules
68), CRTAC1-B, W307
Cell adhesion
S>L Vitronectin (Vtn) NM_019156
molecules
SWI/SNF-related matrix-associated actin-dependent
S>L Transcription Rsc8, BAF170, CRACC2 BF396079
regulator of chromatin c, member 2 (SMARCC2)
ECP54; NMP238; TIP49a (TATA binding
S>L Transcription RuvB-like protein 1 (Ruvbl1) AB002406
protein interacting protein 49 kDa); Pontin52
S>L Transcription Smad3 (Mad homolog 3, D. melanogaster) BF552908

L>S Transcription Retinoid X receptor gamma (RXRγ) NR2B3 BE118450

Nuclear factor of activated T cells 5 (T cell transcription Tonicity-responsive enhancer binding protein
L>S Transcription 287 2e-74 BM384203
factor NFAT5) (TONEBP)
Neuronal activity regulated pentraxin protein II
L>S Calcium signalling NARP 1051 0.0 AI228623
(NPTX2)
hypothetical Eukaryotic initiation factor 1A (eIF-1A)/S1
S>L Translation domain IF1 type profile/Nucleic acid-binding OB-fold 2010003J03Rik, LOC293673, MGC11102 1158 0.0 BF420639
containing protein
S>L Translation Ribosomal protein L3 (Rpl3) TARBP-B AA892367
Ubiquitin A-52 residue ribosomal protein fusion product
S>L Translation NM_031687
1 (Uba52)
S>L Translation Speckle-type POZ protein (Spop) TEF2 476 2e-131 BF283504
Gelatinase b (GELB), Macrophage gelatinase,
Folding, Sorting
S>L Matrix metalloproteinase 9 (Mmp9) Type V collagenase, 92kD type IV collagenase, NM_031055
and Degradation
CLG4B
Folding, Sorting Dnaj (Hsp40 homolog, subfamily C, member 8
S>L SPF31, HSPC331 AI227785
and Degradation (Dnajc8)
Folding, Sorting
S>L FK506 binding protein 3 (FKBP3) FKBP25, PPIase, Rotomase AA891798
and Degradation
Folding, Sorting
S>L Ubiquilin 1, transcript variant 1 (ubqln1) DA41, DSK2, PLIC-1, XDRP1 BI279735
and Degradation
Folding, Sorting
S>L ADP-ribosylarginine hydrolase (Adprh) M86341
and Degradation
Folding, Sorting
S>L Syntaxin binding protein 1 (stxbp1) U06069
and Degradation
SUPPLEMENTAL MATERIAL ATN LESIONS & RSC TRANSCRIPTOME

Replication and
S>L Replication factor C (activator 1) 2 (Rfc2) BF283113
repair
Carbohydrate
S>L Phosphomannomutase 2 222 7e-55 AI411161
metabolism
Amino acid transporter 1 (Atr1); Neutral and
Carbohydrate basic amino acid transport protein rBAT
S>L Solute carrier family 3, member 1 (Slc3a1) NM_017216
metabolism (B(0,+)-type amino acid transport protein
(NBAT); CSNU, D2H
Carbohydrate
L>S Glycoprotein galactosyltransferase alpha 1, 3 (Ggta1) AI178222
metabolism
L>S Lipid Metabolism Prostaglandin-endoperoxide synthase 1 (Ptgs1) Cyclooxygenase 1 (COX1), COX3 NM_017043
Oxidative
S>L Cytochrome c1 (Cyc1) BI277021
phosphorylation
Oxidative Ubiquinol-cytochrome C reductase complex
S>L Cytochrome c1, non heme 7.2 kDa protein 278 1e-71 AI007981
phosphorylation (UCRC), HSPC119, HSPC151
Oxidative
S>L Succinate dehydrogenase complex (Sdhc), subunit b/c 1405 0.0 AI009817
phosphorylation
Nitrogen
S>L Carbonic anhydrase 4 (Ca4) NM_019174
metabolism
Amino acid L-glutaminase, L-glutamine amidohydrolase,
S>L Liver glutaminase (gls2) J05499
metabolism phosphate-activated/-dependent glutaminase
Glycan
S>L Biosynthesis and Hyaluronoglucosaminidase 2 (Hyal2) LUCA-2 AF034218
Metabolism
Cytoskeleton,
S>L microtubule and Myosin-1e (Myo1e) Myo1c BI275813
actin-related
Cytoskeleton,
L>S microtubule and Myosin-IXA(Myo9a) Myr7 801 0.0 AW917818
actin-related
Cytoskeleton,
L>S microtubule and Kif6 (Kinesin family member 6) Kinesin-related protein 3 (Krp3) AY035403
actin-related
S>L Oxygen-related Hemoglobin alpha-1 (Hba1) Hbam, CD31 AI179404
Low density lipoprotein receptor-related protein 3
S>L Vesicle-related NM_053541
(LRP3)
S>L Unclassified VGF nerve growth factor inducible NM_030997

S>L Unclassified Hypothetical HAD-like structure containing protein 139 1e-29 BG380656
PREDICTED Rattus norvegicus ATPase inhibitor 1003 0.0;
L>S Unclassified 902 0.0
AA893518
(Atpi); Urinary protein 2/3 precursor (RUP-2/3)
PREDICTED: Rattus norvegicus similar to D3Mm3e
S>L Unknown 1021 0.0 AI178206
(LOC500226)
S>L Unknown weakly similar to Proline-rich protein MP-2 precursor 486 4e-134 AI236927

S>L Unknown LOC362671 AI409584

S>L Unknown LOC317191 UNQ8193, GC0XP083030 AW254686

S>L Unknown LOC294291 MGC57858, GC06M034261, GC06M034215 AW915035

SUPPLEMENTAL MATERIAL ATN LESIONS & RSC TRANSCRIPTOME

S>L Unknown EST BE108374

S>L Unknown EST BF391141

S>L Unknown clone RP24-75K5 from chromosome 5 BF401709

S>L Unknown Similar to hypothetical protein FLJ14466 (LOC304496) BG378798

S>L Unknown KIAA0683 gene product 293 3e-76 BI279598

Hypothetical protein KIAA0226; Similar to D.
L>S Unknown 1700021K19Rik, 5330403K09 melanogaster gene encoded in P1 clone BE113144
DS00642
L>S Unknown Chromosome 22 open reading frame 23 (C22ORF23) LOC315126; EVG1; FLJ32787 301 1e-78 BI286421

L>S Unknown LIM domain containing 2, LIMD2 MGC10986 1356 0.0 BI294855

L>S Unknown EST BI300513

Hypothetical protein 6330514E13 OR RNI-like
L>S Unknown 307 2e-80 AA964675
structure containing protein
S>L Development Fibronectin type III domain containing 5 (Fndc5) LOC260327 599 4e-168 AI172165
1322 0.0
zinc finger, FYVE domain containing 21
L>S Unknown Zinc finger, FYVE domain containing 21 (zfyve21) (predicted); BI283114
(predicted) (Zfyve21_predicted) 244 3e-61
SUPPLEMENTAL MATERIAL ATN LESIONS & RSC TRANSCRIPTOME

Figure S2: Transcription factor binding sites computationally predicted to be on the promoter regions of the gene lists produced
by the fold-change ANOVA (A) and treatment profiling (B) approaches.

A.
SUPPLEMENTAL MATERIAL ATN LESIONS & RSC TRANSCRIPTOME

B.
SUPPLEMENTAL MATERIAL ATN LESIONS & RSC TRANSCRIPTOME

I. Gene enrichment (GSEA) for the ‘Intact’ condition

A. Electron transport chain gene set

RANK
IN RANK
GENE GENE METRIC RUNNING CORE
SYMBOL GENE_TITLE LIST SCORE ES ENRICHMENT
ATP synthase, H+ transporting, mitochondrial F0 complex,
ATP5S subunit s (factor B) 266 0.513009 -0.00901 No
NADH dehydrogenase (ubiquinone) Fe-S protein 4, 18kDa
NDUFS4 (NADH-coenzyme Q reductase) 390 0.453527 0.001501 No
POPDC2 popeye domain containing 2 1293 0.240821 -0.13078 No
ATP synthase, H+ transporting, mitochondrial F0 complex,
ATP5G3 subunit C3 (subunit 9) 1338 0.232869 -0.12222 No
ATP synthase, H+ transporting, mitochondrial F0 complex,
ATP5F1 subunit B1 2166 0.114776 -0.2507 No
UQCRB ubiquinol-cytochrome c reductase binding protein 2709 0.045491 -0.33692 No
COX6C cytochrome c oxidase subunit VIc 3305 -0.02302 -0.4334 No
COX7B cytochrome c oxidase subunit VIIb 3374 -0.0309 -0.4425 No
UQCRC1 ubiquinol-cytochrome c reductase core protein I 3471 -0.04274 -0.45542 No
SLC25A27 solute carrier family 25, member 27 3596 -0.05751 -0.47195 No
COX5A cytochrome c oxidase subunit Va 3646 -0.0644 -0.47565 No
NADH dehydrogenase (ubiquinone) Fe-S protein 2, 49kDa
NDUFS2 (NADH-coenzyme Q reductase) 3743 -0.07822 -0.48616 No
COX17 cytochrome c oxidase assembly homolog (S.
COX17 cerevisiae) 3766 -0.08222 -0.48421 No
COX7A2 cytochrome c oxidase subunit VIIa polypeptide 2 (liver) 3783 -0.08384 -0.48115 No
succinate dehydrogenase complex, subunit A, flavoprotein
SDHA (Fp) 3929 -0.10277 -0.49807 No
succinate dehydrogenase complex, subunit D, integral
SDHD membrane protein 4030 -0.11505 -0.50674 No
ATP synthase, H+ transporting, mitochondrial F0 complex,
ATP5I subunit E 4059 -0.11823 -0.50333 No
NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 4,
NDUFB4 15kDa 4145 -0.13307 -0.5083 No
SURF1 surfeit 1 4227 -0.14314 -0.51194 No
SUPPLEMENTAL MATERIAL ATN LESIONS & RSC TRANSCRIPTOME

COX4I1 cytochrome c oxidase subunit IV isoform 1 4270 -0.14858 -0.50877 No

ATPIF1 ATPase inhibitory factor 1 4286 -0.15037 -0.50104 No
NADH dehydrogenase (ubiquinone) Fe-S protein 6, 13kDa
NDUFS6 (NADH-coenzyme Q reductase) 4342 -0.15629 -0.49949 No
CYCS cytochrome c, somatic 4462 -0.17356 -0.50732 No
ATP synthase, H+ transporting, mitochondrial F1 complex,
ATP5E epsilon subunit 4647 -0.20321 -0.52385 Yes
UCP2 uncoupling protein 2 (mitochondrial, proton carrier) 4652 -0.2036 -0.51069 Yes
ATP synthase, H+ transporting, mitochondrial F0 complex,
ATP5H subunit d 4750 -0.22008 -0.51174 Yes
NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa
NDUFS1 (NADH-coenzyme Q reductase) 4758 -0.22271 -0.49777 Yes
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5,
NDUFA5 13kDa 4822 -0.2334 -0.49232 Yes
UQCRC2 ubiquinol-cytochrome c reductase core protein II 5021 -0.27317 -0.5064 Yes
NADH dehydrogenase (ubiquinone) 1, subcomplex
NDUFC2 unknown, 2, 14.5kDa 5030 -0.2748 -0.48907 Yes
ATP synthase, H+ transporting, mitochondrial F1 complex,
ATP5C1 gamma polypeptide 1 5087 -0.28729 -0.4788 Yes
ATP synthase, H+ transporting, mitochondrial F1 complex,
ATP5B beta polypeptide 5091 -0.28848 -0.45971 Yes
COX5B cytochrome c oxidase subunit Vb 5141 -0.29729 -0.44761 Yes
ATP synthase, H+ transporting, mitochondrial F0 complex,
ATP5J subunit F6 5180 -0.30472 -0.43319 Yes
ATP synthase, H+ transporting, mitochondrial F0 complex,
ATP5G1 subunit C1 (subunit 9) 5282 -0.32581 -0.42772 Yes
COX15 homolog, cytochrome c oxidase assembly protein
COX15 (yeast) 5424 -0.35685 -0.42674 Yes
solute carrier family 25 (mitochondrial carrier; adenine
SLC25A4 nucleotide translocator), member 4 5492 -0.37542 -0.4123 Yes
ATP synthase, H+ transporting, mitochondrial F1 complex,
ATP5A1 alpha subunit 1, cardiac muscle 5568 -0.39761 -0.39767 Yes
ubiquinol-cytochrome c reductase, Rieske iron-sulfur
UQCRFS1 polypeptide 1 5573 -0.39895 -0.37125 Yes
solute carrier family 25 (mitochondrial carrier; adenine
SLC25A5 nucleotide translocator), member 5 5578 -0.39982 -0.34478 Yes
COX6A1 cytochrome c oxidase subunit VIa polypeptide 1 5601 -0.40725 -0.32076 Yes
AFG3L2 AFG3 ATPase family gene 3-like 2 (yeast) 5621 -0.4154 -0.2957 Yes
SUPPLEMENTAL MATERIAL ATN LESIONS & RSC TRANSCRIPTOME

UQCRH ubiquinol-cytochrome c reductase hinge protein 5622 -0.41703 -0.2674 Yes

succinate dehydrogenase complex, subunit C, integral
SDHC membrane protein, 15kDa 5688 -0.44295 -0.24804 Yes
ATP synthase, H+ transporting, mitochondrial F1 complex,
ATP5D delta subunit 5722 -0.45542 -0.22257 Yes
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9,
NDUFA9 39kDa 5754 -0.47121 -0.1957 Yes
NADH dehydrogenase (ubiquinone) Fe-S protein 7, 20kDa
NDUFS7 (NADH-coenzyme Q reductase) 5893 -0.54975 -0.18113 Yes
ATP synthase, H+ transporting, mitochondrial F1 complex,
ATP5O O subunit (oligomycin sensitivity conferring protein) 5915 -0.5648 -0.14626 Yes
COX6A2 cytochrome c oxidase subunit VIa polypeptide 2 5965 -0.60052 -0.11357 Yes
NDUFV2 NADH dehydrogenase (ubiquinone) flavoprotein 2, 24kDa 5982 -0.61507 -0.07447 Yes
NDUFV1 NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa 5995 -0.63062 -0.03365 Yes
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 8,
NDUFA8 19kDa 6073 -0.7968 0.007744 Yes
SUPPLEMENTAL MATERIAL ATN LESIONS & RSC TRANSCRIPTOME

B. Oxidative phosphorylation gene set

RANK
IN RANK
GENE GENE METRIC RUNNING CORE
SYMBOL GENE_TITLE LIST SCORE ES ENRICHMENT
NADH dehydrogenase (ubiquinone) Fe-S protein 4, 18kDa (NADH-
NDUFS4 coenzyme Q reductase) 390 0.453527 -0.02478 No
ATP synthase, H+ transporting, mitochondrial F0 complex, subunit
ATP5G3 C3 (subunit 9) 1338 0.232869 -0.16036 No
ATP synthase, H+ transporting, mitochondrial F0 complex, subunit
ATP5F1 B1 2166 0.114776 -0.28646 No
UQCRB ubiquinol-cytochrome c reductase binding protein 2709 0.045491 -0.37168 No
COX6C cytochrome c oxidase subunit VIc 3305 -0.02302 -0.46758 No
COX7B cytochrome c oxidase subunit VIIb 3374 -0.0309 -0.47608 No
UQCRC1 ubiquinol-cytochrome c reductase core protein I 3471 -0.04274 -0.48816 No
COX5A cytochrome c oxidase subunit Va 3646 -0.0644 -0.5112 No
NADH dehydrogenase (ubiquinone) Fe-S protein 2, 49kDa (NADH-
NDUFS2 coenzyme Q reductase) 3743 -0.07822 -0.5202 No
COX7A2 cytochrome c oxidase subunit VIIa polypeptide 2 (liver) 3783 -0.08384 -0.51933 No
SDHA succinate dehydrogenase complex, subunit A, flavoprotein (Fp) 3929 -0.10277 -0.53426 No
succinate dehydrogenase complex, subunit D, integral membrane
SDHD protein 4030 -0.11505 -0.54072 Yes
ATP synthase, H+ transporting, mitochondrial F0 complex, subunit
ATP5I E 4059 -0.11823 -0.53506 Yes
NDUFB4 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 4, 15kDa 4145 -0.13307 -0.53749 Yes
NGFRAP1 nerve growth factor receptor (TNFRSF16) associated protein 1 4165 -0.13599 -0.52881 Yes
SURF1 surfeit 1 4227 -0.14314 -0.52641 Yes
COX4I1 cytochrome c oxidase subunit IV isoform 1 4270 -0.14858 -0.52042 Yes
NADH dehydrogenase (ubiquinone) Fe-S protein 6, 13kDa (NADH-
NDUFS6 coenzyme Q reductase) 4342 -0.15629 -0.51852 Yes
CYCS cytochrome c, somatic 4462 -0.17356 -0.52303 Yes
SURF2 surfeit 2 4610 -0.19613 -0.53018 Yes
ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon
ATP5E subunit 4647 -0.20321 -0.51846 Yes
SUPPLEMENTAL MATERIAL ATN LESIONS & RSC TRANSCRIPTOME

ATP synthase, H+ transporting, mitochondrial F0 complex, subunit

ATP5H d 4750 -0.22008 -0.51612 Yes
NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-
NDUFS1 coenzyme Q reductase) 4758 -0.22271 -0.49793 Yes
NDUFA5 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5, 13kDa 4822 -0.2334 -0.48803 Yes
UQCRC2 ubiquinol-cytochrome c reductase core protein II 5021 -0.27317 -0.49688 Yes
NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2,
NDUFC2 14.5kDa 5030 -0.2748 -0.47433 Yes
ATP synthase, H+ transporting, mitochondrial F1 complex, gamma
ATP5C1 polypeptide 1 5087 -0.28729 -0.45859 Yes
ATP synthase, H+ transporting, mitochondrial F1 complex, beta
ATP5B polypeptide 5091 -0.28848 -0.43403 Yes
COX5B cytochrome c oxidase subunit Vb 5141 -0.29729 -0.41628 Yes
ATP synthase, H+ transporting, mitochondrial F0 complex, subunit
ATP5J F6 5180 -0.30472 -0.39606 Yes
ATP synthase, H+ transporting, mitochondrial F0 complex, subunit
ATP5G1 C1 (subunit 9) 5282 -0.32581 -0.38438 Yes
COX15 COX15 homolog, cytochrome c oxidase assembly protein (yeast) 5424 -0.35685 -0.37659 Yes
UQCRFS1 ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1 5573 -0.39895 -0.36629 Yes
COX6A1 cytochrome c oxidase subunit VIa polypeptide 1 5601 -0.40725 -0.33537 Yes
UQCRH ubiquinol-cytochrome c reductase hinge protein 5622 -0.41703 -0.30244 Yes
succinate dehydrogenase complex, subunit C, integral membrane
SDHC protein, 15kDa 5688 -0.44295 -0.27466 Yes
ATP synthase, H+ transporting, mitochondrial F1 complex, delta
ATP5D subunit 5722 -0.45542 -0.24054 Yes
NDUFA9 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9, 39kDa 5754 -0.47121 -0.20472 Yes
BCS1L BCS1-like (yeast) 5860 -0.52918 -0.17603 Yes
NADH dehydrogenase (ubiquinone) Fe-S protein 7, 20kDa (NADH-
NDUFS7 coenzyme Q reductase) 5893 -0.54975 -0.13355 Yes
ATP synthase, H+ transporting, mitochondrial F1 complex, O
ATP5O subunit (oligomycin sensitivity conferring protein) 5915 -0.5648 -0.08796 Yes
COX6A2 cytochrome c oxidase subunit VIa polypeptide 2 5965 -0.60052 -0.04386 Yes
NDUFA8 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 8, 19kDa 6073 -0.7968 0.007733 Yes
SUPPLEMENTAL MATERIAL ATN LESIONS & RSC TRANSCRIPTOME

II. Gene enrichment (GSEA) for the ‘Lesion’ condition

A. Monoamine G-protein coupled receptors gene set

RANK
IN RANK
GENE GENE METRIC RUNNING CORE
PROBE SYMBOL GENE_TITLE LIST SCORE ES ENRICHMENT
ADRB3 ADRB3 adrenergic, beta-3-, receptor 32 0.826153 0.242804 Yes
ADRA1D ADRA1D adrenergic, alpha-1D-, receptor 147 0.601358 0.404696 Yes
DRD1 DRD1 dopamine receptor D1 480 0.427345 0.478664 Yes
HTR2C HTR2C 5-hydroxytryptamine (serotonin) receptor 2C 503 0.41974 0.601085 Yes
ADRA2C ADRA2C adrenergic, alpha-2C-, receptor 507 0.41905 0.726408 Yes
ADRA1B ADRA1B adrenergic, alpha-1B-, receptor 598 0.390678 0.828974 Yes
CHRM3 CHRM3 cholinergic receptor, muscarinic 3 2533 0.064333 0.531759 No
CHRM2 CHRM2 cholinergic receptor, muscarinic 2 2712 0.045068 0.516157 No
5-hydroxytryptamine (serotonin) receptor 7
HTR7 HTR7 (adenylate cyclase-coupled) 2776 0.03774 0.517177 No
DRD3 DRD3 dopamine receptor D3 2882 0.026111 0.507832 No
HTR2A HTR2A 5-hydroxytryptamine (serotonin) receptor 2A 3711 -0.07313 0.394272 No
SUPPLEMENTAL MATERIAL ATN LESIONS & RSC TRANSCRIPTOME

QPCR ASSAY CHARACTERISTICS

Common Name Assay linearity Assay efficiency (%) Melting peak (oC)
Kruppel-like factor 5 0.9995 97.3 79.9
Matrix metalloproteinase 9 0.9999 93.3 83.1
5-HT2C receptor 0.9996 99.7 77.1
Chromogranin B 1.000 96.9 78.6
Olfactomedin 3 0.9998 96.7 79.5
Ubiquitin specific protease 3 0.9990 94.6 81.3
c-fos 0.9998 100.6 81.5
fos-related antigen 0.9999 98.6 85.6
zyxin 0.9997 96.0 81.9
beta-actin 0.9990 92.0 83.6
All assays were linear in the range 101 to 107 copies.

GROUP1

Rattus norvegicus Kruppel-like factor 5 (intestinal, Klf5)

NM_053394.1

Primer Length start end Tm GC Sequence

left 20 338 357 59 55 5’-cagagcctggaagtcctgat-3’
right 19 390 408 59 58 5’-agcagcataggacggaggt-3’
Span an intron ?: No
Amplicon 71 nt:
cagagcctggaagtcctgatagacaagctgagatgctccagaatctgaccccacctccgtcctatgctgct

Rattus norvegicus matrix metalloproteinase 9 (gelatinase B, 92-kDa type IV collagenase) (Mmp9)

NM_031055.1
SUPPLEMENTAL MATERIAL ATN LESIONS & RSC TRANSCRIPTOME

Primer Length start end Tm GC Sequence

left 20 1728 1747 59 45 5’-tccgcagtccaagaagattt-3’
right 20 1812 1831 59 55 5’-agcctagccccaacttatcc-3’
Span an intron ?: Yes
Amplicon 104 nt:
tccgcagtccaagaagattttcttcttctctgggcgcaaaatgtgggtgtacacaggccagacggtgctgggccccaggagtctggataagttggggctaggct

GROUP2

Rattus norvegicus chromogranin B (Chgb)

NM_012526.1

Primer Length start end Tm GC Sequence

left 22 1961 1982 59 45 5’-aggcagaagatgaaaaggacag-3’
right 19 2019 2037 60 58 5’-cgccaagttctccagttcc-3’
Span an intron ?: Yes
Amplicon 77 nt:
aggcagaagatgaaaaggacagggctgaccagagagttctgaccgaggaagagaaaaaggaactggagaacttggcg

Rattus norvegicus optimedin form B, complete cds; alternatively spliced.

AF442822.1

Primer Length start end Tm GC Sequence

left 21 503 523 59 43 5’-cgctaatgaccaagcattttc-3’
right 20 574 593 60 55 5’-gcgtcggttttgtactgctc-3’
Span an intron ?: Yes
Amplicon 91 nt:
cgctaatgaccaagcattttcaagagttgaaagagaaaatggacgagctactgcccctcatcccagtgttggagcagtacaaaaccgacgc

Rattus norvegicus 5-hydroxytryptamine (serotonin) receptor 2C (Htr2c).

NM_012765.2 [substituting for BF285539 (rat EST) 5-hydroxytryptamine (serotonin) receptor 2C (Htr2c)]

Primer Length start end Tm GC Sequence

SUPPLEMENTAL MATERIAL ATN LESIONS & RSC TRANSCRIPTOME

Left 18 970 987 59 50 5’-atcatgtggtgcccgttt-3’

right 20 1011 1030 60 50 5’-tacaggccttcccacaaaga-3’
Span an intron ?: No
Amplicon 61 nt:
atcatgtggtgcccgtttttcatcaccaatatcctgtcggttctttgtgggaaggcctgta

GROUP 3

Rattus norvegicus Zyxin

AA943537 [Affy target sequence]
Primer Length start end Tm GC Sequence
left 18 492 509 60 61 5’-caaccctctgggaacgtg-3’
right 21 533 553 59 52 5’-aacctagcagcacagagcaag-3’
Span an intron ?: No
Amplicon 62 nt:
Caaccctctgggaacgtggctccagcagcctggacacccaccttgctctgtgctgctaggtt

GROUP 4

Rattus norvegicus c-fos

X06769.1 [substituting for BF415939 (rat EST) c-fos]
Primer Length start end Tm GC Sequence
left 22 209 230 59 50 5’-cagcctttcctactaccattcc-3’
right 20 275 294 60 50 5’-acagatctgcgcaaaagtcc-3’
Span an intron ?: Yes
Amplicon 86 nt:
cagcctttcctactaccattccccagccgactccttctccagcatgggctcccctgtcaacacacaggacttttgcgcagatctgt

Rattus norvegicusfra-2
AI031032
Primer length GC sequence
Left 22 54.5 5’-agaggaggagaagcgtcgaatc-3’
Right 22 54.5 5’-ctccttctgcagctcagcgatt-3'
SUPPLEMENTAL MATERIAL ATN LESIONS & RSC TRANSCRIPTOME

Amplicon: 162 nt

Rattus norvegicus similar to ubiquitin specific protease 3 (LOC363084)

XM_343415.1 [substituting for AI411205 (rat EST) similar to ubiquitin specific protease 3]

Primer Length start end Tm GC Sequence

Left 20 1092 1111 59 55 5’-cgacagttgcctgtatgacc-3’
Right 20 1145 1164 59 45 5’-tgtgtaatgcccagaaccaa-3’
Span an intron ?: Yes
Amplicon 73 nt:
cgacagttgcctgtatgacctcgctgccgtggttgttcaccatggctctggggttggttctgggcattacaca