BIOLEP

DNA barcoding of Lepidoptera of the Area de Conservacion Guanacaste (ACG), Costa Rica John J. Wilson
PhD Advisor: Paul Hebert Collaborators: Mehrdad Hajibabaei, Dan Janzen, Winnie Hallwachs

Why Barcode Tropical Lepidoptera ???

Current state of Lepidoptera taxonomy

Worldwide distributed, charismatic group with extensive previous taxonomic attention - yet still unknown 165,000 described species out of estimated 280,000 - 1.4 million global total Higher taxonomic relationships are still shrouded in mystery

Macrolepidoptera represent a benchmark group for the encyclopaedia of life

Area de Conservacion Guanacaste 9,600 species of Macrolepidoptera As many species as in North America

156,000 hectare reserve

Area de Conservacion Guanacaste

Mission of BioLep: Complete inventory of non-leaf-mining lepidopteran species in the ACG DNA barcodes facilitate: -Species identifications -Species discoveries -Exploration of higher taxonomic relationships

DNA barcoding

Morphology

DNA Barcode
AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAATTGGAACTTCTC TAAGTTTATTAATTCGAGCAGAATTAGGTAACCCCGGATCACTAATTGGG GATGATCAAATTTATAATACTATTGTAACAGCTCATGCATTTATTATAAT TTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAA TTCCCCTTATATTAGGGGCCCCTGACATAGCTTTTCCGCGAATAAATAAT ATAAGATTTTGATTATTACCCCCTTCTATTATATTATTAATTTCAAGAAG AATTGTAGAAAATGGAGCAGGAACTGGATGAACTGTGTACCCACCTTTAT CCTCAAATATTGCACATGGGGGAAGATCTGTAGATTTAGCAATTTTTTCC TTACATTTGGCGGGAATTTCATCAATTTTAGGGGCTATTAATTTTATTAC AACAATTATTAATATACGATTAAATAACATATCATTTGATCAAATACCAT TATTTGTTTGAGCTGTGGGAATTACTGCATTTTTACTTTTACTTTCATTG CCTGTTTTAGCGGGAGCTATTACTATATTATTAACAGATCGAAATTTAAA TACTTCATTTTTTGATCCTGCTGGAGGAGGTGACCCTATTTTATATCAAC ATTTATTT

DNA Barcode

Barcode collection: 1

100 km

heavy caterpillar inventory heavy light trapping

Barcode collection: 2 Area de Conservacin Guanacaste

Specimen

GPS record

Photo

www. boldsystems .org

Light trapping of specimens

Leg sample

University of Guelph
DNA extraction PCR Sequencing DNA Barcode

ACTGTCTA GenBank

Barcode collection: 3

Applying DNA barcoding to the taxonomic inventory

Species identification

Species identification: popular approach

Phenetic Thresholds Genetic Yardstick

2%

Species Identification: test family Saturniidae Saturniidae has good coverage in public databases due to published project of Hajibabaei et al. (2006) PNAS - 73 ACG species. 170 Saturniid BioLep Specimens (37 species)
70.0

Correct ID
60.0 50.0 Percentage 0.0 30.0 20.0 10.0 0.0 BOLD 57.6

62.

False Positive nknown

37.1 37.6

BOLD www.boldsystems.org Closest match in Reference dataset within a limit of 5% sequence divergence GenBank www.ncbi.nlm.nih.gov Best BLAST hit

5.3 0.0 GenBank Database Search

Species identification: alternative approaches

Characteristic Attribute Organization System

1 1 0 1 0
NODE GROUP POS STATE CONF 0 0 90 C 1 0 0 171 T 1 0 1 90 T 1 0 1 171 A 1 1 0 108 A 1 1 0 153 T 1 1 1 108 T 1 1 1 153 A 1

1. Cladogram

2. Search for characteristic attributes with CAOS algorithm 3. Find unique combinations of character states

Taxa A B C

Nucleotide Position 90 108 153 171 C T A T T T T A T A A A

Species identification: alternative approaches

Maximum Likelihood

Applying DNA barcoding to the taxonomic inventory

Species identification

Species discovery

Species discovery: hypothesis generation

Species discovery: hypothesis testing

Every putative species is a research hypothesis

Represents a generalization from which future observations are predicted. When future observations are made, the hypothesis is either corroborated or refuted. Species discovery hypotheses are subject to testing through concordance with independent sources of data.

Species discovery: hypothesis testing

Baum & Shaw (1995)

Species discovery: test family Nymphalidae

Adelpha basiloidesDHJ01 Adelpha Adelpha basiloidesDHJ01 Adelpha basiloidesDHJ01 basiloides Adelpha basiloidesDHJ01 Adelpha basiloidesDHJ01 (Bates 1865) Adelpha basiloidesDHJ02 Adelpha basiloidesDHJ02 Adelpha basiloidesDHJ02 Adelpha basiloidesDHJ02 Adelpha basiloidesDHJ02 Adelpha cytherea Adelpha melanthe Adelpha phylaca Adelpha zina Adelpha zinaDHJ01 (Hewitson 1867) Adelpha zinaDHJ01 Adelpha zinaDHJ01 Adelpha zinaDHJ01 Adelpha zinaDHJ01 Adelpha zinaDHJ02 Adelpha zinaDHJ02 Adelpha zinaDHJ02 Taygetis andromedaDHJ01 Taygetis Taygetis andromedaDHJ01 Taygetis andromedaDHJ01 andromeda Taygetis andromedaDHJ01 Taygetis andromedaDHJ02 (Cramer 1779) Taygetis andromedaDHJ02 Taygetis andromedaDHJ02 Taygetis andromedaDHJ02 Taygetis andromedaDHJ02 Taygetis virgilia Taygetis kerea Memphis aulica Memphis cleomestra Memphis forreriDHJ03 Memphis forreriDHJ03 Memphis forreri Memphis forreriDHJ03 (Godman & Memphis forreriDHJ03 Memphis forreriDHJ03 Salvin 1884) Memphis forreriDHJ04 Memphis forreriDHJ04 Memphis forreriDHJ04 Memphis forreriDHJ04 Memphis forreriDHJ04 Memphis moruusDHJ01 Memphis moruusDHJ01 Memphis moruusDHJ01 Memphis moruus Memphis moruusDHJ01 Memphis moruusDHJ01 (Fabricius 1775) Memphis moruusDHJ02 Memphis moruusDHJ02 Memphis moruusDHJ02 Memphis moruusDHJ02 Memphis moruusDHJ02 Zaretis isidoraDHJ01 Zaretis isidoraDHJ01 Zaretis isidoraDHJ01 Zaretis isidoraDHJ01 Zaretis isidora Zaretis isidoraDHJ01 Zaretis isidoraDHJ02 (Cramer 1779) Zaretis isidoraDHJ02 Zaretis isidoraDHJ02 Zaretis isidoraDHJ02 Zaretis isidoraDHJ02 Siderone marthesia Siderone Siderone marthesia Siderone marthesia martesia Siderone marthesia Siderone marthesia (Cramer 1777) Siderone marthesia Siderone marthesia Siderone marthesia Siderone marthesia Siderone marthesia Prepona laertes Siderone marthesia Siderone marthesia (Hubner [1811]) Prepona laertesDHJ01 Prepona laertesDHJ01 Prepona laertesDHJ02 Prepona laertesDHJ02 Biblis hyperiaDHJ01 Biblis hyperiaDHJ01 Biblis hyperiaDHJ01 Biblis hyperiaDHJ01 Biblis hyperia Biblis hyperiaDHJ01 Biblis hyperiaDHJ02 (Cramer 1782) Biblis hyperiaDHJ02 Biblis hyperiaDHJ02 Biblis hyperiaDHJ03 Biblis hyperiaDHJ03 Biblis hyperiaDHJ03 Biblis hyperiaDHJ03 Biblis hyperiaDHJ03 Chlosyne Janzen01 Chlosyne Janzen01 Chlosyne Chlosyne Janzen01 Chlosyne Janzen01 Janzen 1 & 2 Chlosyne Janzen01 Chlosyne Janzen02 Chlosyne Janzen02 Chlosyne Janzen02 Chlosyne Janzen02 Chlosyne laciniaDHJ01 Chlosyne laciniaDHJ01 Chlosyne lacinia Chlosyne laciniaDHJ02 Chlosyne laciniaDHJ02 (Geyer 1837) Chlosyne laciniaDHJ02 Chlosyne laciniaDHJ02 Chlosyne laciniaDHJ02 Chlosyne gaudialis Chlosyne erodyle Pteronymia latillaDHJ01 Pteronymia Pteronymia latillaDHJ01 Pteronymia latillaDHJ01 latilla (Hewitson Pteronymia latillaDHJ02 Pteronymia latillaDHJ02 [1855]) Pteronymia latillaDHJ02 Pteronymia latillaDHJ02 Pteronymia latillaDHJ02 Pteronymia picta Dynamine mylittaDHJ01 Dynamine mylitta Dynamine mylittaDHJ01 Dynamine mylittaDHJ02 (Cramer 1782) Dynamine mylittaDHJ02 Dynamine mylittaDHJ02 Dynamine mylittaDHJ02 Dynamine mylittaDHJ02 Dynamine sosthenes Caligo atreus Caligo eurilochus Caligo telamoniusDHJ01 Caligo telamoniusDHJ01 Caligo Caligo telamoniusDHJ01 Caligo telamoniusDHJ01 telamonius Caligo telamoniusDHJ01 Caligo telamoniusDHJ02 (Felder & Caligo telamoniusDHJ02 Caligo telamoniusDHJ02 Felder 1862) Caligo telamoniusDHJ02 Caligo telamoniusDHJ02

15 putative species identified by the barcode sequence pattern (from the ACG reared project)

Next steps: Sequencing nuclear gene regions -wingless, ITS+28S, other nuclear introns Morphology genitalia dissections

uture steps: Include specimens from wider geographical area Compare with type specimens

5 changes
Figure 3: One of 200 most parsimonius cladograms inferred from barcode sequences showing 15 potential new Nymphalidae species. Converted to a phylogram to visualize number of nucleotide changes supporting the branch es.

Species discovery: testing nuclear gene regions Cytochrome c oxidase I

S101778 S101780 S103496 S103497 S103505 S103850 S103656 S103009

Wingless protein
S101778 S101780 S103496 S103497 S103850 S103505 S103656 S103009 S102320 S102321 S103011

Rothschildia lebeau

S102320 S102321 Copaxa rufinans S103011 S101781 S102322 Caio championi S104088 S104089 S101784 S102789 S103014 S104085 Othorene purpurascens S104338 S104337 S102312 S102308 S103654 S102309 S103140 S103399 S103507 S103508 S103846 Rothschildia lebeau S103397 S103398 S103509 S103928 S103494 S103510 S104095 S103655 S103847 Rothschildia lebeau S102310 S102311 S102786 S102787 S102788 S103143 Adeloneivaia jason S103400 S103492 S103842 S103843 S103844 S103926 S102313 S103493 Citheronia bellavista S103950 S104086 S104087 S102314 S102315 S102316 S102317 S102318 Eacles ormondei S102795 S102796 S102797 S103010 S102319 Enyo1 Enyo2 Manduca1 Manduca2 S103401 S103848 Eacles imperialis S104084 S103495 S103504 Eacles masoni S103849 S103141 S103142 S103490 S103491 Adeloneivaia quadrilineata S103841 S104339 S103845 S104094 S104340 10 changes

S101781 S102322 S104089 S104088

S101784 S102312 S102789 S103014 S104085 S104337 S104338 S102310 S102311 S102786 S102787 S103143 S103844 S103926 S102788 S103400 S103492 S103842 S103843 S103141 S103491 S103490 S103142 S104339 S103841 S103845 S102313 S103950 S103493 S104086 S104087 S102314 S102315 S102316 S102317 S102318 S102319 S102795 S102796 S102797 S103010 S103401 S103848 S104084 S103495 S103504 S103849 S104340

S104094 5 changes

S104095

S102309 S103510

S102308 S103654 S103655 S103847 S103140 S103397 S103507 S103509 S103508 S103846 S103928 S103398 S103399 S103494

10 changes

5 changes

Synonymizing species: test study Atteva

One Species? Two Names?

Dry orest Atteva punctella/ ergatica

Atteva punctella (Cramer, [1781])

Rain orest

Atteva ergatica (Walsingham, 1914)

Synonymizing species: test study Atteva

Next steps: Morphological examination Comparison with A. ergatica holotype in BMNH

Applying DNA barcoding to the taxonomic inventory

Species identification

Species discovery

Deeper hierarchical relationships

Phylogenetic utility: questions

What is the phylogenetic information content of these sequences, and will these data contribute to a solid image of the tree of life? (Savolainen et al. 2005; Vogler & Monaghan 2006) How would any phylogenetic reconstruction be affected by taxa sampling? (Savolainen et al. 2005; Tautz et al. 2003)

Phylogenetic utility: testing with known phylogenies

If the COI dataset is useful for phylogenetic analysis then the barcode analysis must consistently recover test clades hypothesized in independently derived cladograms
Phylogeny Taxonomy Blue Yellow Red Green Orange Sister species Sister species Genus Subfamily Family

Build COI cladogram and look for concordant branches

Phylogenetic utility: taxa addition

If increased sampling of taxa is advantageous to the recovery of the tree of life then the addition of terminals should increase the recovery and support of test clades
Test clades from literature: Genus1 Genus2

Few taxa: 5 terminals 3 terminals

Increased taxa: 8 terminals 7 terminals

Summary of research goals BIOLEP INVENTORY ENABLES THE OLLOWING:

 Testing the hypothesis that species can be identified using the barcoding technique
Effect of different approaches: phenetic, character-based, likelihood

 Investigating the usefulness of DNA barcodes in species discovery (and uncovering synonymy)
Ability to produce corroborated robust species hypotheses tested through independent sources of data (nuclear genes) Explore different delimitation approaches within the framework of the phylogenetic species concept

 Testing the phylogenetic utility of barcode characters

Effect of increased taxa sampling

Acknowledgements

Laboratory
Stephanie Kirk, Lynne Oslach, Becky Cowling, Chris Grainger, Angela Holliss, Shana Hayter & Luiqhong Lu

Database & Analysis

Greg Downs, Riadul Mannan & Sujeevan Ratnasingham

Funding & Support

Gordon and Betty Moore oundation and NSERC to PDN Hebert, NS and Wege oundation to DH Janzen and W Hallwachs

Guidance
Mehrdad Hajibabaei, Dan Janzen, Jean- rancois Landry, Rodolphe Rougerie, Hebert Lab Grad Students, DNA Barcoding Discussion Group & IB Science Communication Class

Questions