Lec 7 - Recombinant DNA Techniques

What would you need to do biotechnology?
DNA(s) to be cloned/edited
Library clone (genomic DNA/cDNA)
PCR
Synthesize gene
Method for modifying DNAs

Restriction Enzymes
PCR
CRISPR/TALEN
Synthesize modified gene (self-declare biohazards)
Copyright 2009 Pearson Education, Inc.

CS
What would you need to do biotechnology?
Method for transformation/transgenic organism/GMO
Bacteria (plasmid, transposon, artificial chromosome)
Eukaryote (plasmid, virus, transposon, mito/chloroplast, artificial chromosome)
Plant (T-DNA, gene gun)
Animal (stem cell; electroporation)
Method for identifying successfully modified organism

Selection/fluorescence
PCR/sequencing
Functional assay
Expression systems
Do I have to worry about protein modifications (Golgi, etc).
Do I need to produce large amounts of substance/drug?
Do I need modified cells to secrete a compound or bind directly to a target?
Do I need to build in a kill switch?

CS
Agarose Gel Electrophoresis
Agarose melted in a buffer and poured into a horizontal tray

When solidified, the gel contains small holes or pores
through which the DNA fragments will travel
The percentage of agarose used to make the gel
determines the ability of the gel to separate DNA fragments
of different sizes
Most common is 0.52% agarose
Higher percentage will separate small DNA fragments better
Lower percentage is better for separating large fragments

Agarose Gel Electrophoresis Contd
To run a gel, it is submerged in a buffer solution that

conducts electricity
DNA is loaded into wells at the top of the gel
Electric current is applied to the ends of the gel
DNA migrates according to its charge and size
Rate of migration through the gel depends on the size of the
DNA
Large fragments migrate slowly; smaller fragments migrate
faster
Tracking dye is added to the samples to monitor DNA
migration during electrophoresis
DNA can be visualized after electrophoresis by the addition
of DNA staining dyes

Agarose Gel Electrophoresis

Restriction mapping gene structure
Cut cloned gene with restriction enzymes to pinpoint location

of the cutting sites
Knowing restriction map is useful for making clones of small
pieces of the DNA which is called subcloning
These small pieces of DNA can then be sequenced
Protocol of restriction mapping:
a. Digest DNA with single or double restriction enzymes
b. Separate DNA fragments via agarose gel electrophoresis
c. Arrange fragments in order to make map of restriction sites

Restriction mapping
*** Note: These days scientists use bioinformatic software to

identify restriction sites in the DNA
2013 Pearson Education,
Copyright 2009 Pearson Education, Inc. Inc.
DNA Sequencing
Original Sanger method:

Had four separate reaction tubes and each contained the
vector; primer; dNTPs in which one dNTP is radioactively
labeled; and a different small amount of ddNTP; DNA Pol
Over time a ddNTP will be incorporated into all the positions in
the newly synthesized strands creating fragments of varying
lengths that are terminated at the ddNTP (which has a 3' H instead
of 3'OH on the deoxyribose so it cannot form a phosphodiester bond with
the incoming nucleotide and so gets terminated)
Then the fragments are separated on polyacryamide gel
Autoradiography used to then identify radioactive fragments
Read the gel from bottom to top as individual nucleotides
The sequence generated from the reaction is complimentary to
the sequence on the template strand in the vector

Key features of DNA replication are used in DNA
sequencing
DNA synthesis occurs in the 5 to 3 direction.

DNA synthesis requires a template and a primer.
DNA replication is semi-conservative (one strand copied).
DNA replication is carried out by an enzyme called DNA
polymerase.

DNA synthesis requires a 3-OH to make the next
phosphodiester bond during DNA synthesis
normal
dNTP

Dideoxy NTPs block DNA synthesis

A mixture of dNTPs and ddNTPs are used
in DNA sequencing

Theresultingchainterminatedproductsare
sortedbysize(1baseresolution)
ACGGTCATCA
ACGGTCATCAC
ACGGTCATCACT
ACGGTCATCACTG
ACGGTCATCACTGG
ACGGTCATCACTGGA
ACGGTCATCACTGGAT
ACGGTCATCACTGGATG
ACGGTCATCACTGGATGC
ACGGTCATCACTGGATGCC
ACGGTCATCACTGGATGCCC
ACGGTCATCACTGGATGCCCT
ACGGTCATCACTGGATGCCCTT
ACGGTCATCACTGGATGCCCTTG TC
Traditionally - Polyacrylamide gel electrophoresis
used to visualize the fragments

High throughput computer automated sequencing
Allows >500 nucleotides to be sequenced per reaction

Very helpful for completing human genome project
Procedure: instead of 4 separate tubes, only 1 reaction tube is used
ddNTPs are each labeled with a different fluorescent dye
Samples are separated on a single-lane capillary gel that is
scanned with a laser beam
Laser stimulates fluorescent dye on each DNA fragment which
emits a different wavelength of light for each different colored
ddNTP
Emitted light is collected by a detector that amplifies and feeds this
info. to a computer that can run multiple capillary gels at one time
= 900 bp sequence
Computer converts light patterns to reveal the sequence

Capillaryelectrophoresis
DNAproductsin
thecapillary.
-
DNAproductsmoveinthe
electricalfield.
ShorterDNAproductsmovefaster
throughthegelmaterialinthe
capillarythanlargerDNAproducts.
Sotheyseparatebysize.

+ TC
Automated DNA sequencing with fluorescent dyes
coupled to each reaction
Direction of
electrophoresis
Laser Photocell
*

A G C T TC
Chromatogram
typicalrunread5001000bases

TC
Shotgun cloning/sequencing

DNA sequencing
Faster, cheaper, technology
Cost of
sequencing a
human genome?

CS
CS
Next generation sequencing (NGS)
Designed to produce highly accurate and long stretches of DNA

sequence (greater than 1 gigabase) of DNA per reaction
Is done at very low cost
Use parallel formats that use fluorescence imaging techniques
Two types of NGS approaches
Read newly synthesized DNA strands
Read without synthesis

DNA sequencing
454(Roche), Solid (Thermo Fisher) etc
1 million-100 million reactions per run

CS
DNA sequencing
Ion Torrent
Cross between biotech and engineering tech

CS
DNA sequencing
Oxford Nanopore
Biosensors
Threads single strand of DNA
through pore. Reads sequence
by change in conductance
DNA synthesis not required!
https://goo.gl/images/5RhlTl

CS
EXOME
SEQUENCING
Just sequence
Exons
Cheaper
Faster analysis
For
disease related genes
Misses mutations
in non-coding portions
of genes

Chromosome Location and Copy Number of
Genes
Identify the chromosome location of the cloned gene
Determine if the gene is present as a single copy in the
genome
Fluorescence in situ hybridization (FISH)
Chromosomes are isolated from cells and spread out on
glass slide
cDNA probe for gene of interest is labeled with fluorescent
nucleotides and incubated with slides
Probe will hybridize with complementary sequences on slide
Slide is washed and exposed to fluorescent light
Wherever probe bound, it is illuminated to indicate the
presence of that gene

FISH test for aneuploidy
FISH = Fluorescence In Situ Hybridization
Example: trisomy 21 Downs syndrome
Chromosome specific
probe (sequence)
hybridizes to target chr
Cell from amniotic fluid
CS
Cell-free fetal DNA test
Sequencing
Count # of
times chr 21
sequences
found relative
to other chrs
Nature Medicine
Copyright 18, 10411051
2009 Pearson Education, Inc.(2012) doi:10.1038/nm.2829
CS
TRANSLOCATION
Responsible for one type of leukemia
FISH
karyotype
RED = ABL (chr 9)

GREEN = BCR (chr 22)
CS
Microarrays to detect SNPs
Disease associated SNPs
Pharmacogenomics how your genetic
makeup can affect treatment decisions
Using DNA
hybridization
differences to
detect single
base variants
CYP genes involved in metabolism of

>25% of all prescription drugs
Variants affect drug dosage decisions
CS
Gene Copy Number
Southern blotting (Ed Southern)
Digest chromosomal DNA into small fragments with
restriction enzymes Fragments are separated by agarose
gel electrophoresis
Gel is treated with alkaline solution to denature the DNA
Fragments are transferred onto a nylon or nitrocellulose filter
(called blotting)
Filter (blot) is incubated with a probe and exposed to film by
autoradiography
Number of bands on film represents gene copy number
Also used to identify the presence of a gene or for preparative
purposes.

Southern Blotting
Copyright 2009 Pearson Education, Inc. 33

Why Study Gene Expression
How much RNA?
Which genes are being transcribed?
Protein coding and non coding!
Are pro-cancer genes on at high levels?
Are anti-cancer genes at low levels?
Is a cell making an RNA that it normally does not make?
Techniques
Older method: Northern blot
qPCR (aka RT-PCR) what is different from regular PCR?
Microarrays
RNA-seq
RNA in situ hybridization

CS
Studying Gene Expression
Techniques involve analyzing mRNA produced by a tissue
Northern blot analysis
Basic method is similar to Southern blotting
RNA is isolated from a tissue of interest, separated by gel
electrophoresis, blotted onto a membrane, and hybridized to
a probe
Presence/absence/intensity of a band is conclusive
Real time PCR (RT-PCR)
Also referred to as Reverse transcription - PCR
Reverse transcription of mRNA is performed converted
into double-stranded cDNA
cDNA is then amplified with a set of primers specific for the
gene of interest + the TaqMan primer with the reporter

Real-time PCR
Or quantitative PCR
(qPCR)

Studying Gene Expression contd
In situ hybridization
Used to determine the cell type that is expressing the mRNA
Tissue of interest is preserved in a fixative solution and
embedded in a wax-like substance
Tissue can be sliced into very thin sections attached to
microscope slides
Slides are incubated with a probe to the gene of interest
Probe hybridizes with mRNA in cells
Probe is detected

RNA In situ
Hybridization
Where and when
are genes
expressed?
Uses a labeled
nucleic acid
probe to bind
and detect
mRNAs
inside cells
Liebenberg Syndrome
Developing chick Pitx1 gene inappropriately
CS
Copyright 2009 Pearson Education, Inc. embryos expressed in human forelimbs
Gene microarrays
DNA microarray analysis
Single-stranded DNA molecules are attached onto a slide
using a robotic arrayer fitted with tiny pins
Can have over 10,000 spots of DNA
Extract mRNA from tissue of interest, create a fluorescence-
tagged cDNA library, and incubate overnight with the slide
cDNA will hybridize to spots on the microarray that have
complimentary DNA sequences
Slide is scanned with a laser that causes the spots to
fluoresce

Microarrays

CRISPR a brief history
CRISPR = Clustered Regularly Interspaced Short
Palindromic Repeats
1987: Repeats first identified in E. coli
2002: CRISPR term coined by other researchers who
identified similar repeats in various bacteria.
2005: First link of CRISPR to viral sequences.
2007: Industry researchers identify a strain of bacteria
used in making yogurt that was resistant to certain
viruses. Sequencing showed the bacteria had gained
viral DNA in CRISPR repeats. First result showing that
CRISPR conferred protection against viruses.

CS
Gene Editing - CRISPR
2012: Charpentier/Doudna/Zhang
Mechanism of CRISPR worked out and tweaked
so that researchers can modify the genome in

virtually any cell
CRISPRd GMOs (plants, animals, microbes)

Medical applications (correct defective disease
genes; introduce beneficial mutations, fight

pathogens, etc. )

CS
Gene Editing - CRISPR
CRISPR used to remove latent HIV from
genome in cultured cells (July 2014)
CRISPR engineered mushroom
(inactivate an oxidase gene

Non-browning variety)
**Bypasses USDA (2016)

CRISPR
2015 Doudna Zhang

Charpentier
CRISPR is less expensive

& faster than other methods
CRISPR
publications

CS
CRISPR
anti-viral immunity in bacteria
CRISPR is present in 40% of sequenced bacteria and 90% of sequenced Archea
Doudna lab UC Berkeley

CS
CRISPR as a tool for gene
editing
Works in prokaryotes
and eukaryotes
Gene of Interest is cut

at a specific site

CS
CRISPR Gene editing
NHEJ HDR
Imprecise Repair
Repair template
x x

CS
CRISPR-Cas9 as gene editing
tools

Proteins as Biotechnology Products
Use of proteins in manufacturing is a
time-tested technology
Beer brewing and winemaking
Cheese making
Recombinant DNA technology made

it possible to produce specific
proteins on demand
Enzymes
Hormones
Antibodies

Applications of Proteins in Industry
Medical applications
Food processing
Textiles and leather goods
Detergents
Paper manufacturing and recycling
Adhesives: natural glues
Bioremediation: treating pollution with proteins

Biotech Drugs and other medical applications
Produced through microbial fermentation or mammalian cell
culture
Complicated and time-consuming process
Once the method is determined produce large batches of the
protein products in bioreactors by growing the host cells that have
been transformed to contain the therapeutic gene of interest
Cells are stimulated to produce the target proteins through
precise culture conditions that include a balance of temp.,
oxygen, acidity, and other variables
At appropriate time the proteins are isolated from the cultures,
tested at every step of purification and formulated into
pharmaceutically active products

Protein Production
Production of proteins is a long and painstaking

process
Upstream processing includes the actual expression of
the protein in the cell
Downstream processing involves purification of the
protein and verification of the function; a stable means
of preserving the protein is also required

Upstream Processing
Protein Expression: The First Phase in Protein

Processing
Selecting the cell to be used as a protein source
Microorganisms
Fungi
Plants
Mammalian cell systems
Whole-animal production systems
Insect systems

Downstream Processing
Protein purification
Step 1: preparing an extract for purification
Protein must be harvested
Entire cell is harvested if protein is intracellular
Requires cell lysis to disrupt the cell wall and release the
protein
Methods include freeze/thaw; detergents; mechanical methods
mixture which releases the entire contents of the cell
After cells are ruptured organic alcohols and salts are added to
mixture
agents increase the interactions between protein molecules to
separate them from the mixture
Culture medium is collected if the protein is extracellular
because it is excreted into the culture

Protein purification
Step 2: stabilizing proteins in solution
Maintain low temperature and proper pH in buffering
solution
Add protease inhibitors and antimicrobrials to prevent
proteins from being digested
Important to remove these additives later during purification
process
Add additives to prevent foaming and shearing from
destroying the protein
These additives must be removed later
Copyright 2009 Pearson Education, Inc. 2013 Pearson Education, Inc.

Protein purification methods
Step 3: separating components in extract
Similarities between proteins allow them to be separated
from other macromolecules
Protein precipitation salts cause proteins to settle out of
solution
Differences between individual proteins are used to
separate target proteins from others
Filtration (size-based) separation methods
Membrane filtration
Microfiltration
Ultrafiltration
Centrifugation

Protein Purification Methods
Chromatography allows the sorting of proteins based
on size or by how they bind to or separate in various
substances
A. Long glass tubes are filled with resin beads and buffer
B. Then protein extract is added and flows through resin
beads
C. Depending on resin used proteins either stick to beads or
passes through glass column while beads act as filtration
system

Types of chromatography
Size Exclusion Chromatography
Uses gel beads with pores as filtering systems
Large protein molecules flow around beads and small protein
molecules pass through gel beads retarding their flow
Ion exchange chromatography
Relies on the charge of the protein
Proteins bind to resin beads in column due to the electrostatic
charge and contaminants pass through and out of the column
Affinity Chromtography
Relies on the ability of proteins to bind specifically and reversibly
to uniquely shaped compounds called ligands
After proteins have bound to resin, buffer solution is used to wash out
unbound molecules

SEC

Verification
The presence and concentration of the protein of
interest must be verified at each step of the
purification process
SDS-PAGE (polyacrylamide gel electrophoresis)
Western blotting
ELISA

SDS PAGE
Important to verify that target protein is not lost
during each stage of protein purification
SDS PAGE (polyacrylamide gel electrophoresis)
How do you visualize the proteins after running the
SDS/PAGE?
Coomassie stain - dye that combines with proteins so a colored
band results
Compare stained sample with known size marker to estimate size
of protein
During purification process the colored band representing the
protein should become increasingly intense showing that the
protein is not lost during the procedure

Polyacrylamide Gel Electrophoresis
Lanes 1 through 5 represents

Samples after progressive
Purification steps..

SDS/PAGE= Western blotting
Proteins are transferred from the SDS/PAGE to a nitrocellulose
membrane using electrical current
All sites on membrane are blocked so that the antibody will not
bind to them nonspecifically
Primary antibody is added and incubated with the membrane
If there are any antibodies present that are directed against one
or more of the blotted antigens (proteins on the membrane) those
antibodies will bind to the protein and the other antibodies will be
washed away at end of incubation
To detect antibodies that have bound to protein a secondary
anti-immunoglobulin antibody coupled to a reporter group
(alkaline phosphatase) are added to the membrane
Excess secondary antibody is washed off the membrane
Substrate is added that precipitates upon reaction with
conjugate resulting in visible band where primary antibody is
bound to the protein

ELISA
Enzyme linked immunosorbent assay method
Used to detect specific proteins
Needs 2 antibodies
Procedure takes place on a multiwell plate
Antibody 1 to capture the unique protein is plated on multiwell ELISA
plate and then the protein is added to the plate and then there are
several washes and blocking steps
Antibody 2 attached to an enzyme is added and addition of
substrate allows colored reaction to occur if antibody has bound
to the protein

ELISA / Western blot
Sandwich ELISA
Direct ELISA / Western blot

Analytical methods
High-Performance liquid chromatography (HPLC) uses

high pressure to force the extract through the column in a
shorter time
Mass spectrometry (mass spec) highly sensitive method
used to detect trace elements
Used on the outflow of HPLC systems
Mass spec does THREE things:
a. Suspend sample molecule into charged gas phase
b. Separate molecules based on mass-charge ratios by
acceleration down a narrow tube
c. Detect separated ions
(readout is produced which indicates identity and size of most of
proteins analyzed)

Postpurification Analysis Methods
Protein Sequencing
Must determine the primary structure, the sequence of
amino acids
Mass spec method is used in which peptide masses are identified by
their unique signatures
X-ray Crystallography
Used to determine the complex tertiary and quaternary
structures
Requires pure crystals of proteins, dehydrated from solutions
When exposed to x-rays, a pure protein creates specific shadow
patterns based on its configuration
Computer analysis of the patterns allows the generation of ribbon
diagrams

Preserving Proteins
Once protein of interest is isolated, collected and
purified it must be saved to preserve its activity
Lyophilization (freeze-drying)
Protein, usually a liquid product, is first frozen
A vacuum is used to hasten the evaporation of water from
the fluid
Will maintain protein structure and can be stored at room
temperature for long periods of time

Scale-Up of Protein Purification
Protocols are usually designed in the laboratory
on a small scale
Must be scaled up for production
Process is approved by FDA so must make sure

laboratory procedures can be scaled up

Lec 7 - Recombinant DNA Techniques

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Lec 7 - Recombinant DNA Techniques

Uploaded by

Copyright:

Available Formats

What would you need to do biotechnology?

Method for modifying DNAs

Copyright 2009 Pearson Education, Inc.

Method for identifying successfully modified organism

Copyright 2009 Pearson Education, Inc.

Agarose melted in a buffer and poured into a horizontal tray

Copyright 2009 Pearson Education, Inc.

To run a gel, it is submerged in a buffer solution that

Copyright 2009 Pearson Education, Inc.

Copyright 2009 Pearson Education, Inc.

Cut cloned gene with restriction enzymes to pinpoint location

Copyright 2009 Pearson Education, Inc.

*** Note: These days scientists use bioinformatic software to

Original Sanger method:

Copyright 2009 Pearson Education, Inc.

DNA synthesis occurs in the 5 to 3 direction.

Copyright 2009 Pearson Education, Inc.

Copyright 2009 Pearson Education, Inc.

Copyright 2009 Pearson Education, Inc.

Copyright 2009 Pearson Education, Inc.

Copyright 2009 Pearson Education, Inc.

Allows >500 nucleotides to be sequenced per reaction

2013 Pearson Education,

Copyright 2009 Pearson Education, Inc.

Copyright 2009 Pearson Education, Inc.

Copyright 2009 Pearson Education, Inc.

Copyright 2009 Pearson Education, Inc.

Copyright 2009 Pearson Education, Inc.

Designed to produce highly accurate and long stretches of DNA

2013 Pearson Education,

1 million-100 million reactions per run

Copyright 2009 Pearson Education, Inc.

Cross between biotech and engineering tech

Copyright 2009 Pearson Education, Inc.

DNA synthesis not required!

Copyright 2009 Pearson Education, Inc.

Copyright 2009 Pearson Education, Inc.

Copyright 2009 Pearson Education, Inc.

RED = ABL (chr 9)

CYP genes involved in metabolism of

Copyright 2009 Pearson Education, Inc.

Copyright 2009 Pearson Education, Inc. 33

Copyright 2009 Pearson Education, Inc.

Copyright 2009 Pearson Education, Inc.

Copyright 2009 Pearson Education, Inc.

Copyright 2009 Pearson Education, Inc.

Copyright 2009 Pearson Education, Inc.

Copyright 2009 Pearson Education, Inc.

Copyright 2009 Pearson Education, Inc.

so that researchers can modify the genome in

CRISPRd GMOs (plants, animals, microbes)

genes; introduce beneficial mutations, fight

Copyright 2009 Pearson Education, Inc.

(inactivate an oxidase gene

Copyright 2009 Pearson Education, Inc.

2015 Doudna Zhang

CRISPR is less expensive

Copyright 2009 Pearson Education, Inc.

CRISPR is present in 40% of sequenced bacteria and 90% of sequenced Archea

Doudna lab UC Berkeley

Gene of Interest is cut

Copyright 2009 Pearson Education, Inc.

Copyright 2009 Pearson Education, Inc.

Copyright 2009 Pearson Education, Inc.