BIO4320 Mid-Term Examination Oct.

16, 2001
Name: Student ID:
Part I (Dr. Fung’s Portion; total 40 marks) Answer all questions.

1. CsCl gradient centrifugation is used to separate DNA and RNA molecules. Refer to the
following figure; name the nucleic acid in the centrifuge tube at position A and B.
Explain your answer. (3 marks)

(A)

(B)
Centrifuge tube

2. What is “second genetic codon”? (5 marks)

3. If the gene encoding the sigma factor of the RNA polymerase in the E. coli cell is
mutated, what biological change(s) will you expect? Explain your answer. (5 marks)

-1-
BIO4320 Mid-Term Examination Oct. 16, 2001
Name: Student ID:
4. The amino acid sequence of the N-terminal of a protein is: Met-Trp-Tyr-Ile-Leu-Ile-Phe-
Asn-His Cys-Gly-Trp.

(i) Write down the sense sequences of the 5’ end of the corresponding mRNA. (4
marks)

(ii) Design an oligonucleotide probe with 17 bases for the detection of the
corresponding mRNA using “Northern Blot Hybridization” method. (6 marks)

5. E. coli cells were first cultured in a medium with glucose as the only carbon source and
then changed to a medium with lactose as the only carbon source. Explain how the E.
coli cells regulate the gene expression to cope with the change in the carbon source. (10
marks)

-2-
BIO4320 Mid-Term Examination Oct. 16, 2001
Name: Student ID:
6. An E. coli strain contains two suppressor tRNA genes. One is coding for a Gly-tRNA
having a “5’-CCCC-3’” anitcodon and the other is coding for a Gly-tRNA having a “5’-
UCU-3’” anticodon. Cell free extract prepared from this E. coli strain is used to translate
the following mRNA:

5’-XXXXXXXX ATGCCCGAUGGUCCCCUUUUAGCUAGAGGGUGA-3’

Write down the amino acid sequences of all the possible peptide that will be translated.
(7 marks) [Note: ATG is the initiation codon]

- End of Part I -

-3-
BIO4320 Mid-Term Examination Oct. 16, 2001
Name: Student ID:
Part II (Dr. Lam’s Portion; total 60 marks) Answer all questions.

Question 1

Many students wrongly believe that the Polymerase Chain Reaction (PCR) technique was
invented after the discovery of the Taq polymerase (a heat-stable DNA polymerase). In fact,
the idea of PCR was proposed by Dr. Kary Mullis (1993 Nobel Laureate) in 1983. The first
successful experiment was completed in 1984. Detection of DNA at that time was mainly
based on hybridization techniques.
Imagine you were the inventor of PCR in 1984. You were given a clone of the human β-
globin gene as the template. You were allowed to synthesize any primers needed. However,
you could only use Klenow to synthesize DNA. Thermo-cycler, of course, was not available.

(a) Design an experiment to show the feasibility of the PCR concept (8 marks).

(b) In the real experiments done in 1984, although successful amplification was seen, the
amplified DNA bands were weak and multiple bands were observed. How could you
prove the specificity of the target DNA fragment (6 marks).

(c) For nowadays PCR reaction, Taq polymerase (successfully purified in 1986) is used.
Using a clean template and well-designed primers, Taq polymerase gives a clear and
distinct band that can be easily detected by simple ethidium bromide staining. State
three differences between Taq polymerase and Klenow (3 marks).

-4-
BIO4320 Mid-Term Examination Oct. 16, 2001
Name: Student ID:
Question 2

In year 2050, Hong Kong was under a terrorist attack. A genetically engineered
pathogenic E. coli Strain was spread all over the city. This E. coli strain infected all
mammals and was resistant to all antibiotics available.
A secret mission coded BIO4320 was undertaken by a group of CUHK students. Their
task was to synthesize new antibiotics that would act against this bacterium.
Dr. Lam Jr. told the students that microorganisms such as fungi were good sources for
new antibiotics. In this respect, all fungal collections in the Biology Department of CUHK
were tested.

(a) Design a strategy for the antibiotic screen (3 marks).

A slow-growing fungus (take several years to grow) was found to produce a useful
peptide antibiotic. There was only several hundred grams of the fungus available. Using
this amount of raw material, about one milligram of the purified peptide antibiotic could be
obtained. A much higher amount was needed.

(b) Carefully design an approach to produce this peptide antibiotic in large quantity (12 marks).

-5-
BIO4320 Mid-Term Examination Oct. 16, 2001
Name: Student ID:
Question 3

In year 5000, the Federation of Solar System was formed. Through effective
communication via the Cybermail system, it was known that all planets in the Solar System
have human-like living creatures. A research was conducted to verify one old saying on the
Earth: “Men are from Mars and Women are from Venus”.
In one experiment, scientists decided to compare the sex-determining region Y (SRY)
genes of male humans in all planets. In Earth’s male human, this gene was cloned and found
to be male specific. Analysis of the gene sequences of male humans in different planets may
help to understand their evolutionary relationship.
The human SRY gene was cloned into the multiple cloning sites of a vector. The
multiple cloning site was flanked by a T7 and a T3 promoter.

T7 p romoter SRY T3 p romoter

DNA sequencing of the middle portion of the coding region gave the following results:

T7 ……………………………………………………………………………………….

agagaaccctcaaatgcaaaactcagagatcagcaagtggctgggatgcaagtggaaaatgcttacagaagccgaaaagc

………………………………………………………………………………………. T3

(a) If you need to make a riboprobe for Northern blot analyses of the SRY gene, will
you use T7 or T3 RNA polymerase for this purpose? Explain you answer (8
marks) [Hint: you may need to use the table in Prof. Fung’s part]

-6-
BIO4320 Mid-Term Examination Oct. 16, 2001
Name: Student ID:

(b) Making use of the SRY gene from the Earth’s male human, design an experiment
to obtain homologous genes from other male humans (10 marks)

After obtaining all SRY genes and submit them to the Universe GenBank, a Blastp
search was performed for the human SRY.

(c) What is a Blastp search? How does it differ from the Blastx search (4 marks).

(d) If men are really originated from Mars, do you expect to see a large or small E
value when compared the homology between the SRY proteins of Earth’s male
and Mars’ male (1 mark).

(e) When investigating the Blastp results, it was found that one region of the SRY
protein sequence was replaced by XXXXXXX, what had happened and how can
you prevent this (5 marks).

- End of Part II -

-7-